ID: 1132712674

View in Genome Browser
Species Human (GRCh38)
Location 16:1276477-1276499
Sequence CACCAGGTCATTCTCGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132712660_1132712674 9 Left 1132712660 16:1276445-1276467 CCCCTGGGGGTGTTGTGGCCCCC No data
Right 1132712674 16:1276477-1276499 CACCAGGTCATTCTCGGGGACGG No data
1132712661_1132712674 8 Left 1132712661 16:1276446-1276468 CCCTGGGGGTGTTGTGGCCCCCC No data
Right 1132712674 16:1276477-1276499 CACCAGGTCATTCTCGGGGACGG No data
1132712657_1132712674 21 Left 1132712657 16:1276433-1276455 CCACGACCACTTCCCCTGGGGGT No data
Right 1132712674 16:1276477-1276499 CACCAGGTCATTCTCGGGGACGG No data
1132712665_1132712674 -10 Left 1132712665 16:1276464-1276486 CCCCCACAATGCCCACCAGGTCA No data
Right 1132712674 16:1276477-1276499 CACCAGGTCATTCTCGGGGACGG No data
1132712658_1132712674 15 Left 1132712658 16:1276439-1276461 CCACTTCCCCTGGGGGTGTTGTG No data
Right 1132712674 16:1276477-1276499 CACCAGGTCATTCTCGGGGACGG No data
1132712652_1132712674 25 Left 1132712652 16:1276429-1276451 CCTGCCACGACCACTTCCCCTGG No data
Right 1132712674 16:1276477-1276499 CACCAGGTCATTCTCGGGGACGG No data
1132712662_1132712674 7 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712674 16:1276477-1276499 CACCAGGTCATTCTCGGGGACGG No data
1132712664_1132712674 -9 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712674 16:1276477-1276499 CACCAGGTCATTCTCGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132712674 Original CRISPR CACCAGGTCATTCTCGGGGA CGG Intergenic