ID: 1132728998

View in Genome Browser
Species Human (GRCh38)
Location 16:1351551-1351573
Sequence CGGCGAGGGCGGCCCGGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 754
Summary {0: 1, 1: 0, 2: 13, 3: 91, 4: 649}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132728998_1132729003 -9 Left 1132728998 16:1351551-1351573 CCGGGCCCGGGCCGCCCTCGCCG 0: 1
1: 0
2: 13
3: 91
4: 649
Right 1132729003 16:1351565-1351587 CCCTCGCCGTCAGCCGCCCCTGG 0: 1
1: 0
2: 2
3: 18
4: 130
1132728998_1132729013 22 Left 1132728998 16:1351551-1351573 CCGGGCCCGGGCCGCCCTCGCCG 0: 1
1: 0
2: 13
3: 91
4: 649
Right 1132729013 16:1351596-1351618 AAGCTGCACGAGAGAGAGAAGGG 0: 1
1: 0
2: 1
3: 38
4: 444
1132728998_1132729006 -1 Left 1132728998 16:1351551-1351573 CCGGGCCCGGGCCGCCCTCGCCG 0: 1
1: 0
2: 13
3: 91
4: 649
Right 1132729006 16:1351573-1351595 GTCAGCCGCCCCTGGCTCCACGG 0: 1
1: 0
2: 1
3: 13
4: 204
1132728998_1132729014 29 Left 1132728998 16:1351551-1351573 CCGGGCCCGGGCCGCCCTCGCCG 0: 1
1: 0
2: 13
3: 91
4: 649
Right 1132729014 16:1351603-1351625 ACGAGAGAGAGAAGGGCACTCGG 0: 1
1: 0
2: 1
3: 31
4: 286
1132728998_1132729012 21 Left 1132728998 16:1351551-1351573 CCGGGCCCGGGCCGCCCTCGCCG 0: 1
1: 0
2: 13
3: 91
4: 649
Right 1132729012 16:1351595-1351617 GAAGCTGCACGAGAGAGAGAAGG 0: 1
1: 0
2: 2
3: 32
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132728998 Original CRISPR CGGCGAGGGCGGCCCGGGCC CGG (reversed) Exonic
900077257 1:827583-827605 AGGCGGGGCCGGGCCGGGCCGGG + Intergenic
900123760 1:1060434-1060456 CGCCGAGGGGGGCCGGGGGCAGG + Intergenic
900126298 1:1070342-1070364 CGGCCAGGAGGGCCCAGGCCAGG - Intergenic
900189979 1:1349216-1349238 CGGGGGCGGCGGCCGGGGCCTGG - Intronic
900242452 1:1623536-1623558 CGGCGAGGGCGGCGTGGGCACGG + Exonic
900269157 1:1778377-1778399 CGGCCAGGGCGCCAAGGGCCAGG - Intronic
900314675 1:2050802-2050824 CGGCGAGGTCGCTGCGGGCCCGG + Intronic
900349493 1:2227972-2227994 CGGAGCGGGCGGCGCGGGGCGGG + Intergenic
900376001 1:2355074-2355096 CGGCGCGGGGGGCCCGCGCGGGG + Intronic
900382569 1:2392063-2392085 CGGGGAGGGCCGTCGGGGCCCGG + Intronic
900392292 1:2438929-2438951 CGGCGTGGGCTGCCCTGCCCAGG + Intronic
900393518 1:2443893-2443915 CAGCGAGGGCGGCGGGGGCGGGG - Intronic
900549540 1:3247403-3247425 AGGCGAGGGCGGCCGGGCCGAGG + Intronic
900594977 1:3476548-3476570 GGACTAGGGCTGCCCGGGCCTGG - Intronic
900663090 1:3795837-3795859 CAGCGGGGGCTGCCCGGGCGGGG - Intronic
900674837 1:3878690-3878712 CAGCGAGGCCGGCCCGGGAGAGG - Intronic
901455325 1:9359859-9359881 TGGCGGGGGCGGCCCGGTTCCGG + Intronic
901627285 1:10631454-10631476 GAGCGGGGGCGGCCCGGGCCTGG - Intergenic
901696545 1:11012297-11012319 CAGCGAGGGCGGGGCGGGGCGGG - Intergenic
902089613 1:13893002-13893024 CGGCGCGGGCCGCACGGGCGCGG - Intergenic
902169582 1:14599120-14599142 CGGCGGCGGCGGCCCCGGCCCGG + Exonic
902169584 1:14599126-14599148 CGGCGGCCCCGGCCCGGGCCCGG + Exonic
902702640 1:18183042-18183064 AGGCGAGGGCAGCCAGGCCCAGG - Intronic
902823246 1:18956248-18956270 CGGCGGGGGCTGCCCTGGCGGGG - Exonic
903190147 1:21651839-21651861 CGGCTCGCGCGGGCCGGGCCGGG - Intronic
903349943 1:22711298-22711320 CGGCGAGCGCCGCCCAGGGCTGG + Intronic
903822114 1:26111177-26111199 CGGCGGCGGCGGCGCGGGGCTGG - Intronic
904006595 1:27366328-27366350 CTGCGGGGGCGGCCGCGGCCGGG + Exonic
905037875 1:34929482-34929504 TGGTGCCGGCGGCCCGGGCCGGG + Exonic
905179160 1:36156040-36156062 CGGCGCGGACGGCGCGGGCGCGG + Intronic
905183188 1:36178850-36178872 GGGCGCGGGCGCCGCGGGCCGGG + Intronic
906225543 1:44118733-44118755 CTGCGAGGGCGGCGCAGGGCGGG + Intergenic
906525246 1:46489847-46489869 CGGAGGCGGCGGCGCGGGCCGGG + Intergenic
907051092 1:51330389-51330411 GGGCGCGGGCGGCGCGGGCTGGG - Intronic
907069186 1:51518944-51518966 CGGCGAGGGCCGCGCGGGGCGGG + Intronic
908272942 1:62437619-62437641 CGGCGAGGGCGCCCGGCGCGGGG + Intronic
908501207 1:64745199-64745221 CGGCGAGGGGGGCGCGGGCCTGG + Exonic
908738935 1:67307755-67307777 CGGCGAGTGAGGATCGGGCCGGG - Exonic
912381317 1:109249652-109249674 CGTCGGGGGCCGCCGGGGCCGGG + Intergenic
912798599 1:112707167-112707189 CGGGGAGGGCGGGCCCGGCAGGG + Intronic
913144509 1:115976474-115976496 GGGCCGGGGCGGGCCGGGCCGGG - Intergenic
913144511 1:115976479-115976501 CGGCGGGGCCGGGGCGGGCCGGG - Exonic
914490090 1:148146373-148146395 TGGCGGGCGCCGCCCGGGCCGGG - Intronic
914824756 1:151132762-151132784 CGGAGAGCGCGGGCCGGGCGGGG + Exonic
915544924 1:156591761-156591783 CGCCGGGGCCGGGCCGGGCCGGG + Exonic
918056003 1:181022679-181022701 AGGTGAAGGCGGCCGGGGCCGGG - Exonic
918151097 1:181798751-181798773 AGGCGCGGGGGGCCTGGGCCAGG + Exonic
919990768 1:202707707-202707729 CTGAGAGGGCGGCACAGGCCTGG + Intronic
921390443 1:214608840-214608862 TGGCGGGCGCCGCCCGGGCCAGG + Intronic
922696772 1:227734940-227734962 AGGCGGGGGCCTCCCGGGCCTGG + Intronic
923171644 1:231422224-231422246 CGTCCCGGGCGGCCCGGCCCAGG + Exonic
923372738 1:233328698-233328720 CGGCGCGCGCGGCGGGGGCCGGG - Exonic
923782950 1:237042270-237042292 GGAGGAGGGCGGCCCGGGCCCGG - Exonic
1062874108 10:931543-931565 CGGCGCGGCCGGGCCGGGCCGGG + Exonic
1063418274 10:5890420-5890442 CTGCGCGGGGGGTCCGGGCCCGG + Intronic
1063429654 10:5977527-5977549 GGGCGAGCGCTGCCCAGGCCGGG + Exonic
1063459015 10:6203654-6203676 CGGCGACGGCCGCCCGAGACGGG - Intronic
1063663735 10:8050030-8050052 GGGCGAGGGCGACCTGAGCCAGG - Intergenic
1064209082 10:13348119-13348141 CGGCGGCGGCGGCGGGGGCCCGG + Exonic
1064418011 10:15167925-15167947 CGCCGAGGGGGTCCCGGGCCCGG - Intronic
1067300206 10:45001055-45001077 CAACGAGGGCGGCGCGGGCCCGG + Intronic
1067497824 10:46775114-46775136 CAGGGAGGGCGGCCCGAGCGCGG - Intergenic
1067596825 10:47565300-47565322 CAGGGAGGGCGGCCCGAGCGCGG + Intergenic
1067972812 10:50991717-50991739 CGGCGGGGGCGGGTCGGCCCAGG + Intronic
1069962805 10:72088262-72088284 CGGCCAGGGCTGCCGCGGCCAGG + Exonic
1070570699 10:77637901-77637923 GGGCGAGCGGGGCGCGGGCCGGG - Intronic
1070570723 10:77637961-77637983 CGCCGCGGGCCGCCCGCGCCCGG + Intronic
1072680086 10:97499577-97499599 GGGCGAGGGCGCCGCTGGCCTGG + Intronic
1072806612 10:98427463-98427485 GGGCTAAGGCGGCCTGGGCCTGG + Intronic
1073196432 10:101695136-101695158 CGGCGGTGGCGGCTCGGGCTGGG - Exonic
1073253130 10:102133813-102133835 CGGGGCTGGAGGCCCGGGCCGGG + Intronic
1075032118 10:119030361-119030383 CGGCGTGGGCGGCCGAGCCCCGG + Exonic
1075048591 10:119165520-119165542 CGCCAAGTACGGCCCGGGCCCGG - Exonic
1075438509 10:122461808-122461830 CTGCGAGGGCGGCCGGGCCCGGG + Exonic
1075885505 10:125896240-125896262 CCGGGAGGGCGGCCCAGGGCCGG + Intronic
1075900910 10:126042185-126042207 CAGGGAGCGCGGCCAGGGCCAGG - Intronic
1076035646 10:127196613-127196635 GGGCGGGGGCGGCGCGGGGCCGG + Intronic
