ID: 1132729639

View in Genome Browser
Species Human (GRCh38)
Location 16:1355086-1355108
Sequence GTCTCCCGCGTCTGCGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 4, 2: 4, 3: 4, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132729633_1132729639 4 Left 1132729633 16:1355059-1355081 CCGCGTCTGCGGGGTCGGGTGTG 0: 2
1: 3
2: 1
3: 4
4: 84
Right 1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG 0: 1
1: 4
2: 4
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132729639 Original CRISPR GTCTCCCGCGTCTGCGGGGT CGG Intronic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
902770925 1:18645230-18645252 GTGGCCCGCGTCGGCGGGCTGGG + Intronic
904303100 1:29568807-29568829 GTCTCCCTGGTCTGGTGGGTGGG + Intergenic
912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG + Intergenic
913109032 1:115641777-115641799 GTGTCCCGGGTGTGTGGGGTCGG + Intergenic
913963039 1:143353954-143353976 GAATCCCGGGTCAGCGGGGTGGG + Intergenic
914057394 1:144179539-144179561 GAATCCCGGGTCAGCGGGGTGGG + Intergenic
914121752 1:144786827-144786849 GAATCCCGGGTCAGCGGGGTGGG - Intergenic
914919963 1:151839808-151839830 GCATCCCGCGTCTGCAGGGCGGG + Intronic
916171274 1:162003219-162003241 ATCTCCCAAGTCTGCTGGGTAGG - Intronic
917565463 1:176207689-176207711 GTCTCTCTCTTCTGAGGGGTAGG + Intergenic
919297689 1:195722817-195722839 GGCTCCTGAGTCTGCTGGGTAGG - Intergenic
920528721 1:206686095-206686117 GTGTCCCCCGGCTGCGGGGGCGG + Intronic
922238439 1:223738845-223738867 GTGTCCCGTGACTGCGGGGCAGG - Intronic
1062922307 10:1289529-1289551 GTCTGCCACGGCTGCTGGGTGGG + Intronic
1069118617 10:64539381-64539403 GTCTCCCTTCTCTGCAGGGTAGG - Intergenic
1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG + Exonic
1081528523 11:43942879-43942901 GCCTCCGGCGTCTGCGGGGCCGG - Exonic
1087407344 11:97745950-97745972 GTCTGCCGCGTTTGCGGGCCAGG - Intergenic
1089732393 11:120527351-120527373 GTCTGCAGGGTCTGCTGGGTGGG + Intronic
1103350137 12:120278256-120278278 GGCTCCCCCGTCTGGGAGGTGGG - Intergenic
1106325342 13:28684127-28684149 GTCTCCCGCCCCTGCAGGCTTGG + Intergenic
1123014596 14:105367738-105367760 GTCTCCCCCGCCTGAGGAGTAGG - Intronic
1125882964 15:43209399-43209421 GTGGCCTGGGTCTGCGGGGTGGG + Exonic
1132729567 16:1354857-1354879 GTCCCCCGCGTCTGTAGGGCTGG + Intronic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG + Intronic
1132729612 16:1354990-1355012 CTCCCCCGCATCTGCGGGGTGGG + Intronic
1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG + Intronic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG + Intronic
1138426050 16:56932544-56932566 GGCGCCCGCGTCGGCGGGGCAGG - Intronic
1143425379 17:6831916-6831938 GTGCCCCGCGTCTTCGCGGTAGG - Intergenic
1143452372 17:7043509-7043531 GTCATCGCCGTCTGCGGGGTGGG + Exonic
1144011269 17:11150483-11150505 CTCTCCAGCGTCTGCGGGAATGG + Intergenic
