ID: 1132729666

View in Genome Browser
Species Human (GRCh38)
Location 16:1355182-1355204
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 2, 1: 3, 2: 3, 3: 6, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132729660_1132729666 5 Left 1132729660 16:1355154-1355176 CCCGCGTCTGTGGGGTCGGGTGT 0: 3
1: 1
2: 1
3: 14
4: 114
Right 1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG 0: 2
1: 3
2: 3
3: 6
4: 104
1132729661_1132729666 4 Left 1132729661 16:1355155-1355177 CCGCGTCTGTGGGGTCGGGTGTG 0: 2
1: 2
2: 1
3: 20
4: 143
Right 1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG 0: 2
1: 3
2: 3
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903276826 1:22227328-22227350 GTCTACCGCCTGTGTGGGCTTGG - Intergenic
904303100 1:29568807-29568829 GTCTCCCTGGTCTGGTGGGTGGG + Intergenic
904528739 1:31154842-31154864 GTCTCCAGAGACAGTGGGGTGGG + Intergenic
911563169 1:99431049-99431071 CTCTCCAGGGTATGTGGGGTAGG + Intergenic
912474538 1:109927363-109927385 GTCTACCTTGTCAGTGGGGTGGG + Intronic
913109032 1:115641777-115641799 GTGTCCCGGGTGTGTGGGGTCGG + Intergenic
915131499 1:153698288-153698310 GTCTCCCCGGCCTGTGGGGAGGG - Intergenic
917565463 1:176207689-176207711 GTCTCTCTCTTCTGAGGGGTAGG + Intergenic
920872485 1:209805883-209805905 GGCTCCCCCGTGGGTGGGGTAGG - Intronic
924260166 1:242221812-242221834 GTCTGCTGTGTCTGTGGGGCCGG - Intronic
1066525514 10:36274878-36274900 GCCTCCCTTGGCTGTGGGGTGGG - Intergenic
1070843248 10:79502697-79502719 GTTTGCCTCCTCTGTGGGGTGGG - Intergenic
1070930423 10:80256939-80256961 GTTTGCCTCCTCTGTGGGGTGGG + Intergenic
1073441840 10:103556802-103556824 GCCTTGCCCGTCTGTGGGGTGGG + Intronic
1074843141 10:117374947-117374969 GTCTCCCGCGTCGGCGGGGCGGG + Exonic
1076871039 10:133195303-133195325 GGCTCCCGGGTCCGTGAGGTGGG + Intronic
1078593615 11:12667500-12667522 GTCTCACGGTTCTGTGGGCTGGG + Intergenic
1081528523 11:43942879-43942901 GCCTCCGGCGTCTGCGGGGCCGG - Exonic
1081655398 11:44853850-44853872 GCCTCCCGGTTCTGTGTGGTGGG + Intronic
1083618777 11:64038880-64038902 GTCTTCCTCATCTGTAGGGTGGG + Intronic
1086611261 11:88758390-88758412 GTCTTCCACGTCTATTGGGTTGG - Intronic
1096259590 12:50082309-50082331 CTCTCCAGCAGCTGTGGGGTGGG - Exonic
1096475563 12:51907160-51907182 GTCTCCCACGGCTGTGGGTCCGG + Intronic
1103350137 12:120278256-120278278 GGCTCCCCCGTCTGGGAGGTGGG - Intergenic
1112390370 13:98978052-98978074 GTCTGCAGAGCCTGTGGGGTGGG + Intronic
1121006511 14:90494130-90494152 GAGTCCCGTGTCTCTGGGGTAGG - Intergenic
1122117388 14:99534736-99534758 GTCTCACCTGTCTGTGGAGTGGG - Intronic
1123014596 14:105367738-105367760 GTCTCCCCCGCCTGAGGAGTAGG - Intronic
1123735614 15:23180104-23180126 GGCTCCCGGGGCTGTGGGCTTGG + Intergenic
1124286330 15:28403087-28403109 GGCTCCCGGGGCTGTGGGCTTGG + Intergenic
1124296373 15:28508549-28508571 GGCTCCCGGGGCTGTGGGCTTGG - Intergenic