1076166581 10:128286971-128286993 CAGGGAGGGCGCCCCTGGCCGGG - Intergenic
1076371605 10:129959300-129959322 GGGCGAGGGAGGCCGGGGCCGGG + Intronic
1076721944 10:132396781-132396803 GGGGGAGGGGGGCCCGGGACCGG + Intergenic
1076873867 10:133206516-133206538 CAGCGAGGCCAGCCCCGGCCTGG - Intronic
1076900416 10:133335132-133335154 GGGCGAGGGCAGCCAGCGCCGGG + Intronic
1076930270 10:133527765-133527787 CGGCGGGGGCCTCCGGGGCCTGG - Intronic
1077040418 11:518748-518770 CGTCGTGGGCAGCCCGGGGCCGG - Intergenic
1077076908 11:706158-706180 CGGCGGGGCCGGGCCGGGGCGGG - Exonic
1077144054 11:1036980-1037002 CAGCGGGGAGGGCCCGGGCCAGG - Intergenic
1077204654 11:1336683-1336705 CGGCGAGGGCGGGGCGGGGCGGG + Intergenic
1077341381 11:2027893-2027915 TGCAGGGGGCGGCCCGGGCCAGG - Intergenic
1077360428 11:2138201-2138223 CGGCGTGTGCGGGCCGGGCCGGG - Intronic
1077488559 11:2850181-2850203 CGGGGTGGGCGGCCGGGGCTGGG - Intergenic
1078222699 11:9364653-9364675 CGGCGGGGGCCGCACGGGGCTGG + Intergenic
1078316040 11:10294061-10294083 CGGCGGCGGCGGCCATGGCCCGG - Exonic
1078987105 11:16607214-16607236 GGGGGACGGCGGCCCGGCCCTGG + Intronic
1079076723 11:17389145-17389167 CGGCGGCGGCGGGCGGGGCCGGG - Intronic
1079459956 11:20670223-20670245 TGGCGGGCGCGGCCGGGGCCCGG + Intronic
1080620921 11:33986389-33986411 CGGGGCGGCTGGCCCGGGCCGGG - Intergenic
1081705641 11:45180828-45180850 AGGGGAGGGCTGCCCAGGCCGGG - Intronic
1081969029 11:47185926-47185948 CGGCAAGGCCGGCCCAGGCAGGG - Intronic
1081981559 11:47270082-47270104 CGGAGGGGGAGGCCGGGGCCGGG - Intronic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1083171178 11:60924755-60924777 GGGCGAGGGGCGGCCGGGCCCGG + Intronic
1083656982 11:64234565-64234587 CGGCGGGGGCGGCGGGGGGCTGG - Exonic
1083697364 11:64451848-64451870 CTGTGAGGGTTGCCCGGGCCTGG + Intergenic
1083714475 11:64567764-64567786 TGGCGAGGCCGGCCATGGCCTGG - Exonic
1083784300 11:64934970-64934992 AGGTGAGGAGGGCCCGGGCCCGG - Exonic
1084112523 11:67023303-67023325 CGAGGAGCGCGGCGCGGGCCGGG - Intronic
1084129201 11:67119793-67119815 AGGCGGGGGCGCCCCGGGCTCGG + Exonic
1084153815 11:67303266-67303288 CCGCTGGGCCGGCCCGGGCCGGG + Intergenic
1084175618 11:67420843-67420865 GAGTGAGGGCGGCCGGGGCCGGG + Intronic
1084265612 11:68003869-68003891 CGGCGGGGGCGGGGCGGGCCGGG - Intronic
1084310465 11:68313283-68313305 CGGCCAGGCCGCCCCGCGCCCGG - Intronic
1084428635 11:69099427-69099449 AGGCGCGGCCGTCCCGGGCCTGG - Intergenic
1085332906 11:75668051-75668073 CGGCCGGAGCGGGCCGGGCCCGG - Exonic
1087169588 11:95037565-95037587 CTCCGAGAGCAGCCCGGGCCTGG - Intergenic
1087172722 11:95067202-95067224 CTCCGAGAGCAGCCCGGGCCCGG - Exonic
1089533860 11:119149224-119149246 CGGTCCCGGCGGCCCGGGCCGGG - Exonic
1089738232 11:120564367-120564389 CGGCGCCGGTTGCCCGGGCCCGG - Intronic
1202824366 11_KI270721v1_random:83082-83104 TGCAGGGGGCGGCCCGGGCCAGG - Intergenic
1091594215 12:1864949-1864971 CGGCGAGGGCACCACGGTCCTGG - Intronic
1091684231 12:2550204-2550226 GGGTGAGGGTGGCCCTGGCCGGG + Intronic
1091730523 12:2877081-2877103 AGGGGAGGGGGTCCCGGGCCGGG + Intronic
1091740758 12:2959245-2959267 GGGCGGGGCCGGGCCGGGCCGGG - Intergenic
1094466103 12:30754997-30755019 GGCCGAGGGCGGAGCGGGCCGGG - Intergenic
1095672406 12:44876355-44876377 CGGGGAGGGAGGGGCGGGCCGGG + Intronic
1095977472 12:47949617-47949639 GGGCGTGGGAGGCCTGGGCCGGG - Intergenic
1096389450 12:51217648-51217670 CGGCGAAGGCGGCTCGGGCTCGG - Exonic
1096692227 12:53328285-53328307 CTGGGAGGGGGACCCGGGCCTGG + Exonic
1096983605 12:55743104-55743126 CGGCTGGGGGGGCCCGAGCCCGG - Intergenic
1097267650 12:57755302-57755324 CGGGGTGGGCGGCCATGGCCAGG - Exonic
1097981724 12:65742462-65742484 CGGCGGGGGGAGGCCGGGCCAGG + Intergenic
1098105969 12:67069329-67069351 CGGCCGGGCCGGGCCGGGCCGGG + Intergenic
1098105999 12:67069400-67069422 CCGGGAGGCCGGGCCGGGCCGGG + Intergenic
1100391413 12:94148796-94148818 CGGGGAGGGCGGCGCGCGGCAGG - Exonic
1100468814 12:94873099-94873121 CCCCGAGGGCGCCCCAGGCCAGG + Intergenic
1100611403 12:96194362-96194384 CGGCGGGGGAGGCGCGGGCCTGG + Exonic
1101606054 12:106248155-106248177 CGGAGAGGGAGGGCCGGGCGGGG + Intronic
1102151018 12:110689175-110689197 GGGCGGGGGCGGCCCGGGCGGGG - Intronic
1102501815 12:113358519-113358541 GGCCGAGGGCGGGCGGGGCCGGG - Intronic
1103484618 12:121274241-121274263 CGGAGAGGTGGGGCCGGGCCTGG + Exonic
1103527655 12:121578769-121578791 CGCAGAGGGCGGCCCGGGGTGGG + Intronic
1103832014 12:123787739-123787761 CGGGGAGTGCGGCTCGGACCCGG + Intronic
1103953768 12:124565949-124565971 CCGGGAGGGCGACCCGGGGCAGG - Intronic
1104761359 12:131299101-131299123 CGGGGAGGGAGGCCCAGGGCGGG + Intergenic
1104818416 12:131661691-131661713 CGGGGAGGGAGGCCCAGGGCGGG - Intergenic
1104860112 12:131919167-131919189 CGGCAAGTGCTGCCCGGGCTTGG - Intronic
1104929212 12:132329391-132329413 CGCAGAGGGCTGCCCGGGGCTGG + Intergenic
1105011740 12:132761338-132761360 CGGGGAAGGCGGCGGGGGCCCGG - Intronic
1105405319 13:20128176-20128198 CAGCGGGGCCGGCCAGGGCCCGG + Intergenic
1105472074 13:20703743-20703765 CGGCGGCGGCGGCGGGGGCCGGG + Intronic
1105512238 13:21060976-21060998 GGGCAGGGGCGGCGCGGGCCGGG - Intronic
1106157384 13:27171446-27171468 CGGCCCGGGCGGCCCGGGCGGGG - Intronic
1107603855 13:42040327-42040349 CGGCGAGGAAAGCCCGGGCTGGG - Intronic
1108541687 13:51452333-51452355 GGGGGAGGGCGGCCGGGGCGGGG - Intronic
1109789667 13:67230425-67230447 CGGCGCGGGCGGCCGCAGCCCGG + Intronic
1110705976 13:78602266-78602288 CGGCGCGGGCGGCGCGGGCGCGG - Exonic
1112216347 13:97434376-97434398 CGGGGCGGGCCGCCGGGGCCGGG + Exonic
1113311919 13:109140598-109140620 CGACGACGGCGGCCCGGGCGCGG + Exonic
1113312045 13:109141011-109141033 CGCGGGGGGCGGCCCGGGCGGGG - Exonic
1113378617 13:109784737-109784759 CGGCGAGTGCGCCACGGGCATGG + Exonic
1113418068 13:110146619-110146641 CGGGGAGGGAGGACGGGGCCTGG + Intergenic
1113541813 13:111115269-111115291 GGGCGACGGCGGCCGAGGCCGGG + Exonic
1113579749 13:111420648-111420670 AGGGGAGGGAGGCCCAGGCCCGG - Intergenic
1113784843 13:112997024-112997046 AGGCGAGGGCGGCCCGGGGCTGG - Intronic
1113868435 13:113543670-113543692 CGGCCAGGGCAGCCTGGGGCTGG - Intronic
1113874370 13:113585087-113585109 CGGGGCGGGGGTCCCGGGCCCGG + Intronic
1113877060 13:113601268-113601290 AGGCCAGGGCCGCCCGGGACAGG - Intronic
1113896253 13:113766267-113766289 CCGGGCGGGCGGCCTGGGCCGGG + Intronic
1114655960 14:24315828-24315850 CGGCCAGGTCGGCCAGGGCCAGG - Exonic
1116821844 14:49634427-49634449 AGGGGAGGGCGCCCGGGGCCCGG + Exonic
1116835799 14:49768213-49768235 GGGCGGCGGCGGCGCGGGCCCGG - Exonic
1117602699 14:57391044-57391066 AGGCGAGGGCGGCCCCCGCCGGG - Exonic
1117816831 14:59607358-59607380 CTGAGAGTGCGGCCAGGGCCAGG + Exonic
1119046301 14:71321033-71321055 CGGCGAGGCCGGCCCGAGGCGGG - Intronic
