ID: 1132727971

View in Genome Browser
Species Human (GRCh38)
Location 16:1346965-1346987
Sequence TGTGAAGGAGTCCTCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132727969_1132727971 2 Left 1132727969 16:1346940-1346962 CCATTTCACGCTGGAGGTAGAGC 0: 1
1: 0
2: 1
3: 4
4: 86
Right 1132727971 16:1346965-1346987 TGTGAAGGAGTCCTCCCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 77
1132727967_1132727971 8 Left 1132727967 16:1346934-1346956 CCGCTTCCATTTCACGCTGGAGG 0: 1
1: 0
2: 0
3: 13
4: 176
Right 1132727971 16:1346965-1346987 TGTGAAGGAGTCCTCCCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132727971 Original CRISPR TGTGAAGGAGTCCTCCCCGC CGG Intronic
900122422 1:1054490-1054512 TGTGACCGGCTCCTCCCCGCTGG + Exonic
909275146 1:73674243-73674265 GGTGAAGGAAACCTCCCAGCTGG - Intergenic
909774540 1:79467415-79467437 TGTGTAGTAGTCCTTCCCCCTGG + Intergenic
912420947 1:109542058-109542080 TGTGAAGGTGCCCTCCGTGCCGG - Intronic
919802440 1:201361804-201361826 TGTGAGGCAGTCCTGCCCTCTGG + Intronic
920698368 1:208199166-208199188 AGTGAAGTAGGCCTCCCTGCTGG + Intronic
921374997 1:214464556-214464578 TGTGAAGGAGAACTCACCGAAGG - Intronic
1063341579 10:5270401-5270423 TGAGAAGGAGTCGTCCAGGCTGG + Intergenic
1070162100 10:73873034-73873056 TGTGAAGAAAACCTCCACGCAGG - Exonic
1072923733 10:99597982-99598004 TGAGAAGCAGTCCTGCCTGCAGG - Intergenic
1074438563 10:113455127-113455149 TGGTAAGGGGCCCTCCCCGCTGG + Intergenic
1075076331 10:119353112-119353134 TGTGAAGAAGCCCTCTCTGCTGG + Intronic
1083609205 11:63997223-63997245 TGTCAAGGAGTTCTGCCAGCAGG + Exonic
1090874831 11:130779413-130779435 TGTGAAGGATTCTTCCCTGTTGG + Intergenic
1091059997 11:132452343-132452365 TGTGAAGGAGTCCCCACCAGTGG + Intronic
1093034663 12:14321048-14321070 TGTGAAAGAGTACCCCCAGCAGG - Intergenic
1101381918 12:104221033-104221055 TGTCAAGCAATCCTCCCAGCTGG - Intronic
1107838870 13:44435579-44435601 TGTGAAGGAGCCCGCGCCACCGG + Intronic
1112507771 13:99985322-99985344 GGTCCATGAGTCCTCCCCGCAGG + Exonic
1113839648 13:113351513-113351535 TGTGCAGGAGGCATCCCTGCCGG + Intronic
1119748130 14:77059000-77059022 TGTGCAGGTGTACTCCCTGCTGG + Intergenic
1119848224 14:77846683-77846705 TGGGAAGGAGGCCTTCCCACTGG + Intronic
1125935550 15:43632363-43632385 TCTGAAGCATTCCTCCCTGCAGG - Exonic
1129424158 15:75452415-75452437 TGTGAGGGAGTCCTCCATGGTGG - Intronic
1132635134 16:940435-940457 TGTGGGAGGGTCCTCCCCGCAGG + Intronic
1132727971 16:1346965-1346987 TGTGAAGGAGTCCTCCCCGCCGG + Intronic
1133916290 16:10112564-10112586 TGAGAAGAAGTACTCGCCGCTGG - Intronic
1141286788 16:82680150-82680172 TGTCCAGGAGTCCTTCCTGCAGG - Intronic
1141409225 16:83821188-83821210 TATGAAGGAGTCCTCTCTGCTGG + Intergenic
1141525313 16:84607247-84607269 TGTGTAGGAGTCCTCCAGGAAGG + Intronic
1142211636 16:88811346-88811368 TGTGCAGGCGTCCTTCCCGCAGG - Intronic
1142976902 17:3650570-3650592 TGAGAGGGAGCTCTCCCCGCTGG + Intronic
1150657773 17:67051572-67051594 TGAGAAGGAATCCTACCCACTGG + Intronic
1151809751 17:76431707-76431729 TTTCAAGCAGTCCCCCCCGCTGG - Intronic
1155172999 18:23280925-23280947 TGGGTGGGAGTCCTCCACGCAGG - Intronic
1164673320 19:30085556-30085578 GGTGCAGGAGTCCTCTCCCCGGG + Intergenic
929860081 2:45669394-45669416 TGTGAAGGAGTGCTCCCTCCGGG - Intronic
