ID: 1132719729

View in Genome Browser
Species Human (GRCh38)
Location 16:1309767-1309789
Sequence GCCCGAGGTGAGCGCGTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 82}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132719722_1132719729 3 Left 1132719722 16:1309741-1309763 CCGCTACGCTCGCCGGGGCTGCG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1132719729 16:1309767-1309789 GCCCGAGGTGAGCGCGTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 82
1132719725_1132719729 -9 Left 1132719725 16:1309753-1309775 CCGGGGCTGCGGCCGCCCGAGGT 0: 1
1: 0
2: 2
3: 12
4: 215
Right 1132719729 16:1309767-1309789 GCCCGAGGTGAGCGCGTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 82
1132719720_1132719729 8 Left 1132719720 16:1309736-1309758 CCTGTCCGCTACGCTCGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1132719729 16:1309767-1309789 GCCCGAGGTGAGCGCGTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 82
1132719717_1132719729 11 Left 1132719717 16:1309733-1309755 CCACCTGTCCGCTACGCTCGCCG 0: 1
1: 0
2: 0
3: 2
4: 29
Right 1132719729 16:1309767-1309789 GCCCGAGGTGAGCGCGTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 82
1132719713_1132719729 25 Left 1132719713 16:1309719-1309741 CCCCGCTCGGTCCTCCACCTGTC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1132719729 16:1309767-1309789 GCCCGAGGTGAGCGCGTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 82
1132719715_1132719729 23 Left 1132719715 16:1309721-1309743 CCGCTCGGTCCTCCACCTGTCCG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1132719729 16:1309767-1309789 GCCCGAGGTGAGCGCGTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 82
1132719712_1132719729 28 Left 1132719712 16:1309716-1309738 CCGCCCCGCTCGGTCCTCCACCT 0: 1
1: 0
2: 0
3: 25
4: 285
Right 1132719729 16:1309767-1309789 GCCCGAGGTGAGCGCGTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 82
1132719714_1132719729 24 Left 1132719714 16:1309720-1309742 CCCGCTCGGTCCTCCACCTGTCC 0: 1
1: 0
2: 2
3: 23
4: 224
Right 1132719729 16:1309767-1309789 GCCCGAGGTGAGCGCGTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 82
1132719716_1132719729 14 Left 1132719716 16:1309730-1309752 CCTCCACCTGTCCGCTACGCTCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1132719729 16:1309767-1309789 GCCCGAGGTGAGCGCGTGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132719729 Original CRISPR GCCCGAGGTGAGCGCGTGCG GGG Intronic