1152016928 17:77756895-77756917 GTCTCTCGCCTCTGTGGGCTCGG - Intergenic
1152590550 17:81209387-81209409 GTCTCCTCCGTCAGCAGGGTGGG + Intronic
1153636451 18:7117493-7117515 GTCTCCCGCGCTTGCCGGGGAGG - Intronic
1158105729 18:53882992-53883014 GTCTCCCTTGGCTGGGGGGTGGG + Intergenic
1160073638 18:75650899-75650921 ATCTCCCTAGTCTGCGGGCTTGG - Intergenic
1162098447 19:8324820-8324842 GTCTGCCCCGTCTGGGGAGTGGG + Exonic
1162547549 19:11339590-11339612 GGCTTCTGCGGCTGCGGGGTCGG - Exonic
1167489205 19:49782121-49782143 GACTCCTGGGTCTGCGGGGGAGG + Intronic
1168346802 19:55653869-55653891 GTCTGCCGCGCCTGCGCGGCGGG + Intergenic
1168354880 19:55694857-55694879 GACTCCGGCGTCTTCCGGGTGGG - Exonic
927692278 2:25216381-25216403 TTCTCCTGAGTCTGCGGGGCGGG + Intergenic
934050482 2:88206401-88206423 GTCTCCAGAGTTTGAGGGGTGGG - Intergenic
934278036 2:91589226-91589248 GAATCCCGGGTCAGCGGGGTGGG + Intergenic
934522190 2:95026470-95026492 TTCTGCCCCGTGTGCGGGGTGGG + Intronic
948806723 2:240456299-240456321 GCCTCTCCCGTCTGCGTGGTGGG + Intronic
1169065095 20:2690743-2690765 GTTTCCCGTGTGTGTGGGGTTGG + Intergenic
1169171715 20:3470887-3470909 GTCTCCGGCGTCCGCGGCGCCGG - Intergenic
1174568127 20:51481604-51481626 GTCTGTGGCGTCTGCGGGGGTGG + Intronic
1174814893 20:53678176-53678198 TTCTCCTGTGTGTGCGGGGTGGG + Intergenic
1175329246 20:58151261-58151283 ATCTCCCACGTCTTCGTGGTGGG - Intronic
1175361432 20:58414415-58414437 GGCTGCCCCGTCTGAGGGGTGGG - Intronic
1176302723 21:5106232-5106254 GGCTCCCGCCTCTGCCTGGTGGG - Intergenic
1176310237 21:5145453-5145475 GTGTCCCGCGTCTGGGCTGTGGG - Intronic
1179846818 21:44116582-44116604 GTGTCCCGCGTCTGGGCTGTGGG + Intronic
1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG + Intergenic
1183961377 22:41413746-41413768 GCCTCCGGCGTCCGCCGGGTGGG - Intergenic
1184050305 22:41999081-41999103 GCCTCGCGCGTTTGAGGGGTGGG + Intronic
1185055047 22:48575197-48575219 GTCTCCCGCGCCAGCAGGGCCGG + Intronic
960684705 3:120285099-120285121 GTCTCGCGCGTTCGCGGGGCTGG + Intergenic
969569047 4:7997681-7997703 GTCTCCTGCTGCTGCTGGGTGGG + Intronic
985545608 5:507685-507707 GATTCGGGCGTCTGCGGGGTGGG - Intronic
991939706 5:71838750-71838772 GTCTGCCACCTCTGAGGGGTAGG - Intergenic
1001640332 5:173239283-173239305 CTCTCCCCTGGCTGCGGGGTGGG - Intergenic
1008909832 6:56720945-56720967 GGCTGCCCCGTCTGGGGGGTGGG - Intronic
1019499659 7:1358614-1358636 GTCTCCCGGGCCTGGGGGGACGG - Intergenic
1019742160 7:2680370-2680392 GTCTCCAGTGCCTGCTGGGTGGG - Intronic
1020002167 7:4762243-4762265 GTCACCCGGGTGTGCGAGGTGGG + Exonic
1023021408 7:36015062-36015084 GACTCCCTCGTCTCCGAGGTCGG + Intergenic
1032932978 7:136695236-136695258 GGTTCCCGCATCTGCAGGGTTGG - Intergenic
1040471658 8:47738997-47739019 GACGCCCGGGTCTGCGGGGTCGG - Exonic
1061860702 9:133467343-133467365 GGCTGCGGGGTCTGCGGGGTCGG - Intronic