ID: 1132712680

View in Genome Browser
Species Human (GRCh38)
Location 16:1276500-1276522
Sequence GAGCTGGGAACAACAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132712668_1132712680 10 Left 1132712668 16:1276467-1276489 CCACAATGCCCACCAGGTCATTC No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data
1132712676_1132712680 -2 Left 1132712676 16:1276479-1276501 CCAGGTCATTCTCGGGGACGGGA No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data
1132712667_1132712680 11 Left 1132712667 16:1276466-1276488 CCCACAATGCCCACCAGGTCATT No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data
1132712672_1132712680 2 Left 1132712672 16:1276475-1276497 CCCACCAGGTCATTCTCGGGGAC No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data
1132712662_1132712680 30 Left 1132712662 16:1276447-1276469 CCTGGGGGTGTTGTGGCCCCCCA No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data
1132712664_1132712680 14 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data
1132712666_1132712680 12 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data
1132712673_1132712680 1 Left 1132712673 16:1276476-1276498 CCACCAGGTCATTCTCGGGGACG No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data
1132712665_1132712680 13 Left 1132712665 16:1276464-1276486 CCCCCACAATGCCCACCAGGTCA No data
Right 1132712680 16:1276500-1276522 GAGCTGGGAACAACAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132712680 Original CRISPR GAGCTGGGAACAACAGAAGG AGG Intergenic