ID: 1132729642

View in Genome Browser
Species Human (GRCh38)
Location 16:1355091-1355113
Sequence CACACCCGACCCCGCAGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 2, 1: 3, 2: 1, 3: 4, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132729642_1132729652 10 Left 1132729642 16:1355091-1355113 CCGCGTCTGCGGGGTCGGGTGTG 0: 2
1: 3
2: 1
3: 4
4: 84
Right 1132729652 16:1355124-1355146 CGCCTCTGCGGGGTCGGGTGTGG 0: 1
1: 2
2: 3
3: 15
4: 152
1132729642_1132729647 0 Left 1132729642 16:1355091-1355113 CCGCGTCTGCGGGGTCGGGTGTG 0: 2
1: 3
2: 1
3: 4
4: 84
Right 1132729647 16:1355114-1355136 GATGGTCTCCCGCCTCTGCGGGG 0: 1
1: 1
2: 2
3: 7
4: 77
1132729642_1132729649 5 Left 1132729642 16:1355091-1355113 CCGCGTCTGCGGGGTCGGGTGTG 0: 2
1: 3
2: 1
3: 4
4: 84
Right 1132729649 16:1355119-1355141 TCTCCCGCCTCTGCGGGGTCGGG 0: 1
1: 1
2: 4
3: 15
4: 151
1132729642_1132729654 14 Left 1132729642 16:1355091-1355113 CCGCGTCTGCGGGGTCGGGTGTG 0: 2
1: 3
2: 1
3: 4
4: 84
Right 1132729654 16:1355128-1355150 TCTGCGGGGTCGGGTGTGGATGG 0: 3
1: 1
2: 1
3: 13
4: 221
1132729642_1132729645 -2 Left 1132729642 16:1355091-1355113 CCGCGTCTGCGGGGTCGGGTGTG 0: 2
1: 3
2: 1
3: 4
4: 84
Right 1132729645 16:1355112-1355134 TGGATGGTCTCCCGCCTCTGCGG 0: 1
1: 2
2: 3
3: 11
4: 94
1132729642_1132729648 4 Left 1132729642 16:1355091-1355113 CCGCGTCTGCGGGGTCGGGTGTG 0: 2
1: 3
2: 1
3: 4
4: 84
Right 1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG 0: 1
1: 1
2: 4
3: 11
4: 103
1132729642_1132729655 30 Left 1132729642 16:1355091-1355113 CCGCGTCTGCGGGGTCGGGTGTG 0: 2
1: 3
2: 1
3: 4
4: 84
Right 1132729655 16:1355144-1355166 TGGATGGTCTCCCGCGTCTGTGG 0: 2
1: 3
2: 1
3: 7
4: 56
1132729642_1132729646 -1 Left 1132729642 16:1355091-1355113 CCGCGTCTGCGGGGTCGGGTGTG 0: 2
1: 3
2: 1
3: 4
4: 84
Right 1132729646 16:1355113-1355135 GGATGGTCTCCCGCCTCTGCGGG 0: 1
1: 1
2: 3
3: 22
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132729642 Original CRISPR CACACCCGACCCCGCAGACG CGG (reversed) Intronic
900187413 1:1338902-1338924 GACACCCCACCCTGCAGACCAGG + Intronic
900318470 1:2070797-2070819 CACCCCGGCCCCCGCAGCCGAGG - Intronic
903250934 1:22052832-22052854 CCCCCACGATCCCGCAGACGGGG - Exonic
903485764 1:23688609-23688631 CACTCCCCACCTCCCAGACGGGG - Intergenic
910679041 1:89843779-89843801 CAGACCCGACCCCGCGCACCTGG - Exonic
913078377 1:115360235-115360257 CACTCCTGACCTCCCAGACGGGG + Intergenic
918038760 1:180899417-180899439 CACCCCCGACACTGCAGACAGGG + Intergenic
1063178994 10:3579910-3579932 CACACTCCACCCTGCAGCCGAGG - Intergenic
1063822687 10:9855665-9855687 CACCCCCCACCTCCCAGACGGGG + Intergenic
1065636764 10:27742651-27742673 CAAACCCGGCCCCGCAGGCCCGG + Intronic
1066086788 10:31979234-31979256 CGCCCCCCACCTCGCAGACGGGG + Intergenic
1067477940 10:46578733-46578755 CGCACCCGACCCCTCACACCTGG - Intronic