1124416611 15:29477732-29477754 GTCTCCCCTGTGTATGGGGTGGG - Intronic
1132729567 16:1354857-1354879 GTCCCCCGCGTCTGTAGGGCTGG + Intronic
1132729576 16:1354889-1354911 CTCCCCCGCGTCTGTAGGGCCGG + Intronic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG + Intronic
1132729612 16:1354990-1355012 CTCCCCCGCATCTGCGGGGTGGG + Intronic
1132729622 16:1355022-1355044 GTCTCCCGCATGTGCGGGGTCGG + Intronic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG + Intronic
1132807019 16:1779551-1779573 GCCTGCCTTGTCTGTGGGGTGGG - Intronic
1136556473 16:31010452-31010474 GTCTCCCGCCTCTGTGCCGGAGG + Exonic
1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG + Intergenic
1142508050 17:378212-378234 GCCTCCCGGGTCTGTGGTGCCGG - Intronic
1148240417 17:45996488-45996510 GGCTCCCGGGTGGGTGGGGTTGG - Exonic
1152016928 17:77756895-77756917 GTCTCTCGCCTCTGTGGGCTCGG - Intergenic
1152754043 17:82079598-82079620 GCCTCCAGCACCTGTGGGGTCGG + Exonic
1154218093 18:12430084-12430106 GTCCCCCGTGTGTGTGGGTTCGG + Intronic
1154367628 18:13726136-13726158 GCCGCCGGGGTCTGTGGGGTCGG + Intronic
1158105729 18:53882992-53883014 GTCTCCCTTGGCTGGGGGGTGGG + Intergenic
1162066526 19:8129143-8129165 CTCATCCACGTCTGTGGGGTGGG + Exonic
1162098447 19:8324820-8324842 GTCTGCCCCGTCTGGGGAGTGGG + Exonic
1162651567 19:12092566-12092588 GACTCCGGGGTCTGTGGGGCTGG + Intronic
1162858543 19:13488334-13488356 CTCTCCAGCATCTGTGGGGGTGG + Intronic
1163525925 19:17821412-17821434 TTCTCACGCATCTCTGGGGTGGG + Exonic
1165938517 19:39403504-39403526 GTCCCCCAGGTCTGTGGGTTTGG + Intergenic
1166135973 19:40777497-40777519 GTCTCCGTGGTCTTTGGGGTGGG + Intronic
1166313309 19:41975460-41975482 GTCTTCCTCCCCTGTGGGGTCGG - Intronic
925293564 2:2763774-2763796 GTCTTAGGCGTCTGTGGGGCTGG - Intergenic
932853344 2:75209147-75209169 GTCTCCCAGGTCTTTGGGGAGGG - Intergenic
934050482 2:88206401-88206423 GTCTCCAGAGTTTGAGGGGTGGG - Intergenic
937031915 2:118747813-118747835 GTTTCCAGAGTCTGTGGGTTGGG - Intergenic
937136721 2:119559822-119559844 GTCTCAGGCCTGTGTGGGGTGGG + Intronic
937325302 2:120986566-120986588 GTGTTCCGCGTGTGTGGAGTCGG - Exonic
948523958 2:238559124-238559146 GTCTCCTGCATCTGTGGGTGGGG - Intergenic
1168878051 20:1184952-1184974 GGGTCCCGCGTCTGTGGGCAAGG - Intronic
1169065095 20:2690743-2690765 GTTTCCCGTGTGTGTGGGGTTGG + Intergenic
1173072164 20:39778883-39778905 GCCTCCCTCTTCTGTGAGGTGGG - Intergenic
1175361432 20:58414415-58414437 GGCTGCCCCGTCTGAGGGGTGGG - Intronic
1176159111 20:63639669-63639691 GTGTCCTGCACCTGTGGGGTCGG - Intergenic
1176310237 21:5145453-5145475 GTGTCCCGCGTCTGGGCTGTGGG - Intronic
1179846818 21:44116582-44116604 GTGTCCCGCGTCTGGGCTGTGGG + Intronic
1183743238 22:39679655-39679677 GGGTCCCGGGGCTGTGGGGTGGG - Intronic
1184050305 22:41999081-41999103 GCCTCGCGCGTTTGAGGGGTGGG + Intronic
