ID: 1132712673

View in Genome Browser
Species Human (GRCh38)
Location 16:1276476-1276498
Sequence CGTCCCCGAGAATGACCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132712673_1132712679 -2 Left 1132712673 16:1276476-1276498 CCACCAGGTCATTCTCGGGGACG No data
Right 1132712679 16:1276497-1276519 CGGGAGCTGGGAACAACAGAAGG No data
1132712673_1132712682 7 Left 1132712673 16:1276476-1276498 CCACCAGGTCATTCTCGGGGACG No data
Right 1132712682 16:1276506-1276528 GGAACAACAGAAGGAGGTCAGGG No data
1132712673_1132712683 14 Left 1132712673 16:1276476-1276498 CCACCAGGTCATTCTCGGGGACG No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data
1132712673_1132712681 6 Left 1132712673 16:1276476-1276498 CCACCAGGTCATTCTCGGGGACG No data
Right 1132712681 16:1276505-1276527 GGGAACAACAGAAGGAGGTCAGG No data
1132712673_1132712680 1 Left 1132712673 16:1276476-1276498 CCACCAGGTCATTCTCGGGGACG No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132712673 Original CRISPR CGTCCCCGAGAATGACCTGG TGG (reversed) Intergenic