1121616972 14:95319880-95319902 CGGCGAGGGCGCCGCGGAGCTGG + Exonic
1122317933 14:100836576-100836598 CCCCGAGAGCGGCTCGGGCCAGG + Intergenic
1122399248 14:101457730-101457752 CCGGGAGGGAGGCGCGGGCCTGG + Intergenic
1122399790 14:101459538-101459560 CGGGGCGGCCGTCCCGGGCCGGG - Intergenic
1122418298 14:101560711-101560733 CGGCCAGGGCGGCGCGGGCTGGG + Intergenic
1122555902 14:102579910-102579932 CGGGGAAGGGGGCCTGGGCCAGG - Intergenic
1122666724 14:103334857-103334879 GGGCGGGGGCGGCCCGATCCCGG + Intronic
1122690352 14:103529296-103529318 GGGTGAGGGTGACCCGGGCCGGG + Intronic
1122707182 14:103628910-103628932 CGGGGTGGGCGGCCAGGCCCTGG - Intronic
1122904587 14:104795847-104795869 CGGCGAGGGCGGAGCGCGCTCGG + Intergenic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1122975336 14:105168549-105168571 CGGCGGCGGCGGCGCGGGCGGGG + Exonic
1123002068 14:105301022-105301044 CGGTGAGCGCAGCCCGGGACTGG + Exonic
1123033812 14:105463678-105463700 CCGGGAGGGCGGCCCAGGGCTGG + Intronic
1202872554 14_GL000225v1_random:177677-177699 CCGGGAGGGCGGCCCAGGGCCGG - Intergenic
1124120390 15:26883567-26883589 GGGCGGGGGCGGGCGGGGCCGGG + Intronic
1124392188 15:29269477-29269499 CGGCGGGGGCGGCCTGGGCCCGG + Exonic
1124427019 15:29570864-29570886 CGCCGGGAGCGGGCCGGGCCGGG + Intergenic
1124628685 15:31325652-31325674 CTCCGAGGACGGCCCAGGCCTGG + Intergenic
1124629040 15:31326818-31326840 CCGTGTGGGCGGCCCGGCCCCGG - Intergenic
1124652357 15:31483419-31483441 CGGCCGTGGCGGCCCGGGGCCGG - Exonic
1126137017 15:45402519-45402541 CGTGGAGGGCGGCCGGGCCCAGG - Exonic
1126668424 15:51094700-51094722 CGGCGCGGGCGGCGCGGGCTGGG + Intronic
1126823670 15:52528930-52528952 CGGGGAGGGCCGCGCGGGGCGGG + Exonic
1127103365 15:55588637-55588659 CGGCGAGGGAGCGCCGGGCGCGG - Intronic
1127293668 15:57591863-57591885 GGGCGGGGCCGGGCCGGGCCGGG - Intergenic
1127922609 15:63504933-63504955 GGGCGAGGGCGAGCCGGGCCCGG + Intronic
1128280157 15:66387461-66387483 CGGCTGGGGAGGCCCGAGCCGGG + Intronic
1128841468 15:70854229-70854251 CGGCGGCGGCGGCGCGGGGCGGG - Intronic
1129082172 15:73051680-73051702 CGGCGACGGCGGCCCGGCTTGGG + Intergenic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1129737714 15:77975285-77975307 TGGGGAGGGCGGCCCAGGCCCGG - Intergenic
1129780044 15:78264282-78264304 CGGAGAAGGCGGCTTGGGCCTGG - Exonic
1130517022 15:84633541-84633563 CGTCCCGGGCGGCCCGGCCCAGG - Intergenic
1132480634 16:164822-164844 CGGGCGGGGCGGCCGGGGCCCGG + Intronic
1132497382 16:270370-270392 CGGCCAGGGCGGCCCCAACCAGG + Intronic
1132498600 16:275123-275145 GGGCGAGGGCGGGACGAGCCGGG + Intronic
1132588217 16:715337-715359 CGGCGCGGGCAGCCGGGGCCAGG - Exonic
1132604583 16:788422-788444 CGGCGGGGGCGGGCCGGGGGCGG - Intergenic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1132743487 16:1427409-1427431 TGGGGGGGGCGGCCGGGGCCAGG - Intergenic
1132837128 16:1959764-1959786 CGGCGAGGGAGCCCCGGGCTGGG - Intronic
1132865637 16:2091482-2091504 CGCTGAGGGCGGCCAGGGCGCGG + Exonic
1132882930 16:2170398-2170420 CCGCCTGGGCGGCCTGGGCCGGG - Intronic
1132883118 16:2171016-2171038 GGGCGAGGGCGGCCAAGGCTGGG + Intronic
1132884958 16:2178521-2178543 CGGCGCGGGAGGGCCCGGCCAGG + Exonic
1133024777 16:2983803-2983825 GGGCGCGCGCGGCCCGCGCCTGG - Intergenic
1133035017 16:3029571-3029593 CGACGACGGCGACCAGGGCCAGG - Exonic
1133156447 16:3880130-3880152 CGGCGGCGGCGGCCGGGGGCGGG - Exonic
1133286669 16:4693912-4693934 CGGCGCGGGCGGGCCCGGGCGGG + Intronic
1133784372 16:8963420-8963442 CGGCGACGGCGGCCCCGGGGCGG + Exonic
1134529972 16:14975362-14975384 CCGGGAGGGCGGCTGGGGCCCGG + Intronic
1135429852 16:22374174-22374196 CAGCGGGGGCCTCCCGGGCCAGG + Intronic
1136237761 16:28925102-28925124 CGGCGGCGGCGGCCGGGGGCTGG - Exonic
1136365371 16:29806905-29806927 CGGCCGCGGCGGCCCGGGCTGGG + Intronic
1136540078 16:30923993-30924015 CGGTGGGGGGGGCCCAGGCCTGG + Intronic
1136641525 16:31569344-31569366 CGACGAGGGCGGCGGGCGCCGGG + Intergenic
1137426478 16:48385097-48385119 CGGGAAGGGCGGCCCGGCCGGGG - Intronic
1137708012 16:50548605-50548627 CGGCGACGGCGGCGGGGCCCGGG - Intronic
1138178793 16:54929058-54929080 CGGCCCAGGCGGCCCGAGCCTGG - Intergenic
1139776254 16:69318794-69318816 GAGGGAGGCCGGCCCGGGCCCGG - Intronic
1139785010 16:69385745-69385767 CGGCGGGGGCGCCACGAGCCGGG - Exonic
1139866375 16:70065592-70065614 CCGGGAGGGCGGCTGGGGCCCGG - Intergenic
1139890684 16:70251657-70251679 CGGCGAGCGCGGCGGCGGCCCGG - Exonic
1140223113 16:73058195-73058217 CGGCGGCGGCGGCGCGGGGCCGG + Intronic
1140223125 16:73058220-73058242 AGGAGGGGGCGGCCCGGGCTCGG + Intronic
1140664004 16:77212463-77212485 CGCCGAGGGAGGCACAGGCCGGG - Intronic
1141452709 16:84116618-84116640 AGGCGAGGGCTGCGGGGGCCGGG - Intronic
1141513507 16:84527575-84527597 CAGCGAGGGGGGGCCGGGGCGGG + Intronic
1141593312 16:85082729-85082751 CGGGGAGGGCGGCCCTGGGGAGG + Intronic
1141830108 16:86505696-86505718 GGGCGAGGAGGGCGCGGGCCCGG + Intergenic
1142156236 16:88533944-88533966 CAGCGAGGGCAGCCAGAGCCCGG + Exonic
1142156492 16:88534777-88534799 CGGCGGGGGCGGCACGGCCTCGG - Exonic
1142336098 16:89490356-89490378 CGGCGGCGGCGGCGCGGGCTCGG + Exonic
1142672093 17:1491957-1491979 GGGGGAGCGCGGCCCTGGCCCGG - Intronic
1142676524 17:1516849-1516871 CGGCGGGCGCGGGCTGGGCCGGG - Exonic
1142795548 17:2304021-2304043 AGGCGAGGCCGGGCCGTGCCAGG + Intronic
1142810693 17:2394233-2394255 GGCCGAGGGCCGCCGGGGCCCGG + Intronic
1143030387 17:3964213-3964235 AGCCGAGGGCGGCCTGAGCCCGG - Exonic
1143148332 17:4790423-4790445 CGGCGAGGGCCGCCCCCGGCAGG + Intergenic
1143513577 17:7408327-7408349 CGCCCCGGGCGGCCCCGGCCTGG + Exonic
1143519477 17:7437416-7437438 CGGCACGGAGGGCCCGGGCCGGG - Exonic
1143676417 17:8436150-8436172 CCGCCGGGGCGGGCCGGGCCGGG + Intronic
1143723981 17:8832958-8832980 CAGCGAGGCCAGCCCGAGCCGGG - Exonic
1143780319 17:9225718-9225740 GGGCCAGGGCGGGCCGGGCAGGG + Intronic
1143904616 17:10198730-10198752 CCGCGAGGGCTGGCCGGGGCCGG + Intergenic
1144656948 17:17042803-17042825 CGGCGGCGGCGGCGCAGGCCTGG - Exonic
1144847105 17:18225764-18225786 GTGCGGCGGCGGCCCGGGCCCGG + Intronic
1144953021 17:19004201-19004223 CGGGGAGGGCGGGCCGCGCGGGG + Intronic
1145765530 17:27456301-27456323 CAGGGAGGGCGGCGCGGGCGCGG + Intergenic
1146142491 17:30379571-30379593 CGGCGACGGCGGCCCGTCCGGGG + Exonic
1146393608 17:32444481-32444503 CGGCGTCGGCGGCCGCGGCCGGG + Exonic
1146492356 17:33292138-33292160 CAGCGGCGGCGGCCCCGGCCGGG + Exonic
1146581154 17:34040009-34040031 CGGCGGTGGCTGCCCGGGCGGGG - Intronic
1146763488 17:35498071-35498093 CGGCGAGGGCGGCGGGGCGCGGG + Intronic
1147285687 17:39401408-39401430 CGGCGGGTGCGGCCCGGGCCGGG + Exonic
1147407028 17:40219564-40219586 CGGGGAGGGGGGCTCGGGGCGGG + Intronic
1147757358 17:42777887-42777909 CTGCTAGGGCAGCCAGGGCCTGG - Intronic