1184599376 22:45533462-45533484 GGCCCCCGCGTCTGTGAGATGGG + Intronic
1184889620 22:47371832-47371854 GTCCCCCCCGACTGTGGGGAGGG - Intergenic
952241056 3:31532301-31532323 GTTTCGCGCGCCTGTGCGGTCGG - Intergenic
953136807 3:40188874-40188896 TTCCCACGTGTCTGTGGGGTGGG - Intronic
953513961 3:43572081-43572103 GTCTCCTCCTTCTGTTGGGTGGG - Intronic
954149362 3:48649705-48649727 CTCTCCCTTGTCTCTGGGGTTGG + Intronic
956681854 3:71788351-71788373 TTCTCCCGTGTGTGTGGGGGGGG - Intergenic
959905178 3:111703327-111703349 CTCTCCCTCTTCTGTGGGATGGG + Intronic
961509485 3:127392163-127392185 ATCTCCGGTGCCTGTGGGGTGGG - Intergenic
962381006 3:134898070-134898092 GATTCCGGAGTCTGTGGGGTGGG + Intronic
968451005 4:675996-676018 TTCTCCAGCTTCTGTGAGGTTGG + Intronic
969821045 4:9720501-9720523 GCCTTCCTCGTCTCTGGGGTGGG + Intergenic
978114505 4:105003258-105003280 GTCTCCTGCCTCAGTGTGGTAGG + Intergenic
985545622 5:507731-507753 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545630 5:507754-507776 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545638 5:507777-507799 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545646 5:507800-507822 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545660 5:507846-507868 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545680 5:507915-507937 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985545694 5:507961-507983 GATTCGGGCGTCTGTGGGGTGGG - Intronic
985802490 5:2013849-2013871 GTCTCCCGTCCCTGTGGAGTGGG - Intergenic
991939706 5:71838750-71838772 GTCTGCCACCTCTGAGGGGTAGG - Intergenic
1004457032 6:15800793-15800815 CTCACCTGAGTCTGTGGGGTAGG - Intergenic
1005121127 6:22390155-22390177 GCCTCCCTTGGCTGTGGGGTGGG + Intergenic
1006337267 6:33427361-33427383 GTCTCCCGTGTGTTTTGGGTGGG + Intronic
1007389955 6:41545423-41545445 GTTTCCGGCGTGTGTGGGGCGGG + Intergenic
1008909832 6:56720945-56720967 GGCTGCCCCGTCTGGGGGGTGGG - Intronic
1012599385 6:101075862-101075884 CTCTCCAGCATCTGTGGGTTTGG - Intergenic
1019499659 7:1358614-1358636 GTCTCCCGGGCCTGGGGGGACGG - Intergenic
1020401983 7:7789621-7789643 GTTTCCAGGGTCTGTGGGGAGGG - Intronic
1030788643 7:113695184-113695206 GTCTGCCCCATCTCTGGGGTTGG - Intergenic
1033742358 7:144284763-144284785 GTGTCCCTCCTCTGTGGGGGAGG + Intergenic
1033751544 7:144364851-144364873 GTGTCCCTCCTCTGTGGGGGAGG - Exonic
1035889027 8:3324215-3324237 CCCTCCCGGGTCTCTGGGGTTGG - Intronic
1040471658 8:47738997-47739019 GACGCCCGGGTCTGCGGGGTCGG - Exonic
1042039946 8:64580371-64580393 GACTCCCCCGTCTGTGGCGGCGG + Exonic
1198731845 X:139739405-139739427 GTCACACCCGTCTTTGGGGTTGG - Intronic
1200105321 X:153708865-153708887 TTCTCCAGCGTCTGTGTGCTGGG - Intronic
1202367937 Y:24179609-24179631 GACGCCAGCGTGTGTGGGGTGGG - Intergenic
1202502846 Y:25490508-25490530 GACGCCAGCGTGTGTGGGGTGGG + Intergenic