ID: 1132729648

View in Genome Browser
Species Human (GRCh38)
Location 16:1355118-1355140
Sequence GTCTCCCGCCTCTGCGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 1, 2: 4, 3: 11, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132729642_1132729648 4 Left 1132729642 16:1355091-1355113 CCGCGTCTGCGGGGTCGGGTGTG 0: 2
1: 3
2: 1
3: 4
4: 84
Right 1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG 0: 1
1: 1
2: 4
3: 11
4: 103
1132729641_1132729648 5 Left 1132729641 16:1355090-1355112 CCCGCGTCTGCGGGGTCGGGTGT 0: 1
1: 4
2: 1
3: 2
4: 61
Right 1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG 0: 1
1: 1
2: 4
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132729648 Original CRISPR GTCTCCCGCCTCTGCGGGGT CGG Intronic
900582507 1:3416036-3416058 TTCTCCCGCCCCTGCGAGGCAGG - Intronic
900778146 1:4600039-4600061 AGCTTCCGCCTCTGCAGGGTCGG + Intergenic
901047354 1:6405220-6405242 GGCTCCGGCCTCTGCTGGGTGGG - Intergenic
903276826 1:22227328-22227350 GTCTACCGCCTGTGTGGGCTTGG - Intergenic
904260979 1:29287474-29287496 GTCTCCCCACTCTGAGGTGTAGG + Intronic
904771161 1:32882205-32882227 GTCCCGCTCCTCTACGGGGTGGG + Intergenic
905445427 1:38025673-38025695 GTCTCTTGCCCCTGCTGGGTGGG + Intergenic
912274066 1:108238445-108238467 TTCTCCCGCCTCTGCTGCCTGGG + Intronic
912287201 1:108381417-108381439 TTCTCCCGCCTCTGCTGCCTGGG - Intronic
912294153 1:108455878-108455900 TTCTCCCGCCTCTGCTGCCTGGG - Intronic
912721091 1:112020759-112020781 GTCTCTCCCTTCTGCCGGGTGGG + Intergenic
915601207 1:156924265-156924287 CACTCGCGCCTCTGCTGGGTTGG - Intronic
917565463 1:176207689-176207711 GTCTCTCTCTTCTGAGGGGTAGG + Intergenic
921146263 1:212360778-212360800 GCCTCCCACCTCTGCCGGATAGG + Exonic
923126030 1:231035335-231035357 GTCTCCCACCTGTGCAGAGTGGG - Intronic
1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG + Intronic
1069118617 10:64539381-64539403 GTCTCCCTTCTCTGCAGGGTAGG - Intergenic
1070843248 10:79502697-79502719 GTTTGCCTCCTCTGTGGGGTGGG - Intergenic
1070930423 10:80256939-80256961 GTTTGCCTCCTCTGTGGGGTGGG + Intergenic
1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG + Exonic
1076541799 10:131219619-131219641 GTCTCCCGCCTCCCCAGGGAAGG + Intronic
1077432417 11:2522375-2522397 GTTTCCCGGCTCTGCAGAGTGGG + Intronic
1081528523 11:43942879-43942901 GCCTCCGGCGTCTGCGGGGCCGG - Exonic
1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG + Exonic
1091582274 12:1797117-1797139 GGCTGCGGCCTCGGCGGGGTGGG + Intronic
1092160447 12:6312678-6312700 GGCTCCCGCCTCTGCTTGGCAGG + Intronic
1101340919 12:103841286-103841308 CCCTCCCGCCGCTGCGGGGCGGG + Intergenic
1103778516 12:123384002-123384024 TTCTCCCGCCTCTTCGGCGGCGG - Exonic
1105534836 13:21256291-21256313 GTGTCCTGCCTCTGCAGGTTGGG - Intergenic
1106325342 13:28684127-28684149 GTCTCCCGCCCCTGCAGGCTTGG + Intergenic
1108359966 13:49659960-49659982 GCCTGCAGCCTCTGCAGGGTAGG + Intergenic
