ID: 1132712666

View in Genome Browser
Species Human (GRCh38)
Location 16:1276465-1276487
Sequence ATGACCTGGTGGGCATTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132712666_1132712681 17 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712681 16:1276505-1276527 GGGAACAACAGAAGGAGGTCAGG No data
1132712666_1132712675 -10 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712675 16:1276478-1276500 ACCAGGTCATTCTCGGGGACGGG No data
1132712666_1132712680 12 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data
1132712666_1132712678 -3 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712666_1132712683 25 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data
1132712666_1132712679 9 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712679 16:1276497-1276519 CGGGAGCTGGGAACAACAGAAGG No data
1132712666_1132712677 -4 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712677 16:1276484-1276506 TCATTCTCGGGGACGGGAGCTGG No data
1132712666_1132712682 18 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712682 16:1276506-1276528 GGAACAACAGAAGGAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132712666 Original CRISPR ATGACCTGGTGGGCATTGTG GGG (reversed) Intergenic