ID: 1132729631

View in Genome Browser
Species Human (GRCh38)
Location 16:1355054-1355076
Sequence GTCTGCCGCGTCTGCGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 1, 2: 3, 3: 15, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132729624_1132729631 5 Left 1132729624 16:1355026-1355048 CCCGCATGTGCGGGGTCGGGTGT 0: 1
1: 0
2: 2
3: 6
4: 69
Right 1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG 0: 1
1: 1
2: 3
3: 15
4: 68
1132729625_1132729631 4 Left 1132729625 16:1355027-1355049 CCGCATGTGCGGGGTCGGGTGTG 0: 1
1: 0
2: 3
3: 8
4: 57
Right 1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG 0: 1
1: 1
2: 3
3: 15
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132729631 Original CRISPR GTCTGCCGCGTCTGCGGGGT CGG Intronic
903950623 1:26994053-26994075 CTCTGGCGCGGCTGCGGGGGCGG + Exonic
904762907 1:32818057-32818079 TTCTGCCGCGTCTCGCGGGTGGG + Exonic
904930418 1:34082512-34082534 GGCCGCCACGTCTGGGGGGTGGG + Intronic
905680904 1:39869950-39869972 GGCTGCCCCGTCTGGGAGGTGGG + Intronic
907671457 1:56477894-56477916 CTCTGCCGGGTCTGCGGGTCGGG - Intergenic
911634022 1:100213521-100213543 GGCTGTCCCGTCTGCAGGGTCGG + Intronic
920065503 1:203266721-203266743 GGCCGCCCCGTCTGGGGGGTGGG - Intronic
922769773 1:228175598-228175620 GTCTGCTGCGCCTACTGGGTGGG + Exonic
924260166 1:242221812-242221834 GTCTGCTGTGTCTGTGGGGCCGG - Intronic
1062843826 10:689816-689838 GTCCGCAGCGCCTGCGGGGAGGG - Intergenic
1062922307 10:1289529-1289551 GTCTGCCACGGCTGCTGGGTGGG + Intronic
1066086792 10:31979239-31979261 CACTGCCCCGTCTGCGAGGTGGG - Intergenic
1070843248 10:79502697-79502719 GTTTGCCTCCTCTGTGGGGTGGG - Intergenic
1070930423 10:80256939-80256961 GTTTGCCTCCTCTGTGGGGTGGG + Intergenic
1072480914 10:95809499-95809521 ATCTGCCCCGTCTGGGAGGTGGG - Intronic
1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG + Exonic
1081528523 11:43942879-43942901 GCCTCCGGCGTCTGCGGGGCCGG - Exonic
1087407344 11:97745950-97745972 GTCTGCCGCGTTTGCGGGCCAGG - Intergenic
1089732393 11:120527351-120527373 GTCTGCAGGGTCTGCTGGGTGGG + Intronic
1091582274 12:1797117-1797139 GGCTGCGGCCTCGGCGGGGTGGG + Intronic
1096522435 12:52191877-52191899 GCCTGCCGCTCCTGCGTGGTTGG - Exonic
1102656252 12:114484850-114484872 GGCAGCCCCGTCTGGGGGGTGGG - Intergenic
1104961382 12:132490021-132490043 GCGGGCCGCGTGTGCGGGGTGGG + Exonic
1108359966 13:49659960-49659982 GCCTGCAGCCTCTGCAGGGTAGG + Intergenic
1112390370 13:98978052-98978074 GTCTGCAGAGCCTGTGGGGTGGG + Intronic
1116502227 14:45635493-45635515 GGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1116849339 14:49893025-49893047 CTCTGCTGCGCCTGCGTGGTCGG + Intergenic
1122779356 14:104137156-104137178 GTCTGCCGGCAGTGCGGGGTGGG + Intergenic
1123971637 15:25513362-25513384 GTCTGGTGCTTCTGCTGGGTGGG + Intergenic
1125554071 15:40569671-40569693 GTCCGCCGCTTCTTCGGGGGCGG - Exonic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG + Intronic
1132729612 16:1354990-1355012 CTCCCCCGCATCTGCGGGGTGGG + Intronic
1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG + Intronic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG + Intronic
1132807019 16:1779551-1779573 GCCTGCCTTGTCTGTGGGGTGGG - Intronic
1138037746 16:53625411-53625433 GGCCGCCCCGTCTGGGGGGTGGG + Intronic