1148090263 17:45019100-45019122 CGGCGCGGGCGGCCCGGGCGGGG + Intergenic
1148796730 17:50200699-50200721 CGGTGAGGTCGGCCCCGCCCCGG - Intronic
1149647296 17:58249694-58249716 TGGTGAGGGCAGGCCGGGCCGGG + Exonic
1150108611 17:62479137-62479159 CGGCGGCGGCTGCCCGGGCGGGG + Exonic
1150108797 17:62479644-62479666 CGGCGAGGGGCGCCGGGACCAGG + Intronic
1150217268 17:63477562-63477584 CGGCGAAGGCGGGCGCGGCCTGG - Intergenic
1150408026 17:64919319-64919341 CAGTGGGGGCGGCCGGGGCCGGG + Intronic
1150489015 17:65561705-65561727 CGGCGGGGGCGGGCCGGGGCGGG - Intronic
1150692550 17:67378210-67378232 GGGCGAGGCCGGGCCGGGCGCGG - Intronic
1150765037 17:67995773-67995795 CTGCGAGCCCGGCCCGGGCACGG + Intergenic
1150802273 17:68291585-68291607 TGGCGGGGGCGGCCCGGCCCCGG - Intronic
1150983441 17:70169308-70169330 CGGGGAGTCGGGCCCGGGCCGGG - Intronic
1151714248 17:75823423-75823445 CGGAGAAGGCGGGCAGGGCCTGG - Exonic
1151763655 17:76121563-76121585 AGGCGAGCCCGGGCCGGGCCGGG + Intronic
1152069803 17:78128839-78128861 GGGCGGGGGCGCCGCGGGCCGGG - Intronic
1152130862 17:78475611-78475633 CGGAGAGGGTGACCCGGTCCAGG + Intronic
1152183575 17:78840486-78840508 CGGCGAGGACAGCCCGGCCCCGG + Exonic
1152552264 17:81035567-81035589 CGGGGAGTGCTCCCCGGGCCTGG - Intronic
1152592973 17:81222748-81222770 AGGTGAGGGGGGCCCGGGCAAGG - Exonic
1152617381 17:81344238-81344260 CGGCGCGGGCGTCCGGAGCCCGG - Intergenic
1152721939 17:81927604-81927626 CGGCGCGAGGGGTCCGGGCCCGG + Exonic
1152798746 17:82321568-82321590 CGGCGGCGGCGGCTCGGGCTGGG - Exonic
1153805308 18:8705321-8705343 CGGCGCTGGCGGCGCGCGCCCGG - Intergenic
1153900463 18:9614098-9614120 GGGCGAGGGCGGCCCCAGGCGGG - Intronic
1154066351 18:11110697-11110719 CGGGGCGGGCGGGCCGGGGCGGG - Intronic
1154214876 18:12408322-12408344 GGGCGGGGGCGGCCGGAGCCGGG + Intronic
1155096391 18:22559862-22559884 CGGCGAGCCCGGCTCGGGCAGGG + Intergenic
1156008595 18:32471017-32471039 GGGCGCTGGCGGCCCCGGCCGGG - Intergenic
1156099604 18:33578316-33578338 GGGCGGGGGCGGCGCCGGCCGGG - Intergenic
1157529585 18:48409676-48409698 CGGCGGGGGGCGCCCGGGACTGG + Intronic
1157582469 18:48781535-48781557 CGGCGAGGGTGGCTGGAGCCGGG + Intronic
1157610008 18:48950253-48950275 CGGTGGCGGCGGCCCGGGCAGGG - Exonic
1157665959 18:49487131-49487153 CTGCGAGCGCGGCCCGGGCTGGG + Intronic
1158530555 18:58256276-58256298 TGGCCAGGGCGGCCCGGCCGCGG + Intronic
1158601936 18:58863495-58863517 CGGCGGCGGCGGCTCGGCCCGGG - Intronic
1158648864 18:59269295-59269317 CGGCAGCGGCGGCCCGAGCCAGG + Exonic
1160453694 18:78980964-78980986 CAGCGGCGGCGGCCTGGGCCTGG + Intronic
1160567857 18:79798208-79798230 GGGCGGGGGCGGCTCGGGGCCGG + Intergenic
1160568012 18:79798729-79798751 CGCCGAGCGCAGCCCGGGTCCGG + Intergenic
1160579744 18:79876764-79876786 CGGAGTTGGTGGCCCGGGCCTGG - Intronic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160739741 19:680287-680309 CGTGGAGTGCGGCCCGGGCAAGG + Exonic
1160792578 19:929443-929465 CGGCGGGGGCGGCCCCTGCGGGG - Exonic
1160792644 19:929639-929661 CGTCGGGGGCAGCCCGGGCCCGG - Exonic
1160807875 19:1000590-1000612 GGGCCAGGGCGGCGCGGGCGCGG - Exonic
1160807883 19:1000605-1000627 GCGCCAGGGCGGCCCGGGCCAGG - Exonic
1160823020 19:1067113-1067135 CGGGGGGCGCGGCCCGGGGCTGG + Intronic
1160864442 19:1250725-1250747 CTGCGAGGGCGTCCCGGGCCGGG + Intronic
1160906764 19:1455336-1455358 CGGTGAGGGGCGCCCGGGCCAGG - Intronic
1160947899 19:1652066-1652088 CGACGGGGGCGACGCGGGCCTGG + Intronic
1160982886 19:1824284-1824306 CGCCGTGTGCGGCCTGGGCCTGG - Intronic
1161175814 19:2841677-2841699 CGGCGAGGGCGGCGCAGGACGGG + Intronic
1161309360 19:3585551-3585573 CGGCGGCGGCGGCGAGGGCCCGG + Exonic
1161341961 19:3747901-3747923 CGGCGAGGGCGGCGCGTACACGG + Exonic
1161406651 19:4094806-4094828 CGGCGATGTTGCCCCGGGCCTGG - Intronic
1161560270 19:4969202-4969224 CGGCGTGCGCGGCCCGGTCCGGG - Exonic
1161560409 19:4969567-4969589 CAGCGTGGGTGGCCCCGGCCGGG + Intronic
1161702929 19:5804961-5804983 CGGGGAGGGCGGGGAGGGCCGGG + Intergenic
1161802631 19:6424545-6424567 CGGCGGCGGCGGCCCGGGCGGGG - Exonic
1161802691 19:6424654-6424676 GGGCGGCGGCGGCCCGGGCGGGG + Exonic
1161925338 19:7294915-7294937 CCGCGAGTGCGCCCCGGCCCAGG + Intergenic
1161959555 19:7516208-7516230 CGGCGCGGGCGCGGCGGGCCGGG + Exonic
1162013213 19:7830379-7830401 CAGGTAGGGCGGCGCGGGCCGGG + Intronic
1162021190 19:7869363-7869385 CCGCGAGGACGCCCCGGCCCCGG + Exonic
1162056293 19:8066037-8066059 GGGCGGAGGCGGCCGGGGCCTGG - Exonic
1162079451 19:8209567-8209589 CGGCCATGGCGGCCCCAGCCCGG + Intronic
1162395572 19:10416628-10416650 GGGCTGGGGCGACCCGGGCCCGG + Intronic
1162435335 19:10654637-10654659 CGGCAAGGGAGGAACGGGCCAGG - Intronic
1162470916 19:10871639-10871661 CAGCGGCGGCGGCCTGGGCCCGG + Exonic
1162648185 19:12065100-12065122 CGGCGACTGCGGCCCCAGCCCGG + Intronic
1162910040 19:13843407-13843429 CGGGGAGGGGGGCCTGGGTCTGG + Intergenic
1162931664 19:13960683-13960705 AGGAGAGGGCAGCCCAGGCCAGG + Intronic
1162954713 19:14091370-14091392 CGGCGGGGGCGGCCCTGGCAGGG - Intergenic
1163138691 19:15332079-15332101 CGGCGCAGGCCGCCCCGGCCCGG + Intronic
1163282393 19:16325584-16325606 GCGCGAGGGCGCCCCGGGCCCGG + Exonic
1163320527 19:16572107-16572129 CGGCGCGGGGGGCACGCGCCAGG + Exonic
1163329618 19:16628087-16628109 CGGAGAGGGGAGCCGGGGCCGGG + Exonic
1163720630 19:18896540-18896562 CGGTGAGGTCGGAGCGGGCCGGG - Intronic
1163729532 19:18941151-18941173 CGGCGCGGAGGGCGCGGGCCCGG - Intronic
1164577896 19:29416893-29416915 CGGGGAGGCCAGCCCGGGGCTGG - Intergenic
1164639120 19:29811924-29811946 GTGCGAGGGCGGGCCGGGGCCGG + Exonic
1164813381 19:31175762-31175784 CGGCCAGTGGGGCCCTGGCCAGG + Intergenic
1165058635 19:33194454-33194476 CGCCGCGGCCGGCCTGGGCCCGG - Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165493920 19:36141053-36141075 CGGCGGGGGAGGCGGGGGCCTGG + Exonic
1165923757 19:39314605-39314627 CGGGGTGGGCGGCTTGGGCCCGG + Exonic
1166064353 19:40348399-40348421 CGGGGCGGGCAGCCCGGGCCGGG - Intronic
1166361687 19:42255166-42255188 GGGCGTGGGCGTCCCGGCCCCGG - Intergenic
1166841591 19:45700668-45700690 CGGCCAGTGGGGGCCGGGCCTGG + Intronic
1166852846 19:45768686-45768708 CGGCGGCGGCGGCCGGGGCCGGG - Exonic
1166873898 19:45885911-45885933 CGGGGAAGGGGGGCCGGGCCTGG - Exonic
1167001061 19:46746089-46746111 GGGTGAGGCCGGGCCGGGCCGGG + Exonic
1167056144 19:47112555-47112577 CGGCGGGGGGGTCCCGGGCGCGG + Exonic
1167133157 19:47600669-47600691 CGGCGCGGGCGGGCAGGGCCAGG + Intergenic
1167134284 19:47608199-47608221 CGGCCAGAGCGGCCGGGGACAGG + Exonic
1167413727 19:49360042-49360064 CGTCCAGGGCGGCCCCAGCCCGG + Exonic
1167643697 19:50695070-50695092 CGGCGGGGGCGGCCGGCACCGGG - Intronic
1167708966 19:51098675-51098697 CGGCAAGGGCCGCCGGGGTCTGG - Exonic
