ID: 1132712664

View in Genome Browser
Species Human (GRCh38)
Location 16:1276463-1276485
Sequence GACCTGGTGGGCATTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132712664_1132712682 20 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712682 16:1276506-1276528 GGAACAACAGAAGGAGGTCAGGG No data
1132712664_1132712677 -2 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712677 16:1276484-1276506 TCATTCTCGGGGACGGGAGCTGG No data
1132712664_1132712683 27 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data
1132712664_1132712674 -9 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712674 16:1276477-1276499 CACCAGGTCATTCTCGGGGACGG No data
1132712664_1132712675 -8 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712675 16:1276478-1276500 ACCAGGTCATTCTCGGGGACGGG No data
1132712664_1132712678 -1 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712664_1132712679 11 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712679 16:1276497-1276519 CGGGAGCTGGGAACAACAGAAGG No data
1132712664_1132712681 19 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712681 16:1276505-1276527 GGGAACAACAGAAGGAGGTCAGG No data
1132712664_1132712680 14 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132712664 Original CRISPR GACCTGGTGGGCATTGTGGG GGG (reversed) Intergenic