1143452372 17:7043509-7043531 GTCATCGCCGTCTGCGGGGTGGG + Exonic
1154192646 18:12243408-12243430 GGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1154192678 18:12243516-12243538 GGCTGCCCCGTCTGGGAGGTGGG + Intergenic
1155529951 18:26756839-26756861 GTCTGGCGCCTGTGCAGGGTGGG + Intergenic
1158190961 18:54828427-54828449 GTCCGCCGCGGCGGCGGGGCTGG - Exonic
1162098447 19:8324820-8324842 GTCTGCCCCGTCTGGGGAGTGGG + Exonic
1162547549 19:11339590-11339612 GGCTTCTGCGGCTGCGGGGTCGG - Exonic
1166121363 19:40689583-40689605 GTCTGCAGTGTCTGCGGTGACGG - Intronic
1168289983 19:55352913-55352935 GACAGCGGCCTCTGCGGGGTGGG + Intronic
1168346802 19:55653869-55653891 GTCTGCCGCGCCTGCGCGGCGGG + Intergenic
928325750 2:30318204-30318226 GTCTGCAGTGGCTGCGGGGATGG + Intronic
934522190 2:95026470-95026492 TTCTGCCCCGTGTGCGGGGTGGG + Intronic
935540067 2:104338288-104338310 GTCTGCAGCCTCAGCGGGGAAGG - Intergenic
940817224 2:158310515-158310537 GGCGGCCCCGTCTGGGGGGTGGG - Intronic
946185623 2:217978969-217978991 GGCTGCCGGGCCTGCGGGGCGGG + Intronic
1169171854 20:3471462-3471484 GTCTGCCCCGCCGGCTGGGTGGG + Exonic
1174568127 20:51481604-51481626 GTCTGTGGCGTCTGCGGGGGTGG + Intronic
1175361432 20:58414415-58414437 GGCTGCCCCGTCTGAGGGGTGGG - Intronic
1176162068 20:63653152-63653174 GTCTGCGGCGCCGGCGGGGCTGG - Intronic
1180830526 22:18903722-18903744 GTCTGCCAGGTCTGCCAGGTGGG - Intergenic
1180962000 22:19766377-19766399 CTCAGCCGCGTCTGCGGAGAGGG - Exonic
1180976315 22:19850751-19850773 GTCTGCCACGTCTGCCCTGTTGG - Exonic
1181960171 22:26617054-26617076 GTCTGCTTCCTCTGAGGGGTTGG + Intronic
1203280616 22_KI270734v1_random:128993-129015 GTCTGCCAGGTCTGCCAGGTGGG - Intergenic
972700683 4:41491297-41491319 GGCTGCCCCGTCTGGGAGGTGGG - Intronic
974597930 4:64037519-64037541 GGCCGCCCCGTCTGGGGGGTGGG + Intergenic
983940730 4:173531899-173531921 GTTTGCCGCGGCTGGGCGGTAGG + Intergenic
991939706 5:71838750-71838772 GTCTGCCACCTCTGAGGGGTAGG - Intergenic
993934790 5:93986421-93986443 GGCTGCCCCATCTGGGGGGTGGG + Intronic
998228904 5:140346734-140346756 CTCCGCCGCGCCCGCGGGGTCGG - Intergenic
1002569163 5:180130265-180130287 GCCTGCTTCCTCTGCGGGGTAGG + Intronic
1006430598 6:33993385-33993407 GGCTGCAGTGTCTGCAGGGTGGG + Intergenic
1008909832 6:56720945-56720967 GGCTGCCCCGTCTGGGGGGTGGG - Intronic
1019110190 6:169702902-169702924 ATCTGCGCCGTCGGCGGGGTAGG - Exonic
1019206828 6:170368808-170368830 GTCTGCCGGGGCTGGGGGGGGGG + Intronic
1023954004 7:44871126-44871148 GGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1025112419 7:56229873-56229895 GTCTGCAGCGTGAGCGGGGCTGG - Intergenic
1030788643 7:113695184-113695206 GTCTGCCCCATCTCTGGGGTTGG - Intergenic
1040471658 8:47738997-47739019 GACGCCCGGGTCTGCGGGGTCGG - Exonic
1049845497 8:144798942-144798964 GTCGGCCGCGGCCGCGGGGCGGG + Intronic
1052274907 9:26664612-26664634 GGCCGCCCCGTCTGGGGGGTGGG + Intergenic
1055090875 9:72364421-72364443 GCGTGCCGCCTCTGCGGGGCCGG - Intronic
1056229052 9:84526478-84526500 GGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1061860702 9:133467343-133467365 GGCTGCGGGGTCTGCGGGGTCGG - Intronic
1192885665 X:75334725-75334747 GGCTGCCCCGTCTGGGAGGTGGG - Intergenic
1200151318 X:153952754-153952776 GTCTGCCGGCTCTGCGGTGGTGG - Exonic