1167781473 19:51601613-51601635 CGGCAAGGGCCGCCGGGGGCTGG + Intergenic
1168063866 19:53908678-53908700 GGGAGGGGGCGTCCCGGGCCGGG - Intergenic
1168144856 19:54415388-54415410 GGGGGAGGGAGGCGCGGGCCGGG - Intronic
1168152402 19:54456082-54456104 CAGCGAGGGACGCCCGGGGCTGG + Exonic
1168240656 19:55087278-55087300 GAGCGAGGGCAGCCCGGGCGCGG - Intronic
1168641461 19:58034287-58034309 GGGGGAGGCGGGCCCGGGCCCGG + Intronic
1168641476 19:58034308-58034330 GGGAGGGGGCGGGCCGGGCCGGG + Intronic
1168645911 19:58059341-58059363 AGGCCAGGCCGGGCCGGGCCGGG + Intronic
925730737 2:6917984-6918006 GGGACAGGGCGCCCCGGGCCAGG + Intronic
926581441 2:14634975-14634997 CGCCGCCGGTGGCCCGGGCCCGG + Exonic
926718582 2:15942571-15942593 CGGGCAGGGCGGCCCCGGCGCGG - Exonic
927596573 2:24402958-24402980 CGGCCAGGGCCGCCAGCGCCGGG + Intergenic
927713788 2:25340849-25340871 CGGCCCCCGCGGCCCGGGCCCGG + Intronic
927714041 2:25341416-25341438 AGGCGGGGGCGGCCCGGCCGGGG + Intronic
927714088 2:25341543-25341565 CGGGGAGGGGGGTCCGCGCCGGG + Intronic
927772774 2:25878257-25878279 CAGGGAGGGCGGCCGGAGCCCGG - Intronic
928022522 2:27715770-27715792 AGGCCGGGGCGGCCCGGGGCGGG + Intergenic
928904430 2:36355620-36355642 CGGAGGGGGCCGGCCGGGCCGGG + Intergenic
929174230 2:38960549-38960571 CGGCGACGGCGGCGGCGGCCGGG - Exonic
931253383 2:60551818-60551840 CGGCGAGGTCGGGCAAGGCCCGG + Intronic
932699861 2:73985091-73985113 TGGCGGCGGCGGCGCGGGCCGGG + Intergenic
932699901 2:73985209-73985231 AGGCGCGGGGGGCCCGGCCCGGG + Intergenic
933751071 2:85602464-85602486 AGGCGAGCGGGGGCCGGGCCGGG - Intronic
933772601 2:85753819-85753841 CGGCTCGGGCGGCCCGGGCTGGG + Intronic
933908023 2:86914183-86914205 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908034 2:86914211-86914233 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908069 2:86914307-86914329 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908143 2:86914518-86914540 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
934011428 2:87824733-87824755 CGGCGGCGGCGGCCTCGGCCTGG - Intronic
934011459 2:87824816-87824838 CGGCGGCGGCGGCCTCGGCCTGG - Intronic
935137617 2:100321697-100321719 CGGCGAGGGAGGGCCGGCCCCGG - Exonic
935265102 2:101387173-101387195 GGGCGGGCGCCGCCCGGGCCAGG - Exonic
935592465 2:104855352-104855374 CGGCGGGGCCGGCGGGGGCCCGG + Intergenic
936412921 2:112276080-112276102 CGGCGGGAGCGGGCCGGGGCCGG + Intronic
936433262 2:112482223-112482245 CGGCGCGGGCGGCGGGGGCCGGG + Exonic
936512247 2:113157576-113157598 CGTCGAGGGCGGCGACGGCCGGG - Intronic
936531393 2:113278870-113278892 CCGCGAGGGTGCCCTGGGCCCGG + Exonic
937182980 2:120012927-120012949 CGGCGAGGCCGGGCCCGGCCGGG - Intergenic
937624190 2:124025204-124025226 AGGCGAGCGCGGGGCGGGCCTGG + Intergenic
938451447 2:131425018-131425040 CGGGGGCGGCGGCCAGGGCCGGG + Intergenic
940954376 2:159712229-159712251 GGGCGCTGGAGGCCCGGGCCGGG - Intergenic
941666327 2:168247189-168247211 CGGCGGGGCCGGCACAGGCCGGG - Intronic
941911712 2:170770867-170770889 CGGCGAGGAGGGCCCGGGGCGGG - Intergenic
942098549 2:172556180-172556202 CGCCTTGGCCGGCCCGGGCCCGG + Exonic
942240812 2:173963731-173963753 CGGCGGGGGCGGGCCGCGCGCGG + Intronic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
942451052 2:176108087-176108109 CGGCGAGGGCCCCCCGGGAGAGG + Exonic
942799736 2:179861435-179861457 CGGCGGGGCCGGGCCGGGCCGGG - Exonic
942928062 2:181457241-181457263 CGGGCTGGGAGGCCCGGGCCAGG + Exonic
943060684 2:183038595-183038617 CGTAGTGGGCGGTCCGGGCCAGG - Exonic
943639678 2:190344144-190344166 CAGCGAGGCCGCCCCCGGCCGGG + Intronic
945234989 2:207625358-207625380 GGGGGCGGGCGGCCCCGGCCCGG + Intronic
945386616 2:209209332-209209354 CAGCTGGGGCAGCCCGGGCCGGG + Intergenic
946386613 2:219387802-219387824 CGGTGGGGGCGGGCCGAGCCCGG - Exonic
946747482 2:222860883-222860905 CGGCGCTGGCGGCCCGGGGCGGG - Intergenic
947506765 2:230713382-230713404 CGGAGAGGGCAGGCTGGGCCCGG - Intronic
947860476 2:233354436-233354458 GGCCGAGGGCGGGCCGGGCCGGG - Intergenic
947866356 2:233400466-233400488 TGGCCAGGGAGGCCCAGGCCAGG - Intronic
948180110 2:235972898-235972920 CCGCGAGGGCTCCCTGGGCCAGG - Intronic
948213892 2:236214805-236214827 GCGCGTGGGCGGCACGGGCCGGG - Exonic
948425710 2:237885654-237885676 CAGGGAGGGCGGCCTCGGCCTGG - Intronic
948816264 2:240511840-240511862 AGGTGAGGGCAGCCAGGGCCTGG - Exonic
948945737 2:241218046-241218068 CGGCGGGGGCGGGCAGGGGCGGG + Intronic
1168790300 20:571878-571900 GGGCGAGGGCGGGGCGGGGCTGG - Intergenic
1168802665 20:653259-653281 CGGGGGGGGGGGCCCGTGCCAGG + Exonic
1168878114 20:1185137-1185159 CGGGGAGGGAGGCCCGGCACAGG - Intronic
1170524759 20:17226842-17226864 CGGCCGGGCCGGGCCGGGCCGGG + Intronic
1170578353 20:17681211-17681233 GGACGAGGGCGCCCGGGGCCCGG - Intronic
1172118068 20:32583554-32583576 CGGCGCGGCCCGACCGGGCCGGG + Intronic
1172155363 20:32820182-32820204 CGGCGCGCGCGGGCTGGGCCTGG + Intronic
1172284742 20:33732409-33732431 CGGCGCGCGGGGCCCGGGACGGG + Intronic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1172474635 20:35227165-35227187 CGCCGAGGGCCGCCGAGGCCGGG + Intronic
1173166090 20:40688266-40688288 CGTCGCGTGCGGCCCGGGCCCGG + Exonic
1173516238 20:43667253-43667275 GGGCGAGCGCGGCGCGGTCCGGG + Exonic
1173734299 20:45348470-45348492 GGGCGGGGGCGGGCCGGGGCGGG - Intergenic
1174231232 20:49046854-49046876 CGGCGAGGCCTGCCCGGGCGGGG + Intronic
1174246830 20:49188087-49188109 CGGCCGGGCCGGGCCGGGCCTGG - Intronic
1174343866 20:49915391-49915413 CGCCGAGGACGGCCCGGCCGAGG + Intronic
1174566222 20:51466346-51466368 TAGGGAGGGAGGCCCGGGCCAGG - Intronic
1174945801 20:54983995-54984017 AGGCCAGGCAGGCCCGGGCCTGG + Intergenic
1175399652 20:58693094-58693116 CTCCGCGGGCCGCCCGGGCCTGG - Intronic
1175466114 20:59192141-59192163 GGGGGAGGGCGGCCCGGGCCCGG + Exonic
1175470261 20:59222413-59222435 CGGCGGGGGCGGAGGGGGCCCGG - Intronic
1175715420 20:61252127-61252149 CGGCGCGGGGGGCGCGGGCGCGG + Intergenic
1175944280 20:62551489-62551511 CGGCGAGGCTGCCCCCGGCCGGG + Intronic
1176015542 20:62929346-62929368 GGGCGAGGGCGGGGCGCGCCTGG + Intronic
1176029796 20:63006470-63006492 CGGCGGCGGCGGCGCGGGCCAGG - Exonic
1176143282 20:63554293-63554315 CGGGGAGGTGGGCCCGGGCCAGG + Exonic
1176178656 20:63739833-63739855 CGGCCAGCCCGGCCCGGCCCGGG + Intronic
1176221142 20:63969835-63969857 CGGCCGGGCCGGGCCGGGCCGGG + Intronic
1176234752 20:64049102-64049124 GGGCGGGGGGGGCTCGGGCCGGG - Intronic
1176546804 21:8205767-8205789 CCGGGAGGGCGTCCCCGGCCCGG + Intergenic
1176547777 21:8208952-8208974 CGGGGGGTGGGGCCCGGGCCGGG + Intergenic
1176548594 21:8212224-8212246 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176554709 21:8249976-8249998 CCGGGAGGGCGTCCCCGGCCCGG + Intergenic
