ID: 1132712683

View in Genome Browser
Species Human (GRCh38)
Location 16:1276513-1276535
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132712668_1132712683 23 Left 1132712668 16:1276467-1276489 CCACAATGCCCACCAGGTCATTC No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data
1132712673_1132712683 14 Left 1132712673 16:1276476-1276498 CCACCAGGTCATTCTCGGGGACG No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data
1132712672_1132712683 15 Left 1132712672 16:1276475-1276497 CCCACCAGGTCATTCTCGGGGAC No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data
1132712676_1132712683 11 Left 1132712676 16:1276479-1276501 CCAGGTCATTCTCGGGGACGGGA No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data
1132712664_1132712683 27 Left 1132712664 16:1276463-1276485 CCCCCCACAATGCCCACCAGGTC No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data
1132712667_1132712683 24 Left 1132712667 16:1276466-1276488 CCCACAATGCCCACCAGGTCATT No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data
1132712665_1132712683 26 Left 1132712665 16:1276464-1276486 CCCCCACAATGCCCACCAGGTCA No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data
1132712666_1132712683 25 Left 1132712666 16:1276465-1276487 CCCCACAATGCCCACCAGGTCAT No data
Right 1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132712683 Original CRISPR CAGAAGGAGGTCAGGGAGCC CGG Intergenic