ID: 1132729600

View in Genome Browser
Species Human (GRCh38)
Location 16:1354958-1354980
Sequence GTCCCCCGCGTCTGTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 2, 2: 3, 3: 10, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132729590_1132729600 10 Left 1132729590 16:1354925-1354947 CCCACGTCTGTGGGGTGGGGCCG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG 0: 1
1: 2
2: 3
3: 10
4: 72
1132729595_1132729600 -10 Left 1132729595 16:1354945-1354967 CCGGGCGTGGAAAGTCCCCCGCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG 0: 1
1: 2
2: 3
3: 10
4: 72
1132729591_1132729600 9 Left 1132729591 16:1354926-1354948 CCACGTCTGTGGGGTGGGGCCGG 0: 1
1: 1
2: 6
3: 22
4: 284
Right 1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG 0: 1
1: 2
2: 3
3: 10
4: 72
1132729583_1132729600 27 Left 1132729583 16:1354908-1354930 CCGGGCGTGGATTGTCTCCCACG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG 0: 1
1: 2
2: 3
3: 10
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132729600 Original CRISPR GTCCCCCGCGTCTGTGGGGT GGG Intronic
904930418 1:34082512-34082534 GGCCGCCACGTCTGGGGGGTGGG + Intronic
913109032 1:115641777-115641799 GTGTCCCGGGTGTGTGGGGTCGG + Intergenic
920065503 1:203266721-203266743 GGCCGCCCCGTCTGGGGGGTGGG - Intronic
1072480866 10:95809388-95809410 GGCCTCCCCGTCTGGGGGGTGGG - Intronic
1072480987 10:95809700-95809722 GGCCACCCCGTCTGGGGGGTGGG - Intronic
1074618492 10:115093488-115093510 GGACGCCGCGGCTGTGGGGTCGG + Intronic
1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG + Exonic
1076839492 10:133039077-133039099 GACCCCTGGGGCTGTGGGGTTGG - Intergenic
1077343780 11:2037323-2037345 GTCCCCAGCCTGTCTGGGGTGGG - Intergenic
1083765373 11:64838970-64838992 GACCCCTGAGTCTGTGTGGTTGG - Intronic
1083879203 11:65539940-65539962 GGCCCCCGCGCAGGTGGGGTGGG - Intronic
1087388240 11:97501088-97501110 GTCCACAGCGTCTGTGGGTCAGG - Intergenic
1088917188 11:114236512-114236534 GCCCCCCGTGTCTGTCTGGTGGG - Intronic
1202826766 11_KI270721v1_random:92512-92534 GTCCCCAGCCTGTCTGGGGTGGG - Intergenic
1105503133 13:20989268-20989290 GGCCTCCGCGTCACTGGGGTTGG + Exonic
1111122984 13:83879087-83879109 GGCCCCGGGGCCTGTGGGGTTGG - Exonic
1112216328 13:97434335-97434357 GGCCGCCGCGGCTGTGAGGTGGG + Exonic
1113242159 13:108350040-108350062 GTCCCACGTGTCTGGGTGGTTGG + Intergenic
1132729567 16:1354857-1354879 GTCCCCCGCGTCTGTAGGGCTGG + Intronic
1132729576 16:1354889-1354911 CTCCCCCGCGTCTGTAGGGCCGG + Intronic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG + Intronic
1132729612 16:1354990-1355012 CTCCCCCGCATCTGCGGGGTGGG + Intronic
1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG + Intronic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG + Intronic
1133847511 16:9469123-9469145 GTCCAGAGGGTCTGTGGGGTAGG - Intergenic
1138037746 16:53625411-53625433 GGCCGCCCCGTCTGGGGGGTGGG + Intronic
1142810847 17:2394935-2394957 GTCCCCAGCGTGGGTGGGGGCGG + Exonic
1142986392 17:3697513-3697535 GTTCCCCGAGTCTGTGGCTTAGG - Intergenic
1143425379 17:6831916-6831938 GTGCCCCGCGTCTTCGCGGTAGG - Intergenic
1152016928 17:77756895-77756917 GTCTCTCGCCTCTGTGGGCTCGG - Intergenic
1152094178 17:78263553-78263575 GTCCCCTGCCTCTGTGGAGCTGG - Intergenic
1152596761 17:81241636-81241658 GTGCCCCTCCTGTGTGGGGTTGG + Intergenic
1154218093 18:12430084-12430106 GTCCCCCGTGTGTGTGGGTTCGG + Intronic