1176555673 21:8253157-8253179 CGGGGGGTGGGGCCCGGGCCGGG + Intergenic
1176556488 21:8256432-8256454 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176565755 21:8388814-8388836 CCGGGAGGGCGTCCCCGGCCCGG + Intergenic
1176566722 21:8391991-8392013 CGGGGGGTGGGGCCCGGGCCGGG + Intergenic
1176567525 21:8395259-8395281 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176573630 21:8433001-8433023 CCGGGAGGGCGTCCCCGGCCCGG + Intergenic
1176574603 21:8436186-8436208 CGGGGGGTGGGGCCCGGGCCGGG + Intergenic
1176575427 21:8439474-8439496 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176611216 21:8987478-8987500 CGGGGGGTGGGGCCCGGGCCGGG + Intergenic
1177431695 21:20998283-20998305 CGGGGAGGGCGGCGGGGGCGGGG - Intergenic
1178488008 21:33030973-33030995 CGCCGAGGGTGGCCCTGGACTGG + Intergenic
1178707980 21:34889984-34890006 CGGCGAGGGACCCCCGCGCCGGG - Intronic
1178992770 21:37368099-37368121 CGGCGGGGCCGGGCCGGGCCGGG + Intronic
1179438498 21:41377884-41377906 CGGCGATGGCTGGCAGGGCCAGG - Exonic
1179446558 21:41435932-41435954 CGGCGATGGCTGGCAGGGCCAGG - Exonic
1179511956 21:41879199-41879221 CAGCGGGTGCGGCCCGGGGCCGG + Intronic
1179522405 21:41953831-41953853 CGGCGGCCGCGGCCCGGGCTGGG + Exonic
1180003245 21:45004584-45004606 AGGCGAGGCCTGCCCGGGGCTGG - Intergenic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180064247 21:45404941-45404963 CTGCGAGGACGGGGCGGGCCGGG - Intergenic
1180285510 22:10741708-10741730 GGGCGAGCGCGCCCCGAGCCGGG - Intergenic
1180285545 22:10741799-10741821 CCGGGAGGGCGGCCCAGGGCCGG + Intergenic
1180699696 22:17774523-17774545 CGCCGGGGGCGGGCCGGGGCGGG - Intronic
1180949345 22:19714280-19714302 GGGCGGGGGCGGCGCGGGTCTGG + Intergenic
1181082928 22:20426065-20426087 AGGCCCGGCCGGCCCGGGCCCGG - Exonic
1181334556 22:22118005-22118027 TGGCGGGCGCCGCCCGGGCCGGG + Intergenic
1181514340 22:23402606-23402628 CGGCCAGGGCGGGCCGGGGGCGG + Intergenic
1183444472 22:37844070-37844092 CGGCGCGGGCCTCTCGGGCCGGG - Exonic
1183466743 22:37983910-37983932 CCCCGAGGGCGGCCCGAGACAGG + Intronic
1183780311 22:39995027-39995049 CGGCCATGGCGCCCCGGCCCCGG - Exonic
1183950589 22:41350465-41350487 CAGGGAGGGTGGCTCGGGCCAGG + Intronic
1184680700 22:46071081-46071103 CGGCGGGGGCGGGCCGGGCCGGG + Intronic
1184681052 22:46072196-46072218 GGGCGTGGGCGTCCCGGGGCCGG + Intronic
1185313805 22:50170407-50170429 GGGGGCGGGCGGGCCGGGCCGGG - Intergenic
1185334953 22:50267313-50267335 GGGGGCGGGCGGGCCGGGCCCGG - Intronic
1185397644 22:50600947-50600969 CGGGGACGGGGGTCCGGGCCGGG - Intronic
1185409518 22:50674605-50674627 CGGCGCGAGCGGCCCCGGCCCGG + Intergenic
1203251679 22_KI270733v1_random:122052-122074 CCGGGAGGGCGTCCCCGGCCCGG + Intergenic
1203252651 22_KI270733v1_random:125237-125259 CGGGGGGTGGGGCCCGGGCCGGG + Intergenic
1203259729 22_KI270733v1_random:167134-167156 CCGGGAGGGCGTCCCCGGCCCGG + Intergenic
1203260707 22_KI270733v1_random:170323-170345 CGGGGGGTGGGGCCCGGGCCGGG + Intergenic
1203261532 22_KI270733v1_random:173607-173629 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
949970275 3:9397786-9397808 CGGGGAGGGGGGGCAGGGCCAGG - Exonic
950072676 3:10165047-10165069 CGGTGAGTGCGGCCCGGGGAGGG + Exonic
950153823 3:10707980-10708002 CAGCGGGGCCGGGCCGGGCCGGG - Intronic
950509979 3:13420253-13420275 CGGCGCGGGCGGCCGGGCGCAGG - Exonic
951080462 3:18445279-18445301 CGGCGGCGGCGGCTCGGGCTCGG - Intronic
951611340 3:24495134-24495156 CGGAGCAGGCGCCCCGGGCCCGG - Intronic
952416728 3:33096819-33096841 CGTCGGGGGCGGGCCGGGCGGGG - Intronic
953246708 3:41199816-41199838 CGGTGAGGGTGGGCCGCGCCCGG + Intronic
953627242 3:44581038-44581060 CGGCGGCGGCGGCGCAGGCCCGG + Intronic
953972300 3:47356633-47356655 CGGGGTGGGTGGCCCGGACCGGG - Intergenic
953989946 3:47476083-47476105 CGGCCGGGCCGGGCCGGGCCGGG + Exonic
954004154 3:47578660-47578682 CGGGGGCGGGGGCCCGGGCCGGG - Exonic
954025635 3:47781457-47781479 CGGCGGGGGCGTGGCGGGCCCGG + Intronic
954277954 3:49554656-49554678 CGGCGGCGCCGGCCCCGGCCCGG + Exonic
954632824 3:52056370-52056392 GAGCGCGGGCGGCCCGGGGCCGG + Exonic
954799915 3:53181150-53181172 CAGTGAGGGCAGCCTGGGCCAGG - Intronic
956604949 3:71064859-71064881 CCGCGCGGGCGCCCCGAGCCCGG - Intronic
961013167 3:123449013-123449035 CGGCGAGGGCGGCTCGGCGGGGG + Exonic
961067104 3:123884625-123884647 GTGCGAGGGGGGCCCGGGTCTGG - Intergenic
961202521 3:125055960-125055982 CGGCGGGGGCCGCGCGGGGCCGG + Intergenic
961236896 3:125375069-125375091 CGGCCTGGCAGGCCCGGGCCCGG - Intronic
961359422 3:126357562-126357584 CCGCGCGGGCGGGCCGGGGCGGG - Intergenic
961574457 3:127823231-127823253 CGGCGGGGGCGGCCCGAGGTGGG + Intronic
961612803 3:128153822-128153844 CGGTGAGCGCGGGCCGGGGCGGG + Exonic
961647373 3:128399860-128399882 AGGGCAGGGCAGCCCGGGCCCGG - Intronic
961827543 3:129606786-129606808 CGGCGAGGCTGACCCGGGCCCGG - Exonic
962575522 3:136752158-136752180 CGGCGACGGCGGCGGGGGGCGGG - Intronic
962811174 3:138960616-138960638 CGGCGATGGGGACCAGGGCCCGG + Intergenic
963061761 3:141231910-141231932 CGGTGAGTGCGGCGCGGGCCTGG + Exonic
964720416 3:159763952-159763974 GGGCGGGGCCGGGCCGGGCCGGG + Intronic
964771287 3:160226115-160226137 TGGCGGCGGCGGCCGGGGCCGGG + Exonic
965520377 3:169663802-169663824 CGGGGAGGGCGGCGGGGGGCGGG + Intergenic
967272631 3:187743793-187743815 CGGCGGCGGCGGCCCGGGGAGGG - Intronic
967904089 3:194486749-194486771 CGGCGGGGCCGGGCCGGCCCTGG + Intronic
967930626 3:194687807-194687829 CGGCGGGGGCTCCCTGGGCCCGG + Exonic
968230694 3:197003170-197003192 CGGGAAGGGCCGCGCGGGCCCGG + Exonic
968434107 4:576190-576212 CGGCGGCGGCGGCGCGGGCCCGG - Intergenic
968503612 4:962105-962127 TGGTGAGGGCGGCCGGGTCCTGG - Intronic
968509496 4:989171-989193 CGGTGAGGGAGGCCCTGCCCAGG - Exonic
968511536 4:997813-997835 CAGCGAGGGGAGCCCGGGACAGG - Intronic
968514881 4:1011792-1011814 GGGCGCGGGCGGCTCGGGCCGGG - Intronic
968562225 4:1290072-1290094 CGGCGAGGGCGGCGGGAGCTGGG + Intronic
968582902 4:1403162-1403184 CGGCGGGGGCGGACCGGGACCGG - Exonic
968698109 4:2042441-2042463 CGGCGGGCTCGGCGCGGGCCCGG - Exonic
968729123 4:2261535-2261557 CGGCGAGGGCGGGGCCGGCCGGG + Intronic
968775439 4:2536969-2536991 CGGCGGCGGCGGCTCGGGCGGGG + Intronic
968893505 4:3385220-3385242 AGGCGAGGGCTGCCAGGGCCAGG - Intronic
968983136 4:3861415-3861437 CGGCGAGGGAGGCCCCAGCATGG + Intergenic
969330752 4:6472382-6472404 GGGCGGGGGCGGCCGGGGGCGGG + Intronic
969416990 4:7067531-7067553 CAGCGAGGCCGAGCCGGGCCGGG - Intronic
969559809 4:7939760-7939782 CGGCGGCGGCGGCCCCGCCCCGG - Exonic
969715853 4:8867792-8867814 CGGTGGGGGCGGCGCGGGCGCGG + Exonic
974069346 4:57110135-57110157 CGGCGAGGGCGAGCCGTGCGGGG - Exonic
974069443 4:57110477-57110499 CCGGGAGGGCGGCACGGGCGGGG - Intergenic
