ID: 1132713134

View in Genome Browser
Species Human (GRCh38)
Location 16:1278126-1278148
Sequence TCTGGGGCCCCTCCACCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132713127_1132713134 3 Left 1132713127 16:1278100-1278122 CCAGCCTCGGTGAGAGCTGCTCC No data
Right 1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG No data
1132713122_1132713134 19 Left 1132713122 16:1278084-1278106 CCTGGGCCGTCTGTCCCCAGCCT No data
Right 1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG No data
1132713121_1132713134 26 Left 1132713121 16:1278077-1278099 CCTGCAGCCTGGGCCGTCTGTCC No data
Right 1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG No data
1132713128_1132713134 -1 Left 1132713128 16:1278104-1278126 CCTCGGTGAGAGCTGCTCCTCCT No data
Right 1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG No data
1132713124_1132713134 13 Left 1132713124 16:1278090-1278112 CCGTCTGTCCCCAGCCTCGGTGA No data
Right 1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG No data
1132713125_1132713134 5 Left 1132713125 16:1278098-1278120 CCCCAGCCTCGGTGAGAGCTGCT No data
Right 1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG No data
1132713126_1132713134 4 Left 1132713126 16:1278099-1278121 CCCAGCCTCGGTGAGAGCTGCTC No data
Right 1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132713134 Original CRISPR TCTGGGGCCCCTCCACCAAG AGG Intergenic
No off target data available for this crispr