ID: 1132724349

View in Genome Browser
Species Human (GRCh38)
Location 16:1332431-1332453
Sequence CTGGACACTCGCAGCCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132724349_1132724356 8 Left 1132724349 16:1332431-1332453 CCCAAAGGGCTGCGAGTGTCCAG No data
Right 1132724356 16:1332462-1332484 GACCAAGGGCAGGTGCGACCGGG No data
1132724349_1132724354 -2 Left 1132724349 16:1332431-1332453 CCCAAAGGGCTGCGAGTGTCCAG No data
Right 1132724354 16:1332452-1332474 AGCTGTATTCGACCAAGGGCAGG No data
1132724349_1132724352 -6 Left 1132724349 16:1332431-1332453 CCCAAAGGGCTGCGAGTGTCCAG No data
Right 1132724352 16:1332448-1332470 GTCCAGCTGTATTCGACCAAGGG No data
1132724349_1132724357 9 Left 1132724349 16:1332431-1332453 CCCAAAGGGCTGCGAGTGTCCAG No data
Right 1132724357 16:1332463-1332485 ACCAAGGGCAGGTGCGACCGGGG No data
1132724349_1132724360 11 Left 1132724349 16:1332431-1332453 CCCAAAGGGCTGCGAGTGTCCAG No data
Right 1132724360 16:1332465-1332487 CAAGGGCAGGTGCGACCGGGGGG No data
1132724349_1132724359 10 Left 1132724349 16:1332431-1332453 CCCAAAGGGCTGCGAGTGTCCAG No data
Right 1132724359 16:1332464-1332486 CCAAGGGCAGGTGCGACCGGGGG No data
1132724349_1132724351 -7 Left 1132724349 16:1332431-1332453 CCCAAAGGGCTGCGAGTGTCCAG No data
Right 1132724351 16:1332447-1332469 TGTCCAGCTGTATTCGACCAAGG No data
1132724349_1132724355 7 Left 1132724349 16:1332431-1332453 CCCAAAGGGCTGCGAGTGTCCAG No data
Right 1132724355 16:1332461-1332483 CGACCAAGGGCAGGTGCGACCGG No data
1132724349_1132724362 26 Left 1132724349 16:1332431-1332453 CCCAAAGGGCTGCGAGTGTCCAG No data
Right 1132724362 16:1332480-1332502 CCGGGGGGCCGCTGCGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132724349 Original CRISPR CTGGACACTCGCAGCCCTTT GGG (reversed) Intergenic
No off target data available for this crispr