1109538086 13:63741474-63741496 GCCTCCCGCCTCTGCGATGGTGG + Intergenic
1109538211 13:63741870-63741892 GCCTCCCGCCTCTGCGATGGGGG + Intergenic
1122779356 14:104137156-104137178 GTCTGCCGGCAGTGCGGGGTGGG + Intergenic
1123033395 14:105461649-105461671 GTCTCCAGCCTCTGCTGCGCTGG - Intronic
1123117509 14:105901341-105901363 GTCTCCAGCCTCTGCAGGTCGGG - Intergenic
1125744326 15:41988363-41988385 GTCTCCCGGCACTGAGGGGAGGG - Intronic
1128636490 15:69305698-69305720 CTCTCCCTCCTCTGCTTGGTGGG - Intronic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG + Intronic
1132729612 16:1354990-1355012 CTCCCCCGCATCTGCGGGGTGGG + Intronic
1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG + Intronic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG + Intronic
1136556473 16:31010452-31010474 GTCTCCCGCCTCTGTGCCGGAGG + Exonic
1136687224 16:32002673-32002695 GGCACCCCCCTCTGGGGGGTCGG + Intergenic
1136787837 16:32946224-32946246 GGCACCCCCCTCTGGGGGGTCGG + Intergenic
1136881946 16:33907565-33907587 GGCACCCCCCTCTGGGGGGTCGG - Intergenic
1203090065 16_KI270728v1_random:1207881-1207903 GGCACCCCCCTCTGGGGGGTCGG + Intergenic
1147148202 17:38498342-38498364 GGCACCCCCCTCTGGGGGGTTGG + Intronic
1147911408 17:43858337-43858359 GCCTCCTGGCTCTGCGGGCTAGG + Intronic
1152016928 17:77756895-77756917 GTCTCTCGCCTCTGTGGGCTCGG - Intergenic
1155529951 18:26756839-26756861 GTCTGGCGCCTGTGCAGGGTGGG + Intergenic
1161396175 19:4045951-4045973 GTCACCCACCTCAGCAGGGTAGG + Exonic
1162562295 19:11423763-11423785 GTCTCCCCTCTCTGCCAGGTCGG - Intronic
1163700850 19:18785845-18785867 GTCTCCCACCTCTCAGGGGACGG - Exonic
1166313309 19:41975460-41975482 GTCTTCCTCCCCTGTGGGGTCGG - Intronic
1168289983 19:55352913-55352935 GACAGCGGCCTCTGCGGGGTGGG + Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
928114415 2:28536943-28536965 GTCCCCCGCCTCTCCAGGGACGG + Intronic
935246538 2:101223761-101223783 GTCTCCCTGCTCTGGGGAGTGGG + Intronic
935540067 2:104338288-104338310 GTCTGCAGCCTCAGCGGGGAAGG - Intergenic
936938297 2:117859031-117859053 GTCTCCCGACGCCGCTGGGTGGG + Intergenic
936945997 2:117931447-117931469 GTCTCCAGACACTGCCGGGTGGG - Intronic
937136721 2:119559822-119559844 GTCTCAGGCCTGTGTGGGGTGGG + Intronic
946247701 2:218396896-218396918 GTCTCCCGCCGCTGGAGTGTGGG - Intergenic
948473522 2:238202494-238202516 GTCTCCAGCCCCCGCTGGGTTGG + Intronic
948965056 2:241372753-241372775 CTCTCTTGCCTCTGCTGGGTGGG + Intronic
1174386095 20:50189451-50189473 CTTGCCCGCCTCTGCTGGGTAGG - Intergenic
1174579689 20:51562780-51562802 GGCTCCCGGCTCGGCGGAGTCGG + Intronic
1175606647 20:60316868-60316890 GTGTTCCGCCTCTGGGGCGTTGG + Intergenic
1176049584 20:63110817-63110839 GCCACCTGCCTCTGCAGGGTGGG + Intergenic
1176302723 21:5106232-5106254 GGCTCCCGCCTCTGCCTGGTGGG - Intergenic
1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG + Intergenic