935062767 2:99622699-99622721 TTGGATGGAGTCCTCCCAGCAGG + Intronic
949045907 2:241872553-241872575 GGTGAGGGAGCCCTCCCCGCTGG - Exonic
1170208692 20:13826536-13826558 TGTGAAGGACTCCTCACTGGAGG - Intergenic
1170924705 20:20712432-20712454 TGTGAAGAAGTCCACCCAGAAGG - Exonic
1173926890 20:46787437-46787459 TGTGAAGGTGACCTCCCAGAAGG - Intergenic
1175778106 20:61665642-61665664 TGCGAACGAGTGCTCCCGGCAGG + Intronic
1176157136 20:63627449-63627471 TGTTCAGGCGTCCGCCCCGCAGG - Intergenic
1176272278 20:64242073-64242095 TGTGAGGGAGTGCTGGCCGCAGG + Exonic
1176428368 21:6562239-6562261 TGTGAAGCACTTCTCCCCGGAGG + Intergenic
1176643384 21:9327088-9327110 TGTGAAGGACTCTTCTCCCCTGG + Intergenic
1178237321 21:30857906-30857928 TGTGCAGCATTCCTTCCCGCAGG + Intergenic
1179703858 21:43170555-43170577 TGTGAAGCACTTCTCCCCGGAGG + Exonic
1185192756 22:49448966-49448988 TGGGAAGGACTCCTCCACCCCGG + Intronic
950433077 3:12962463-12962485 TGAGGAGGACTCCTCCCAGCTGG + Intronic
954156073 3:48685581-48685603 TGTGAAGGGGTCCTGCCCCAGGG + Intronic
954841494 3:53515617-53515639 TGTCATGGAGTCCTCCCTGCAGG + Intronic
960181451 3:114585171-114585193 AGTGTAGGAGTACTCCCTGCTGG + Intronic
966732256 3:183161176-183161198 TGTGAACAAGGCCTCCCTGCTGG + Intronic
967270555 3:187729085-187729107 GATGGTGGAGTCCTCCCCGCTGG + Exonic
1202743497 3_GL000221v1_random:77941-77963 TGTGAAGGACTCTTCTCCCCTGG - Intergenic
969207424 4:5657202-5657224 TGTGAAGCAGTCCTGACCACGGG - Intronic
969285943 4:6201816-6201838 TTTGAAGGCTTCCTCCCCGAAGG + Intergenic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
979974714 4:127182705-127182727 GGTGAAGGAATCCTCCCAGTGGG + Intergenic
983351042 4:166588666-166588688 TGTGAACCACTCCTCCCTGCTGG + Intergenic
985530346 5:430384-430406 TGTGACGGGGTCCTCCCAGAGGG - Intronic
986459954 5:7959890-7959912 TGTGAAGAAGCCCTGCCCACAGG - Intergenic
994639699 5:102391598-102391620 GGTGAAGGAGTCCTCTCTACAGG + Intronic
996661469 5:126008769-126008791 GGGGAAGGAGTCCTCTCCACAGG + Intergenic
1006680859 6:35795965-35795987 TGTGAAGGAGTCCATCCCCTGGG + Intronic
1013633886 6:112010359-112010381 TGTGAAGGAATCCCCCCAGAAGG - Intergenic
1018972904 6:168540854-168540876 TCTGAAGGAGGACTCCCTGCAGG + Intronic
1028838284 7:95397981-95398003 TGCGATGGAGTCCTTCCCACAGG - Intergenic
1029668369 7:102010720-102010742 AGTGAAGGAGTTCTGCCGGCGGG + Intronic
1032688373 7:134258336-134258358 TGTGAAGAAATGCTCCCCTCCGG - Exonic
1040467090 8:47705219-47705241 TGTGAAGGGGTCCTCCCTCAGGG + Intronic
1040965533 8:53077709-53077731 TGTGCAGGAGCCCACCCCGGGGG + Intergenic
1047713333 8:127573439-127573461 TGTGAAGGAGGGCTCCCCCAGGG + Intergenic
1047732628 8:127738937-127738959 CTCGACGGAGTCCTCCCCGCAGG + Exonic
1061205278 9:129159420-129159442 TGGGAAGCTGTCCTGCCCGCAGG - Intergenic
1203712133 Un_KI270742v1:107905-107927 TGTGAAGGACTCTTCTCCCCTGG - Intergenic
1185735037 X:2489873-2489895 CGTGAAGGCGTGCTCCCTGCTGG - Exonic
1195229424 X:102831153-102831175 AGTGAAGGAGTCCTACCTGAGGG - Intergenic
1197753263 X:129979947-129979969 GGTGGGGGAGACCTCCCCGCCGG - Intergenic
1199743533 X:150757548-150757570 TGGGAAGGAGTCCTGGCTGCAGG + Intronic
1200176805 X:154122713-154122735 TGTCAAGGAGGCCTCCCCTGAGG - Intergenic