1067616797 10:47763054-47763076 CGCACCCGACCCCTCACACCTGG + Intergenic
1072480861 10:95809383-95809405 CGCCCCCCACCCCCCAGACGGGG + Intronic
1072480910 10:95809494-95809516 CACCCCCCACCTCCCAGACGGGG + Intronic
1072480984 10:95809695-95809717 CGCTCCCCACCCCCCAGACGGGG + Intronic
1072481014 10:95809772-95809794 CACTCCCCACCTCCCAGACGGGG + Intronic
1082166340 11:48955463-48955485 CACCCCCCACCTCCCAGACGGGG + Intergenic
1083986867 11:66221258-66221280 CCCACCCCGCCCCGCAGTCGCGG - Intronic
1085716707 11:78879427-78879449 CACTCCCCACCTCCCAGACGGGG - Intronic
1085716761 11:78879618-78879640 CACTCCCCACCTCCCAGACGGGG - Intronic
1096528620 12:52229656-52229678 CACACCCGACCCCAAGGATGTGG + Intergenic
1096968624 12:55648303-55648325 CACACCCCACCTCCCAGACGGGG + Intergenic
1104995043 12:132649109-132649131 CACACTGGAACCCACAGACGGGG + Intronic
1114594240 14:23898283-23898305 CCCCCCCCACCCCCCAGACGTGG + Intergenic
1120926694 14:89804163-89804185 CACCCCCTACCCCCCAAACGTGG + Intronic
1122835236 14:104427561-104427583 CACCCCCGGCCACGCAGCCGAGG + Intergenic
1128489700 15:68134577-68134599 CGCCCCCCACCCCCCAGACGGGG + Intronic
1128972264 15:72118081-72118103 CGCCCCCGACCCCGCGCACGCGG + Exonic
1132365152 15:101251650-101251672 CACGCCCGCCCCCGCCGCCGCGG + Exonic
1132576588 16:667091-667113 CTCACCCCACCCCAGAGACGAGG - Intronic
1132677688 16:1127417-1127439 CACCCCCCACCCTACAGACGGGG - Intergenic
1132729581 16:1354894-1354916 CACGCCCGGCCCTACAGACGCGG - Intronic
1132729605 16:1354963-1354985 CAGGCCCCACCCCACAGACGCGG - Intronic
1132729617 16:1354995-1355017 CACGCCCCACCCCGCAGATGCGG - Intronic
1132729625 16:1355027-1355049 CACACCCGACCCCGCACATGCGG - Intronic
1132729633 16:1355059-1355081 CACACCCGACCCCGCAGACGCGG - Intronic
1132729642 16:1355091-1355113 CACACCCGACCCCGCAGACGCGG - Intronic
1132729651 16:1355123-1355145 CACACCCGACCCCGCAGAGGCGG - Intronic
1132729661 16:1355155-1355177 CACACCCGACCCCACAGACGCGG - Intronic
1132729669 16:1355187-1355209 CACACCCGACCCCACAGACGCGG - Intronic
1138037750 16:53625416-53625438 CCCACCCCACCCCCCAGACGGGG - Intronic
1148909414 17:50932696-50932718 CACACCCAGCCCCGCAGCCTCGG - Intergenic
1151843776 17:76636678-76636700 CGCCCCCGACCTCCCAGACGGGG - Intronic
1153636388 18:7117266-7117288 CACCCCCGCCCGCGCAGCCGGGG + Intronic
1155218333 18:23662639-23662661 CCCACCCGACCCCGCGGGCCCGG + Intronic
1161157448 19:2739999-2740021 CAGTCTCGACCCCACAGACGCGG + Exonic
1165924768 19:39320361-39320383 CACACCCGGCTCCACAGACCCGG + Intergenic
927509348 2:23634743-23634765 CACACCCGGCCCCCATGACGTGG + Intronic
936433229 2:112482125-112482147 CACGCCCGCCCCCGCCGGCGCGG - Intergenic
1174483677 20:50848291-50848313 CACTCCTGACCCCTCAGACCTGG - Intronic
1176705833 21:10119604-10119626 CACCCCAGTCCCCGCAGCCGCGG - Intergenic
1181851554 22:25753217-25753239 CACACCCGCCCCTGCCGACCGGG - Intronic
1184458008 22:44622209-44622231 CACCCCCCACCCTGCAGACCGGG - Intergenic
1185074105 22:48673929-48673951 GACACCCGACCCCAGAGCCGGGG - Intronic
1185393835 22:50577004-50577026 CCTACCAGACCCCGCAGACCCGG - Exonic
950041130 3:9920158-9920180 CACACCCCTCCCCACAGAAGTGG - Intronic
953084902 3:39656013-39656035 CACCCCCCACCTCCCAGACGGGG - Intergenic
954807368 3:53228399-53228421 CACACCCAACCTCAGAGACGAGG + Intronic
958407192 3:93764541-93764563 CACTCCTGACCTCCCAGACGGGG + Intergenic
968699337 4:2047267-2047289 CACACCCAACGCAGCGGACGTGG - Intergenic
969440252 4:7212756-7212778 CACACCCAACCCTGCAGCCAGGG + Intronic
969476284 4:7424256-7424278 CCCACCCTACCCTTCAGACGAGG - Intronic
969608186 4:8212588-8212610 CACACCTGACCCCGAAGGCCTGG - Intronic
977724853 4:100284268-100284290 CACACCAGACACCGAAGACTGGG - Intergenic
980651516 4:135722245-135722267 CACACAAAACCCCACAGACGTGG - Intergenic
985527681 5:415391-415413 CCCACCCGACCAGGCAGACTCGG - Intronic
985527705 5:415459-415481 CCCACCCGACCAGGCAGACTCGG - Intronic
985527730 5:415527-415549 CCCACCCGACCAGGCAGACTCGG - Intronic
990962460 5:61408974-61408996 CTGACCCGACCGCGCAGAGGCGG + Intronic
1001640327 5:173239278-173239300 CACCCCCCACCCCGCAGCCAGGG + Intergenic
1007295191 6:40815931-40815953 CACCCCCCACCTCCCAGACGGGG - Intergenic
1007327596 6:41073648-41073670 CACACGGGACCCCGCGGCCGCGG - Intronic
1013316875 6:108951693-108951715 CACACCCGACGCCCCTCACGGGG + Intronic
1025813264 7:64888735-64888757 CACACCCAGCCCCGCAGAGCCGG + Intronic
1028984126 7:96996749-96996771 CAAACCCGACCCGGCAAGCGTGG + Intergenic
1033644207 7:143288362-143288384 CACATCCCTCCCCTCAGACGCGG - Exonic
1034422652 7:150997485-150997507 CACACCCCAGCCCACAGACTCGG + Intronic
1035889023 8:3324210-3324232 CACACCCAACCCCAGAGACCCGG + Intronic
1036032760 8:4991846-4991868 CGCACTTGACCCCGCAGGCGTGG + Intronic
1038420912 8:27433597-27433619 CACACCCGAGTCCCCAGAGGCGG + Intronic
1043471649 8:80569094-80569116 CACCCCCGACCCCTCAGAGGTGG + Intergenic
1044581961 8:93833642-93833664 CACTCCCCACCTCCCAGACGGGG + Intergenic
1049657072 8:143803664-143803686 CCCCCGCGACCCCACAGACGAGG - Exonic
1054787203 9:69221175-69221197 CGCACCCGAGACCGCAGCCGTGG + Exonic
1056229222 9:84526998-84527020 CACTCCCCACCTCCCAGACGGGG + Intergenic
1056576076 9:87857165-87857187 CACTCCTGACCTCCCAGACGTGG + Intergenic
1057707449 9:97406409-97406431 CACACCCCACCCCACAGCGGGGG + Intergenic
1057995915 9:99821721-99821743 CACACCCTCCCTCGCACACGCGG + Intergenic
1202790867 9_KI270719v1_random:89693-89715 CACCCCAGTCCCCGCAGCCGCGG - Intergenic
1186854475 X:13612633-13612655 CACCCCCCACCTCCCAGACGGGG + Intronic
1189421772 X:40862856-40862878 CACTCCCCACCTCCCAGACGGGG - Intergenic
1192505139 X:71676630-71676652 CACTCCCCACCTCCCAGACGGGG - Intergenic
1192663937 X:73069111-73069133 CACTCCCCACCTCCCAGACGGGG - Intergenic