ID: 1132712678

View in Genome Browser
Species Human (GRCh38)
Location 16:1276485-1276507
Sequence CATTCTCGGGGACGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132712664_1132712678 -1 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712668_1132712678 -5 Left 1132712668 16:1276467-1276489 CCACAATGCCCACCAGGTCATTC No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712666_1132712678 -3 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712667_1132712678 -4 Left 1132712667 16:1276466-1276488 CCCACAATGCCCACCAGGTCATT No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712665_1132712678 -2 Left 1132712665 16:1276464-1276486 CCCCCACAATGCCCACCAGGTCA No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712660_1132712678 17 Left 1132712660 16:1276445-1276467 CCCCTGGGGGTGTTGTGGCCCCC No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712658_1132712678 23 Left 1132712658 16:1276439-1276461 CCACTTCCCCTGGGGGTGTTGTG No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712661_1132712678 16 Left 1132712661 16:1276446-1276468 CCCTGGGGGTGTTGTGGCCCCCC No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712657_1132712678 29 Left 1132712657 16:1276433-1276455 CCACGACCACTTCCCCTGGGGGT No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data
1132712662_1132712678 15 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712678 16:1276485-1276507 CATTCTCGGGGACGGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132712678 Original CRISPR CATTCTCGGGGACGGGAGCT GGG Intergenic