1154367628 18:13726136-13726158 GCCGCCGGGGTCTGTGGGGTCGG + Intronic
1157260905 18:46174617-46174639 GGCCCCAGCGTCTGGGGGCTTGG - Intronic
1162066526 19:8129143-8129165 CTCATCCACGTCTGTGGGGTGGG + Exonic
1162975621 19:14205987-14206009 GTCCAGCGCCTCTCTGGGGTCGG + Exonic
1163806886 19:19405235-19405257 GGCCCCGGTGTCTGTGGGGAGGG - Intronic
1165016928 19:32888072-32888094 GTTCCCCTGGTCTGTGGGGCTGG - Intronic
1165938517 19:39403504-39403526 GTCCCCCAGGTCTGTGGGTTTGG + Intergenic
1166147083 19:40845259-40845281 GTCCCCGTAGTCTGGGGGGTGGG + Intronic
1166701680 19:44885925-44885947 GTCCCTCCAGGCTGTGGGGTAGG - Exonic
1168266065 19:55224738-55224760 GTCCCTGGGCTCTGTGGGGTCGG - Intergenic
927413787 2:22855855-22855877 CTCCCCCGAGGCTGTGGGGAAGG + Intergenic
927554979 2:24024876-24024898 ATCCTCCCCGTCAGTGGGGTCGG - Intronic
932873185 2:75424446-75424468 GTCCCCAGGGGCTGTGGGGAGGG + Intergenic
942564927 2:177256865-177256887 GTTCCCACCATCTGTGGGGTGGG + Intronic
943348458 2:186769578-186769600 GTCCCTCACATCTGTGGGCTGGG + Intergenic
1169065095 20:2690743-2690765 GTTTCCCGTGTGTGTGGGGTTGG + Intergenic
1174116523 20:48230189-48230211 GTCCCAGGCCACTGTGGGGTAGG + Intergenic
1174198999 20:48794070-48794092 GTCCTCCCACTCTGTGGGGTAGG - Intronic
1181814321 22:25426650-25426672 GTGCCCAGCGTCTGTGTGGCTGG + Intergenic
1181832818 22:25576156-25576178 GTGCCCAGCGTCTGTGTGGCTGG + Intronic
1183351303 22:37336184-37336206 GGACCCTGCGTCTGTGAGGTGGG - Intergenic
1183482987 22:38075133-38075155 GTGCCCCGCGGCTGTGGTGCCGG + Exonic
1184599376 22:45533462-45533484 GGCCCCCGCGTCTGTGAGATGGG + Intronic
1184889620 22:47371832-47371854 GTCCCCCCCGACTGTGGGGAGGG - Intergenic
953136807 3:40188874-40188896 TTCCCACGTGTCTGTGGGGTGGG - Intronic
953730378 3:45442269-45442291 GAACCCTGTGTCTGTGGGGTGGG - Intronic
954306121 3:49726381-49726403 ATCCCCCACTTCAGTGGGGTGGG + Exonic
959892421 3:111571045-111571067 GTCCCTCCAGGCTGTGGGGTAGG + Intronic
967568154 3:190995323-190995345 CTCCCCAGCTTCTGTGGGGGTGG + Intergenic
969333291 4:6492340-6492362 GACCTCCCTGTCTGTGGGGTTGG - Intronic
974597930 4:64037519-64037541 GGCCGCCCCGTCTGGGGGGTGGG + Intergenic
987323563 5:16792568-16792590 GCCCCCCGCTCCTGTGGGGAGGG - Intronic
989665201 5:43846177-43846199 GTCCCAGGCATCTGGGGGGTGGG + Intergenic
1002189958 5:177473095-177473117 GTCCCCCGGGCCCGGGGGGTAGG + Exonic
1003012036 6:2435385-2435407 GTCCCCCGGGACCGTGAGGTGGG - Intergenic
1004457032 6:15800793-15800815 CTCACCTGAGTCTGTGGGGTAGG - Intergenic
1016223557 6:141706203-141706225 GTCCTCTGTGTCTGTGGGGAGGG - Intergenic
1018365353 6:163114684-163114706 GTTCCCAGGGGCTGTGGGGTGGG + Intronic
1035349543 7:158236501-158236523 TGCCCTGGCGTCTGTGGGGTGGG + Intronic
1037776476 8:21838945-21838967 GTCCCGGGGGTCTGTGGGGAGGG + Intergenic
1040471658 8:47738997-47739019 GACGCCCGGGTCTGCGGGGTCGG - Exonic
1052274907 9:26664612-26664634 GGCCGCCCCGTCTGGGGGGTGGG + Intergenic
1056595771 9:88006801-88006823 GTCCCCCGCGTTGGGGGGTTTGG - Intergenic
1057550318 9:96047421-96047443 GCTCCCCGCCCCTGTGGGGTTGG - Intergenic
1061474536 9:130855501-130855523 GTGCCAGGCGTCTGTGGGGGAGG - Intronic
1062502023 9:136855748-136855770 GTCCCCCGAGGCTGGGGGCTGGG + Exonic
1198731845 X:139739405-139739427 GTCACACCCGTCTTTGGGGTTGG - Intronic
1202367937 Y:24179609-24179631 GACGCCAGCGTGTGTGGGGTGGG - Intergenic
1202502846 Y:25490508-25490530 GACGCCAGCGTGTGTGGGGTGGG + Intergenic