ID: 1132729622

View in Genome Browser
Species Human (GRCh38)
Location 16:1355022-1355044
Sequence GTCTCCCGCATGTGCGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 41}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132729607_1132729622 17 Left 1132729607 16:1354982-1355004 CCTGGATACTCCCCCGCATCTGC 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG 0: 1
1: 0
2: 2
3: 6
4: 41
1132729615_1132729622 6 Left 1132729615 16:1354993-1355015 CCCCGCATCTGCGGGGTGGGGCG 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG 0: 1
1: 0
2: 2
3: 6
4: 41
1132729617_1132729622 4 Left 1132729617 16:1354995-1355017 CCGCATCTGCGGGGTGGGGCGTG 0: 1
1: 0
2: 0
3: 25
4: 237
Right 1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG 0: 1
1: 0
2: 2
3: 6
4: 41
1132729614_1132729622 7 Left 1132729614 16:1354992-1355014 CCCCCGCATCTGCGGGGTGGGGC 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG 0: 1
1: 0
2: 2
3: 6
4: 41
1132729616_1132729622 5 Left 1132729616 16:1354994-1355016 CCCGCATCTGCGGGGTGGGGCGT 0: 1
1: 0
2: 0
3: 15
4: 123
Right 1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG 0: 1
1: 0
2: 2
3: 6
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132729622 Original CRISPR GTCTCCCGCATGTGCGGGGT CGG Intronic
902348416 1:15835847-15835869 GTCTCGCGCATGCGCGGAGGGGG - Intergenic
903276826 1:22227328-22227350 GTCTACCGCCTGTGTGGGCTTGG - Intergenic
903587215 1:24425186-24425208 CTCTCCAGCTTGTGCTGGGTGGG + Intronic
907470537 1:54670810-54670832 CTCTCCCGCATGCCCAGGGTGGG - Exonic
913109032 1:115641777-115641799 GTGTCCCGGGTGTGTGGGGTCGG + Intergenic
923126030 1:231035335-231035357 GTCTCCCACCTGTGCAGAGTGGG - Intronic
1063622607 10:7662797-7662819 GTCTCCCTTATGTGCAGGGCTGG - Intronic
1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG + Exonic
1075949086 10:126462012-126462034 GTCTCCAGCAAGTGCAGGGGAGG - Intronic
1106514811 13:30444409-30444431 GTGTCCCGCATTTGCTGAGTGGG - Intergenic
1108705552 13:52982316-52982338 GTCTAGCTCATGTGCAGGGTGGG + Intergenic
1122779356 14:104137156-104137178 GTCTGCCGGCAGTGCGGGGTGGG + Intergenic
1130666497 15:85873941-85873963 GCCTCCCGGTTGTGCGGTGTTGG + Intergenic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG + Intronic
1132729612 16:1354990-1355012 CTCCCCCGCATCTGCGGGGTGGG + Intronic
1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG + Intronic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132773721 16:1580010-1580032 GTCTCCCGCATGTGTCTTGTGGG - Intronic
1135188837 16:20337971-20337993 GACTCCCACATGTGCTGGGCTGG + Intronic
1140767264 16:78171896-78171918 GTCACCTGCAGGTGGGGGGTTGG + Intronic
1155529951 18:26756839-26756861 GTCTGGCGCCTGTGCAGGGTGGG + Intergenic
1160736036 19:662838-662860 GTCTCCCGCATGTACAGGACGGG + Intronic
1162494604 19:11016513-11016535 GTCTCCCCCATGTGCTTGTTTGG + Intronic
1164882060 19:31741062-31741084 GGCACCCACATGTGCGGGGTCGG + Intergenic
927484295 2:23478293-23478315 GACTCCTGCATGTGAGGGGAGGG - Intronic
934522190 2:95026470-95026492 TTCTGCCCCGTGTGCGGGGTGGG + Intronic
937136721 2:119559822-119559844 GTCTCAGGCCTGTGTGGGGTGGG + Intronic
948614902 2:239192171-239192193 TCCTCACCCATGTGCGGGGTGGG - Intronic
1169065095 20:2690743-2690765 GTTTCCCGTGTGTGTGGGGTTGG + Intergenic
1170889641 20:20367250-20367272 GTCTCCCGAAAGCGCGGGATTGG - Intergenic
1174814893 20:53678176-53678198 TTCTCCTGTGTGTGCGGGGTGGG + Intergenic
1181177789 22:21047619-21047641 GTCTCCCAGATGTGGAGGGTAGG - Intronic
950957147 3:17066093-17066115 GTCTCCCGGATGTGAAGAGTGGG + Intronic
966923521 3:184629790-184629812 TTCTCCCGCCTGTCGGGGGTAGG + Intronic
978070723 4:104464691-104464713 GTTTCCCACATTTGCGGGATGGG - Intergenic
993168482 5:84385143-84385165 GTCTCCAGCATGTGCGGAGAAGG - Intergenic
1007842543 6:44728475-44728497 GTCTCCTGCAGGTGCGGAGCCGG + Intergenic
1020002167 7:4762243-4762265 GTCACCCGGGTGTGCGAGGTGGG + Exonic
1021304151 7:19011027-19011049 GTCTCCAGCATGGGCAGGTTAGG + Intergenic
1030181757 7:106716798-106716820 GTCGTCAGCATGTGTGGGGTGGG + Intergenic
1032932978 7:136695236-136695258 GGTTCCCGCATCTGCAGGGTTGG - Intergenic
1035519437 8:265698-265720 GTCTCCAGCCTGCGCTGGGTGGG - Intergenic
1043838310 8:85069641-85069663 TTTTCCTGCATGTGCGTGGTGGG - Intergenic
1202297545 Y:23376079-23376101 GTTTCCCCCATGTGCAGGTTTGG + Intergenic
1202573264 Y:26294518-26294540 GTTTCCCCCATGTGCAGGTTTGG - Intergenic