975779014 4:77819761-77819783 CGGGGCGGGCGGGCCGGGCCGGG + Intergenic
979455640 4:120922844-120922866 GGGCGCGGGGGGCGCGGGCCTGG + Exonic
981550279 4:145936613-145936635 GGGCGCGGGCTGCTCGGGCCAGG - Intronic
983449927 4:167896397-167896419 AGGCGAGGCAGGCCCAGGCCTGG + Intergenic
984206521 4:176792982-176793004 AGGGGAGGGCAGCCCGGGCTCGG - Intergenic
984668070 4:182449099-182449121 CGGCGGCGGCGGCCTGGGGCGGG + Intronic
985064149 4:186104996-186105018 CGGCCGAGGCGGCCCGGGCCGGG - Intronic
985129097 4:186723881-186723903 CGGCGCCGGCGGGCGGGGCCGGG - Intronic
985247989 4:187995965-187995987 CGGCGAGGCCGGCTCCGGCCTGG - Intronic
985638530 5:1052296-1052318 CGGCGTGGGCAGCCTGGGCCTGG - Exonic
985823360 5:2175986-2176008 CGGTGAGGACGGCGCTGGCCTGG + Intergenic
986813664 5:11385173-11385195 CGGCGGCGGCGGCGCGGGCTCGG + Exonic
988823845 5:34915287-34915309 AGGCGATGGCGGGGCGGGCCCGG + Intronic
989229827 5:39073939-39073961 CGGCGAGGCGGCCCCGGGCTCGG + Intronic
990381879 5:55227169-55227191 CGGAGGCGGCGGCCCGGGCTGGG + Exonic
990509990 5:56481188-56481210 CGGCCGGGGCGGCCTTGGCCTGG + Intronic
991684297 5:69167426-69167448 CGCCGAGGTGGGCCCAGGCCTGG + Intronic
992828147 5:80569722-80569744 CGGCGAGGGCTGCCCGGCCGCGG - Intronic
993905693 5:93621180-93621202 CGGTGAGGGCGGCGAGGGCCAGG + Intronic
994197272 5:96935223-96935245 CGGCGCCCGCGACCCGGGCCGGG + Intronic
996221391 5:120936910-120936932 CGGCATGGGCGGCCCAGGCTCGG + Intergenic
997201291 5:132011573-132011595 CGGGGAGGCCGGGCCGGGCCGGG - Exonic
997239164 5:132294336-132294358 AGGGGAGGGCGGCCCAGCCCGGG - Intronic
997584058 5:135034349-135034371 CGGCGCGGGCGGCTTGGGGCTGG - Intronic
997978355 5:138453716-138453738 CGGTGAGGGGGGCCTGGGGCTGG - Intergenic
997980403 5:138464848-138464870 GGGCGAGGGCGAGTCGGGCCGGG - Intergenic
997984602 5:138492340-138492362 CGGCGCGGGAGGCGCGGGACGGG + Intergenic
998071045 5:139198239-139198261 CGGTGAGGGCCGCCCGGCCCTGG - Intronic
998205983 5:140157256-140157278 CAGGGAGGGAGGCCCGGGGCTGG - Intergenic
998435884 5:142108689-142108711 AGGCTAGGCCGGGCCGGGCCGGG + Exonic
1001065075 5:168529588-168529610 CGGCGGCGGCGGCGCGGGCAAGG + Exonic
1001065110 5:168529675-168529697 CGGCGGGGGCGGCCGGGGCCGGG + Exonic
1001401819 5:171450706-171450728 CGGCGAGGGGGGTCGGGGCCGGG + Intronic
1002352033 5:178590096-178590118 CGGCGACGACGGCCGGGTCCCGG - Exonic
1002524313 5:179806883-179806905 CGGCAGGGCCGGGCCGGGCCGGG + Intronic
1002600595 5:180352457-180352479 TGGGGAGGGCGGCCGCGGCCCGG - Intronic
1002632440 5:180590756-180590778 CGGCGGCGGAGGCCGGGGCCGGG - Exonic
1002926569 6:1609044-1609066 CGGCGAGGGCTGCCGGAGCCCGG - Intergenic
1003175969 6:3752187-3752209 CGGGGCGGGGGGCGCGGGCCGGG + Intergenic
1004395687 6:15245237-15245259 AGGGGAGGGGGGCCGGGGCCCGG + Intergenic
1005385262 6:25279352-25279374 CGGGGAGAGCGGCGCGGGGCGGG - Intronic
1006369226 6:33633839-33633861 GGGCGGGGCCGGGCCGGGCCGGG + Intronic
1006392717 6:33768211-33768233 CGGCCAGGGCAGCCCAGTCCTGG + Intergenic
1006599000 6:35213675-35213697 CGGCGATGGGGGAGCGGGCCTGG - Intergenic
1006932696 6:37697366-37697388 CGGCGAAGCAGCCCCGGGCCCGG + Exonic
1008920876 6:56843481-56843503 CGGCGAGGGCGGGCGGGGGCCGG + Intronic
1011633853 6:89352648-89352670 CGGCTCGGGCGGACGGGGCCTGG + Exonic
1016010655 6:139135150-139135172 CCGCGCGGGCGCCGCGGGCCCGG - Exonic
1016447824 6:144150769-144150791 CGGGGAGGGCGGGTCGGGGCGGG + Intronic
1017671970 6:156777709-156777731 CGGCGGCGGCGGCGCGGGCGCGG + Intergenic
1017811688 6:157988302-157988324 TGGGGAGGGCGGCCCCAGCCTGG - Intronic
1018023895 6:159789384-159789406 CGGTAAGGGCGGGCCGGGCCTGG - Exonic
1018432200 6:163731044-163731066 GGGCGAGGGCTGCCCTGGGCTGG + Intergenic
1018613058 6:165662164-165662186 CGGCGGCGGCGGCCGGGGACCGG + Intronic
1018876762 6:167827544-167827566 CCGCGAGCGCGGCGCGGCCCCGG + Intronic
1018890509 6:167978254-167978276 CAGCGCGGGCGGCCGGGGCGAGG + Intergenic
1019054508 6:169213607-169213629 CGGGGTGGGGGGCACGGGCCCGG + Intergenic
1019360342 7:601611-601633 CGGCGGGGCCGGGCGGGGCCGGG - Intronic
1019395817 7:816989-817011 CGCGGCGGGCGGCCCGGGCTGGG + Intronic
1019474373 7:1236832-1236854 CGGCGCGGGCGGCGGGGGCGCGG - Exonic
1019492979 7:1323715-1323737 CGGTGGGGGCGGCAGGGGCCCGG + Intergenic
1019500176 7:1360746-1360768 CGGTGAGGGTGGCTCTGGCCTGG - Intergenic
1019509080 7:1408166-1408188 AGGGGAGGGCAGGCCGGGCCTGG + Intergenic
1019525340 7:1478115-1478137 TGGAGAGTGCGGCCGGGGCCGGG + Intronic
1020094580 7:5361425-5361447 CGGCCTGTGCTGCCCGGGCCAGG - Intronic
1020099953 7:5389064-5389086 CGCCGAGGGCCGCCAGGACCGGG - Exonic
1020100345 7:5390807-5390829 CCGTGAGGGCTGCCTGGGCCTGG - Intronic
1020238614 7:6374943-6374965 CGGCCCGGGCGGCGCGTGCCTGG + Intronic
1020274296 7:6615504-6615526 CGGCGGCGGCGGCGGGGGCCGGG + Intergenic
1022094569 7:27130619-27130641 CGCAGACGGCGGCCCGGGCGGGG - Exonic
1022106285 7:27199916-27199938 CGGCGGCGGCTGCCGGGGCCGGG - Exonic
1022375384 7:29806909-29806931 CGGCCGGGCCGGGCCGGGCCGGG + Intronic
1022400046 7:30028371-30028393 GCGCGAGCGCGTCCCGGGCCCGG + Exonic
1023722792 7:43113121-43113143 CGGGGATGCCGGCCCGGACCGGG - Intronic
1023810295 7:43906432-43906454 GGGCGGGGGCGCCCCTGGCCGGG + Intronic
1023881860 7:44325324-44325346 CGGCGCGCGCGGGCTGGGCCGGG - Intronic
1024579991 7:50793488-50793510 CGGGGAGGGCGGGCGGGGCCGGG - Intergenic
1026822281 7:73557584-73557606 CGGCGGGAGCGGCGGGGGCCGGG + Exonic
1026909455 7:74083875-74083897 CGGAGGGCGCGGGCCGGGCCGGG - Intronic
1027350274 7:77304994-77305016 AGGCCAGGCAGGCCCGGGCCTGG + Intronic
1027654985 7:80919238-80919260 CCGCGGGGGCGGACCGGGCGGGG + Exonic
1029238739 7:99143830-99143852 CGGCGGGGCCGGGCCGGGCCGGG - Exonic
1029238807 7:99144064-99144086 CGGCGAGGGCGGCGGGCGTCCGG - Exonic
1029259793 7:99294069-99294091 CGAGGGAGGCGGCCCGGGCCTGG - Intergenic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1029372551 7:100158618-100158640 CGGAGAGACCGGCCCGGTCCCGG + Exonic
1029438225 7:100574142-100574164 TGGTGAGGGTGGCCTGGGCCTGG - Intronic
1029535408 7:101154752-101154774 CGGCGGGGCCGTCCCGAGCCGGG + Intronic
1031008437 7:116499679-116499701 AGGCGAGGGGGGGCGGGGCCGGG + Exonic
1031604092 7:123748511-123748533 AGGCGGGAGCGGCGCGGGCCAGG - Intronic
1032037811 7:128532154-128532176 CGGCGAGGGGCGCCGGGACCAGG + Intergenic
1032074587 7:128830393-128830415 CGGGAAGGGCGGGCTGGGCCGGG - Exonic
1032087255 7:128890798-128890820 CGACGTGGGCGGAGCGGGCCTGG + Intronic
1032125321 7:129189007-129189029 CGTCCGGGGGGGCCCGGGCCCGG + Exonic
1032190483 7:129762653-129762675 GGGCGAAGGCGGCCCGGGTGCGG + Intergenic
1033361242 7:140640488-140640510 CGGGGAGGTAGGGCCGGGCCGGG - Exonic
1034129074 7:148699070-148699092 CGGCGGCGGCGGCGCAGGCCCGG + Intronic
1034412210 7:150947565-150947587 GGGCGAGGGAGGACCGGGCGTGG - Intronic