1180228603 21:46413079-46413101 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228621 21:46413139-46413161 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228639 21:46413199-46413221 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228676 21:46413318-46413340 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1181960171 22:26617054-26617076 GTCTGCTTCCTCTGAGGGGTTGG + Intronic
950459183 3:13111102-13111124 CTCTCCAGCCTCTGCAGGGCAGG - Intergenic
964786358 3:160400244-160400266 GTCTCCCTCCTCTCAGCGGTCGG - Intronic
966923521 3:184629790-184629812 TTCTCCCGCCTGTCGGGGGTAGG + Intronic
969533180 4:7740665-7740687 GGCCCCGGCCTCTGCGGGGAAGG - Exonic
969569047 4:7997681-7997703 GTCTCCTGCTGCTGCTGGGTGGG + Intronic
978114505 4:105003258-105003280 GTCTCCTGCCTCAGTGTGGTAGG + Intergenic
985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG + Intronic
985802490 5:2013849-2013871 GTCTCCCGTCCCTGTGGAGTGGG - Intergenic
991939706 5:71838750-71838772 GTCTGCCACCTCTGAGGGGTAGG - Intergenic
1002569163 5:180130265-180130287 GCCTGCTTCCTCTGCGGGGTAGG + Intronic
1002928805 6:1619880-1619902 GACTCCCGCCGCTTCGGGGGAGG - Intergenic
1007374149 6:41444921-41444943 GTCTCCCGTCTCTGAGTGTTGGG + Intergenic
1019927526 7:4203112-4203134 GCCTCCTGCCTCTGCGGGAAGGG - Intronic
1026019724 7:66697703-66697725 TTCTCCGGCCTCAGCGAGGTGGG + Intronic
1026880659 7:73904879-73904901 TTCTCCGGCCTCAGCGAGGTTGG - Intergenic
1028442440 7:90879880-90879902 GTCTCCCTTCTCTGGGGAGTGGG - Intronic
1032932978 7:136695236-136695258 GGTTCCCGCATCTGCAGGGTTGG - Intergenic
1033724229 7:144095828-144095850 TCCTCCCACCTCTGCGTGGTGGG + Exonic
1033736973 7:144232101-144232123 TCCTCCCACCTCTGCGTGGTGGG - Exonic
1033742358 7:144284763-144284785 GTGTCCCTCCTCTGTGGGGGAGG + Intergenic
1033746084 7:144318845-144318867 TCCTCCCACCTCTGCGTGGTGGG + Exonic
1033751544 7:144364851-144364873 GTGTCCCTCCTCTGTGGGGGAGG - Exonic
1034622063 7:152464018-152464040 GTCTCCCTCCTCTCGGGGGGAGG - Intergenic
1034708708 7:153171246-153171268 GTCACCAGCCCCTGCGGGTTGGG + Intergenic
1035519437 8:265698-265720 GTCTCCAGCCTGCGCTGGGTGGG - Intergenic
1040471658 8:47738997-47739019 GACGCCCGGGTCTGCGGGGTCGG - Exonic
1048223851 8:132566422-132566444 GGCTTCCTGCTCTGCGGGGTTGG + Intergenic
1053175200 9:35917562-35917584 GTCTCCCTCCACTGCTGGGATGG - Intergenic
1055090875 9:72364421-72364443 GCGTGCCGCCTCTGCGGGGCCGG - Intronic
1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG + Intronic
1203772860 EBV:58219-58241 GTCTCCGGCCTCTGCGGCCCCGG - Intergenic
1186660687 X:11665181-11665203 GTCTCCCGCCTCAGCTAGGAAGG - Exonic
1189232186 X:39461159-39461181 CTCTCCCACCTCTGCAGGATAGG - Intergenic
1189335449 X:40168354-40168376 GTCTCTTGCCTCTGCCGGGAGGG + Intronic
1192197430 X:69037969-69037991 GTCCCCTGCCACTGCTGGGTGGG - Intergenic
1200151318 X:153952754-153952776 GTCTGCCGGCTCTGCGGTGGTGG - Exonic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic