ID: 1132729641

View in Genome Browser
Species Human (GRCh38)
Location 16:1355090-1355112
Sequence ACACCCGACCCCGCAGACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 4, 2: 1, 3: 2, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132729641_1132729646 0 Left 1132729641 16:1355090-1355112 CCCGCGTCTGCGGGGTCGGGTGT 0: 1
1: 4
2: 1
3: 2
4: 61
Right 1132729646 16:1355113-1355135 GGATGGTCTCCCGCCTCTGCGGG 0: 1
1: 1
2: 3
3: 22
4: 145
1132729641_1132729645 -1 Left 1132729641 16:1355090-1355112 CCCGCGTCTGCGGGGTCGGGTGT 0: 1
1: 4
2: 1
3: 2
4: 61
Right 1132729645 16:1355112-1355134 TGGATGGTCTCCCGCCTCTGCGG 0: 1
1: 2
2: 3
3: 11
4: 94
1132729641_1132729648 5 Left 1132729641 16:1355090-1355112 CCCGCGTCTGCGGGGTCGGGTGT 0: 1
1: 4
2: 1
3: 2
4: 61
Right 1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG 0: 1
1: 1
2: 4
3: 11
4: 103
1132729641_1132729647 1 Left 1132729641 16:1355090-1355112 CCCGCGTCTGCGGGGTCGGGTGT 0: 1
1: 4
2: 1
3: 2
4: 61
Right 1132729647 16:1355114-1355136 GATGGTCTCCCGCCTCTGCGGGG 0: 1
1: 1
2: 2
3: 7
4: 77
1132729641_1132729649 6 Left 1132729641 16:1355090-1355112 CCCGCGTCTGCGGGGTCGGGTGT 0: 1
1: 4
2: 1
3: 2
4: 61
Right 1132729649 16:1355119-1355141 TCTCCCGCCTCTGCGGGGTCGGG 0: 1
1: 1
2: 4
3: 15
4: 151
1132729641_1132729654 15 Left 1132729641 16:1355090-1355112 CCCGCGTCTGCGGGGTCGGGTGT 0: 1
1: 4
2: 1
3: 2
4: 61
Right 1132729654 16:1355128-1355150 TCTGCGGGGTCGGGTGTGGATGG 0: 3
1: 1
2: 1
3: 13
4: 221
1132729641_1132729652 11 Left 1132729641 16:1355090-1355112 CCCGCGTCTGCGGGGTCGGGTGT 0: 1
1: 4
2: 1
3: 2
4: 61
Right 1132729652 16:1355124-1355146 CGCCTCTGCGGGGTCGGGTGTGG 0: 1
1: 2
2: 3
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132729641 Original CRISPR ACACCCGACCCCGCAGACGC GGG (reversed) Intronic
905442876 1:38005804-38005826 ACACGAGACCCCGCAGACCATGG + Intergenic
906513388 1:46424119-46424141 ACCCCAGCCCCCGCAGACACAGG + Intergenic
906961050 1:50419620-50419642 TCACCCGACGGCGCAGACTCGGG - Exonic
915070532 1:153261843-153261865 CCACCAGACCCAGCAGAAGCAGG + Exonic
1065636765 10:27742652-27742674 AAACCCGGCCCCGCAGGCCCGGG + Intronic
1076157586 10:128215642-128215664 ACACCCAACCCCCAGGACGCTGG - Intergenic
1081528520 11:43942875-43942897 CCGCCCGGCCCCGCAGACGCCGG + Exonic
1084674688 11:70627245-70627267 ACACACGTCCCTGCAGCCGCCGG - Intronic
1091280215 11:134377549-134377571 ACACCCGCGCCCGCCGATGCTGG + Intronic
1095584554 12:43836016-43836038 ACACCCGCCGCCGCCTACGCCGG - Intronic
1096370821 12:51067615-51067637 ACACCTCACCCCGCTGACCCTGG + Intronic
1100958749 12:99938883-99938905 TCAAGCGGCCCCGCAGACGCTGG + Intronic
1102370871 12:112381831-112381853 ACACCTGCCCCGGCAGCCGCCGG + Intronic
1122388568 14:101365122-101365144 ACACCCGAGGCCACAGACCCAGG + Intergenic
1127900733 15:63339051-63339073 CCACCCGGCCCCACAGAAGCTGG - Intronic
1129454064 15:75667177-75667199 ACACCCCACCCAGCTGATGCCGG - Intergenic
1129804012 15:78438737-78438759 AGACCCGAACACGGAGACGCAGG - Intronic
1132729562 16:1354829-1354851 ACGCCTGACCCCACAGGCGCAGG - Intronic
1132729580 16:1354893-1354915 ACGCCCGGCCCTACAGACGCGGG - Intronic
1132729604 16:1354962-1354984 AGGCCCCACCCCACAGACGCGGG - Intronic
1132729616 16:1354994-1355016 ACGCCCCACCCCGCAGATGCGGG - Intronic
1132729624 16:1355026-1355048 ACACCCGACCCCGCACATGCGGG - Intronic
1132729641 16:1355090-1355112 ACACCCGACCCCGCAGACGCGGG - Intronic
1132729650 16:1355122-1355144 ACACCCGACCCCGCAGAGGCGGG - Intronic
1132729660 16:1355154-1355176 ACACCCGACCCCACAGACGCGGG - Intronic
1132729668 16:1355186-1355208 ACACCCGACCCCACAGACGCGGG - Intronic
1132729677 16:1355218-1355240 ACACCCGACCCCACAGACGCAGG - Intronic
1134452273 16:14370885-14370907 ACTCCCTAACCCGCAGACCCAGG + Intergenic
1138431447 16:56971847-56971869 ACACCCCTCCCCGCACACCCAGG + Intronic
1145910654 17:28540280-28540302 GCACCCGCCCCAGCAGAGGCTGG + Intronic
1146176179 17:30667798-30667820 CCACCCCACCCCGCAGGCGGAGG - Intergenic
1146349637 17:32083909-32083931 CCACCCCACCCCGCAGGCGGAGG - Intergenic
1165924769 19:39320362-39320384 ACACCCGGCTCCACAGACCCGGG + Intergenic
926087576 2:10029645-10029667 TCACCTGCCCCCGGAGACGCCGG + Intergenic
932413344 2:71559951-71559973 CCACCTGGCCCCGCAGAGGCAGG + Intronic
935966264 2:108479685-108479707 ACACAAGACCCAGCAGAGGCCGG + Intronic
946230257 2:218286891-218286913 AAACCCCACCCAGCAGGCGCAGG + Intronic
948409027 2:237744841-237744863 GCACCGGACCCCGCAGACAGTGG - Intronic
1172011496 20:31848559-31848581 CCACCCGCCCCCGCAGGTGCAGG - Intronic
1172778395 20:37421424-37421446 AAACCCCACTCTGCAGACGCCGG + Intergenic
1179492868 21:41752624-41752646 TCACCCGACCCTGCAAACCCCGG + Intronic
1180969264 22:19806537-19806559 ACACCCCACCCCCCTGCCGCAGG - Intronic
1182355083 22:29719339-29719361 ACACCAGACCCCACAGGCACCGG + Intergenic
1184175817 22:42788226-42788248 CCTCCCGACCCCACACACGCTGG + Intergenic
1185393834 22:50577003-50577025 CTACCAGACCCCGCAGACCCGGG - Exonic
955673825 3:61429349-61429371 ACACCCCAACCTGGAGACGCAGG - Intergenic
962381007 3:134898074-134898096 ACAGCCCACCCCACAGACTCCGG - Intronic
968230449 3:197002465-197002487 TCACCCGGCCCCGCACCCGCTGG - Exonic
970253129 4:14137475-14137497 ACACCAGACACCACAGATGCTGG + Intergenic
978328947 4:107590328-107590350 ACACCCGTCCCAGCAGCCACAGG - Intronic
990962461 5:61408975-61408997 TGACCCGACCGCGCAGAGGCGGG + Intronic
994175166 5:96702884-96702906 ACACCGGACCCCGCAGTCCTCGG - Intronic
1002029348 5:176416468-176416490 AAGCCCGTCCCCGCCGACGCCGG - Exonic
1007431524 6:41779913-41779935 ACCTCCGACCCCGCGGCCGCGGG - Intronic
1019198525 6:170296204-170296226 ACACCCGGCCCCCCAGCCCCGGG - Intronic
1019275691 7:174376-174398 TCACCTGGCCCCGCAGAAGCTGG - Intergenic
1019334607 7:477076-477098 GCACCCGAGCCCTCAGACGGCGG + Intergenic
1032074853 7:128831463-128831485 GCCCCAGAGCCCGCAGACGCGGG - Intronic
1033282887 7:140018219-140018241 ACCCCCCACCCCGCAAAGGCAGG - Intronic
1034422653 7:150997486-150997508 ACACCCCAGCCCACAGACTCGGG + Intronic
1035888992 8:3324068-3324090 ACACCCAACCCCAGAGACCCAGG + Intronic
1035889024 8:3324211-3324233 ACACCCAACCCCAGAGACCCGGG + Intronic
1039067026 8:33617726-33617748 ACACTAGACCCTGCAGACCCAGG - Intergenic
1040471655 8:47738993-47739015 CTCCCCGACCCCGCAGACCCGGG + Exonic
1055000715 9:71446652-71446674 ACTCCCGTCGCAGCAGACGCCGG - Intronic
1059157067 9:111999582-111999604 AGGCCCGACCCAGCAGATGCTGG + Intergenic
1185464706 X:347380-347402 GCTTTCGACCCCGCAGACGCAGG + Intronic
1191720412 X:64224168-64224190 ACACCAGACACAGCAGACACTGG + Intergenic
1197774583 X:130110901-130110923 ACACACGTCCCCGCAGGCGGCGG + Intergenic