1034516400 7:151584092-151584114 TGGCAAGGGAGGCCTGGGCCTGG - Intronic
1034902336 7:154915256-154915278 CGGCCCGGGCTTCCCGGGCCTGG + Intergenic
1034911564 7:155002660-155002682 GGGCGCGGGAGGCCCGGGCCCGG - Intronic
1035169687 7:157010542-157010564 GTGCGAGCGCGGCCCGGGGCGGG - Exonic
1035369236 7:158368557-158368579 CTGTGCGGGCGGGCCGGGCCAGG - Intronic
1035552904 8:544270-544292 CGGCGCGGGCGTCGTGGGCCCGG - Intronic
1035573192 8:687750-687772 CGGCTAGGGCCCCGCGGGCCTGG - Intronic
1035760436 8:2064727-2064749 TGGCGAGGGGGGCCGTGGCCTGG + Intronic
1036195297 8:6708558-6708580 CGGGCGCGGCGGCCCGGGCCCGG + Exonic
1037305248 8:17497319-17497341 GGGCGAGGGCGCCCTGGGGCCGG + Intronic
1037529244 8:19757403-19757425 CGGCGGGGGCGGCCAAGGCCGGG + Intronic
1037589975 8:20304005-20304027 GGGCGGGGCCGGCCCGGGGCGGG + Intergenic
1038429719 8:27490816-27490838 CGTCCAGGAAGGCCCGGGCCTGG + Exonic
1039454208 8:37697000-37697022 CTGCGAGCGAGGGCCGGGCCGGG - Intronic
1039996787 8:42541389-42541411 CGGCGCGCGCAGCCCGGGCGGGG + Intronic
1039996885 8:42541763-42541785 CGGGGCGGGCGGCGCGGGGCGGG - Intronic
1040038872 8:42896864-42896886 CGGTGTGGGCGGCCGGGGGCGGG + Intronic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1042271583 8:66961662-66961684 CGTCCCGGGCGGACCGGGCCGGG - Exonic
1042902813 8:73746290-73746312 AGGGGAGGGCGGCCCGGGGAGGG - Intronic
1043463671 8:80485949-80485971 GGGCGTGTGCGGCCGGGGCCGGG - Intronic
1044819261 8:96144944-96144966 GGGCGAGGGCAGCCAAGGCCTGG + Exonic
1048980950 8:139703233-139703255 GGGCAGGGGCGGCGCGGGCCCGG + Intergenic
1048985203 8:139731331-139731353 AAGCGAGGGCCGCCCAGGCCTGG + Intronic
1049109707 8:140635397-140635419 CGGCGCGGGCGGCAGGGGCCGGG - Intronic
1049194526 8:141308127-141308149 CGGGGCGGCCGGGCCGGGCCGGG + Intronic
1049237263 8:141518568-141518590 CCGCGCGCGGGGCCCGGGCCCGG + Exonic
1049357393 8:142195568-142195590 CTGCGAGGGCGTCCAGGGCTTGG + Intergenic
1049411362 8:142475370-142475392 CGCCGAGGCCGGCCCGGGTGGGG - Intronic
1049570867 8:143369727-143369749 GGGCGTGGGCGCCCAGGGCCTGG - Intronic
1049585089 8:143429312-143429334 CGGCGACGGCGGCGCGGGCTCGG + Exonic
1049620912 8:143597956-143597978 GGGCGCGGGGGGCCCGGGCAGGG - Exonic
1049690685 8:143957646-143957668 TGGCCAGGGCAGCCAGGGCCTGG - Intronic
1049694839 8:143978082-143978104 CTGCGGGGAAGGCCCGGGCCAGG + Intronic
1049788525 8:144462612-144462634 CGGCGGGGGCGGCCCGGCCGCGG - Intronic
1049800205 8:144514149-144514171 TGGGGTGGGCGGCCAGGGCCGGG - Intronic
1051876903 9:21802872-21802894 CGGCAAGGGACGCACGGGCCGGG - Intronic
1054731417 9:68705589-68705611 CGGCGGGCGGGGCCGGGGCCGGG - Intronic
1055611717 9:78031386-78031408 CGGGGGCGGCGGCCAGGGCCGGG + Exonic
1056475175 9:86946299-86946321 CGGCGCGGGCGGCCCCGGCGCGG - Exonic
1056992420 9:91423951-91423973 CGGCAGGGGCGGGCCGGGGCGGG + Intergenic
1057488713 9:95506355-95506377 CCGCGAGGAGGGACCGGGCCGGG + Intronic
1057921990 9:99105160-99105182 CGGCGCGGCCGGGCCGGGCCGGG + Exonic
1059208262 9:112486801-112486823 GGGCGCGGGCGGGCCGGGGCGGG - Intronic
1059375199 9:113876088-113876110 CGGCGAGGCCGGCCCGGGGGCGG + Intergenic
1059375232 9:113876171-113876193 CGGCGCGGCCGGTGCGGGCCGGG + Intergenic
1060106712 9:120877218-120877240 CGGCGGGGGCGGGGCGGGGCGGG + Exonic
1060209014 9:121699201-121699223 GGCCGAGGGCGGGCCGGGCTCGG - Intronic
1060283414 9:122228618-122228640 CTGGGTGAGCGGCCCGGGCCGGG - Intronic
1060468722 9:123930128-123930150 CGGAGGGGGCGGCGCGCGCCGGG - Intronic
1060478057 9:124000011-124000033 CGGGGAGGGGCGCCGGGGCCCGG - Intergenic
1061129952 9:128703074-128703096 CTGCGAGGGCGTCGCGGGGCCGG - Intronic
1061196933 9:129111639-129111661 CGGCGGGGCCAGGCCGGGCCGGG + Intronic
1061299664 9:129697392-129697414 CGGCGCGGGCAGCGCGGGGCTGG + Intronic
1061781155 9:132996747-132996769 AGGGGAGGGCGGCCCGGCCCTGG + Intergenic
1061843823 9:133375866-133375888 CGGCCCGGGCGGCCTGGGTCGGG + Intronic
1061961875 9:133992705-133992727 CGACGCGGGCGGCCCAGGCCCGG - Intergenic
1062022582 9:134326402-134326424 CGGCGGCGGGGGCGCGGGCCGGG + Intronic
1062022612 9:134326547-134326569 CGGCGCGGCCGGCCCGGGCCCGG - Intronic
1062340209 9:136090786-136090808 CCCCGAGGGCAGCCCGGCCCTGG - Intronic
1062461985 9:136666000-136666022 CGGCTGGGTCGGGCCGGGCCGGG + Intronic
1062556219 9:137114428-137114450 CGGCGGGGGCGGCCGGGCCGGGG + Intronic
1062618079 9:137407110-137407132 CGGCGTGGGGTGCCCGGGACTGG - Intronic
1062653528 9:137590414-137590436 CGGCGGCGGAGGCCCGAGCCCGG - Exonic
1203731900 Un_GL000216v2:98865-98887 CCGGGAGGGCGGCCCAGGGCCGG + Intergenic
1203468081 Un_GL000220v1:105203-105225 CCGGGAGGGCGTCCCCGGCCCGG + Intergenic
1203469054 Un_GL000220v1:108388-108410 CGGGGGGTGGGGCCCGGGCCGGG + Intergenic
1203469878 Un_GL000220v1:111676-111698 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1203475902 Un_GL000220v1:149175-149197 CCGGGAGGGCGTCCCCGGCCCGG + Intergenic
1203476875 Un_GL000220v1:152360-152382 CGGGGGGTGGGGCCCGGGCCGGG + Intergenic
1203477699 Un_GL000220v1:155648-155670 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1186426126 X:9465292-9465314 GGGCGGGGGCGGCCCGGGGGCGG + Exonic
1188542661 X:31266963-31266985 CGGCGCGGGCGGGCCGGGGAGGG + Intronic
1189104249 X:38220469-38220491 CCGCGAGGGCGCCCCGCGCCTGG + Intronic
1189534526 X:41923205-41923227 GAGCGAGGGCGGCCCGGGCCCGG + Intronic
1189821628 X:44874025-44874047 GGGCGAGCGCGGCGCCGGCCAGG - Intronic
1192410484 X:70928977-70928999 CAGCCAGTGTGGCCCGGGCCTGG - Exonic
1194503483 X:94705468-94705490 AGGCGAGGCAGGCCCAGGCCTGG - Intergenic
1195269460 X:103215557-103215579 TGGCGAGGAGGGCCAGGGCCAGG + Intronic
1195278854 X:103310519-103310541 CGGCTAGGAGGGCCCGGGCCCGG - Intronic
1195285236 X:103376912-103376934 CAGCGAGGGGAGCCCGGGCTCGG + Intronic
1195716842 X:107826307-107826329 CGGCGGCGGCGACCGGGGCCCGG + Exonic
1198302178 X:135343734-135343756 CGGCCAAGGCGCCCGGGGCCAGG + Exonic
1199772643 X:150984155-150984177 CGGCGCCCGCGGCCCGGGGCGGG + Intronic
1199976603 X:152898136-152898158 CGGCCGGGCCGGGCCGGGCCGGG - Intergenic
1200052445 X:153442193-153442215 CGGGGAGGGCGCCCGAGGCCAGG + Intergenic
1200057288 X:153468306-153468328 AGGAGGGGGAGGCCCGGGCCTGG + Intronic
1200185557 X:154180881-154180903 CGGGGGGGGGGGGCCGGGCCGGG + Intergenic
1200202616 X:154292941-154292963 CGGGGGGGGGGGGCCGGGCCGGG + Intronic
1200211508 X:154348751-154348773 CGGCCAGGGCGGCCTGGGCCGGG + Exonic
1200213979 X:154359378-154359400 TGGCACGGGCGGCCTGGGCCTGG - Exonic
1200217592 X:154374843-154374865 CGGCGAGGGCCGCCAGGCCCTGG + Intergenic
1200229490 X:154437025-154437047 CCGGGAGGGCTGCCAGGGCCCGG - Exonic
1200256073 X:154584211-154584233 GGGTGAGGGCGGCACGGCCCCGG - Intergenic
1200261696 X:154620192-154620214 GGGTGAGGGCGGCACGGCCCCGG + Intergenic