ID: 1132716257

View in Genome Browser
Species Human (GRCh38)
Location 16:1291571-1291593
Sequence ACCGGGAAGCTGCTGATCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132716250_1132716257 1 Left 1132716250 16:1291547-1291569 CCCTCGCCCAGCTCCTGAGATCT No data
Right 1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG No data
1132716252_1132716257 -5 Left 1132716252 16:1291553-1291575 CCCAGCTCCTGAGATCTTACCGG No data
Right 1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG No data
1132716245_1132716257 25 Left 1132716245 16:1291523-1291545 CCTCTTAGTGTGCCTGCTCCAGC No data
Right 1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG No data
1132716246_1132716257 13 Left 1132716246 16:1291535-1291557 CCTGCTCCAGCCCCCTCGCCCAG No data
Right 1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG No data
1132716248_1132716257 3 Left 1132716248 16:1291545-1291567 CCCCCTCGCCCAGCTCCTGAGAT No data
Right 1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG No data
1132716254_1132716257 -6 Left 1132716254 16:1291554-1291576 CCAGCTCCTGAGATCTTACCGGG No data
Right 1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG No data
1132716247_1132716257 7 Left 1132716247 16:1291541-1291563 CCAGCCCCCTCGCCCAGCTCCTG No data
Right 1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG No data
1132716251_1132716257 0 Left 1132716251 16:1291548-1291570 CCTCGCCCAGCTCCTGAGATCTT No data
Right 1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG No data
1132716249_1132716257 2 Left 1132716249 16:1291546-1291568 CCCCTCGCCCAGCTCCTGAGATC No data
Right 1132716257 16:1291571-1291593 ACCGGGAAGCTGCTGATCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132716257 Original CRISPR ACCGGGAAGCTGCTGATCAC CGG Intergenic
No off target data available for this crispr