ID: 1132729675

View in Genome Browser
Species Human (GRCh38)
Location 16:1355214-1355236
Sequence CTCTCCTGCGTCTGTGGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132729668_1132729675 5 Left 1132729668 16:1355186-1355208 CCCGCGTCTGTGGGGTCGGGTGT 0: 3
1: 1
2: 1
3: 14
4: 114
Right 1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG 0: 1
1: 0
2: 3
3: 27
4: 246
1132729669_1132729675 4 Left 1132729669 16:1355187-1355209 CCGCGTCTGTGGGGTCGGGTGTG 0: 2
1: 2
2: 1
3: 20
4: 143
Right 1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG 0: 1
1: 0
2: 3
3: 27
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132729675 Original CRISPR CTCTCCTGCGTCTGTGGGGT CGG Intronic
900247394 1:1643322-1643344 CTGGGCTGTGTCTGTGGGGTCGG - Intronic
900258618 1:1710454-1710476 CTGGGCTGTGTCTGTGGGGTCGG - Intronic
900610262 1:3541739-3541761 CTCTGCTGCCACTGTGGGCTCGG - Intronic
900666887 1:3821563-3821585 CCCTCCTGAGTCGGTGGGTTAGG + Intronic
902013680 1:13289404-13289426 CTGTCCTGTGGATGTGGGGTTGG + Intergenic
902833489 1:19032877-19032899 CTCTCCTGCTTCTAGAGGGTGGG - Intergenic
902878464 1:19355051-19355073 CTCTCCTGTGTCAGAGGGGCTGG - Intronic
903082281 1:20820292-20820314 CTCTTCTGAGTTGGTGGGGTGGG + Intronic
903506270 1:23837946-23837968 CTCACCTAGGTCTGTGGGGGTGG - Intronic
903649351 1:24913574-24913596 CTCTGATGCGTCTGTGCAGTGGG + Intronic
904404098 1:30274945-30274967 CTCTTCTGAGTTGGTGGGGTGGG - Intergenic
905566945 1:38973293-38973315 CTCACCTAGGTCTGTGGGGGTGG - Intergenic
908480773 1:64536885-64536907 CTATTCTGTCTCTGTGGGGTTGG + Intronic
911563169 1:99431049-99431071 CTCTCCAGGGTATGTGGGGTAGG + Intergenic
912567825 1:110601104-110601126 CTCTACTTCTTCTGGGGGGTGGG + Intronic
912737310 1:112161236-112161258 ATCTCCTTCGCATGTGGGGTAGG - Intergenic
914504861 1:148280459-148280481 CTCTCCTCCGTCTGTCGCGCAGG - Intergenic
916025237 1:160827838-160827860 CTCTCCTGGGACCGTGGGGTTGG + Exonic
916697411 1:167253382-167253404 CTCTCCTGTGTGTTTGGGGGGGG - Intronic
917399188 1:174627833-174627855 TTCTCCTGCCTCTGTCAGGTTGG - Intronic
919763827 1:201114177-201114199 CTCTGCTGAGTCTGTAGGTTCGG + Exonic
920851385 1:209630450-209630472 CTCTCCTGGCTCTGTGAGGATGG - Intronic
921116229 1:212093840-212093862 CTCACCTAGGTCTGTGGGGATGG + Intronic
923049905 1:230383677-230383699 CTCTCGAGAGACTGTGGGGTTGG - Intronic
924260166 1:242221812-242221834 GTCTGCTGTGTCTGTGGGGCCGG - Intronic
924515299 1:244760673-244760695 CGCTGCTGCTTCTGTGGCGTGGG - Intergenic
1064869315 10:19920283-19920305 CTCACCTAGGTCTGTGGGGGTGG - Intronic
1065815659 10:29480424-29480446 CTCTGCTGCGTCCGTGCAGTGGG - Intronic
1069977239 10:72224024-72224046 CTCTCCAGCTCCTTTGGGGTAGG - Exonic
1070284225 10:75071729-75071751 CTCACCTGGGTCTGTGGAGGTGG - Intergenic
1073147274 10:101289073-101289095 CTTTCCTCCGTCTGTAGGATAGG - Intergenic
1073280789 10:102352603-102352625 CTCTGATGCGGCTGTGGGGTTGG - Intronic
1074202873 10:111255444-111255466 CTGTCCTGGGTATCTGGGGTTGG - Intergenic
1076058507 10:127394922-127394944 CACTCCTGCACCTGTGGGATAGG - Intronic
1076717659 10:132374580-132374602 AGCTTCTGTGTCTGTGGGGTGGG + Intronic
1076780548 10:132721839-132721861 CTTGCCTGCGTCTGTGGTGCTGG + Intronic
1076839422 10:133038739-133038761 CTCTCCTGGGTCTGAGCAGTGGG + Intergenic
1077481187 11:2815436-2815458 CTCTCCTGGCCCTGTGGGGTCGG + Intronic
1079350038 11:19684681-19684703 CACTCTGGTGTCTGTGGGGTTGG - Intronic
1081487539 11:43543432-43543454 CACTCCTGTGTTTGTGGGGGTGG - Intergenic
1083189258 11:61037513-61037535 CTTTCCTGAGTCTGTGGTCTAGG + Intergenic
1083306473 11:61764575-61764597 CCCTCCTGCCTCAGTGGGGCTGG + Intronic
1083996410 11:66275216-66275238 CTGTCCTTTGTGTGTGGGGTAGG + Intronic
1084188167 11:67486295-67486317 CTCACCTAGGTCTGTGGGGGTGG + Intronic
1084269338 11:68020803-68020825 CGCTGCTGCGTCTGTGGGGATGG - Intronic
1084768575 11:71327905-71327927 CCCTCCTCCCTCTGTGGTGTTGG + Intergenic
1085530132 11:77187589-77187611 CTCTCCTGGCCCTGTGGGGAAGG - Intronic
1087788843 11:102385560-102385582 CTCACCTAGGTCCGTGGGGTTGG + Intergenic
1089182562 11:116593168-116593190 CTCTCCTGGGCCTGGGGGATAGG + Intergenic
1089204479 11:116748459-116748481 CTTTCCTGAGGCTGTGGGGGTGG - Exonic
1089736334 11:120552515-120552537 CTTTACTGCGTCTGTAGGGAGGG + Intronic
1090499527 11:127247867-127247889 CTGTCCTGAGTATGTGGGGTCGG - Intergenic
1091661335 12:2385894-2385916 CTCTCCTGAGTCGCTGGGGCTGG - Intronic
1093886324 12:24465823-24465845 CTCTGGAGCCTCTGTGGGGTTGG - Intergenic
1096259590 12:50082309-50082331 CTCTCCAGCAGCTGTGGGGTGGG - Exonic
1096503939 12:52081284-52081306 CTCCCCTGCTTATCTGGGGTAGG + Intergenic
1104180389 12:126374115-126374137 CTCTCCTTGTTCTGTGGGGAGGG - Intergenic
1105417813 13:20228198-20228220 CTCTCCTGCTTCTGGAGGGCTGG + Intronic
1105429704 13:20325815-20325837 CTCACCTAGGTCTGTGGGGGTGG - Intergenic
1105702440 13:22943611-22943633 TTCTCCTGCGTCTTTTGGGCTGG + Intergenic
1106473366 13:30077268-30077290 CTCTCATGGGTCTGTGGGGAAGG + Intergenic
1107467915 13:40666224-40666246 CTCTCCTGCGGCTGGGGGAGGGG - Exonic
1109132837 13:58610709-58610731 CTCACCTAGGTCTGTGGGGGTGG - Intergenic
1109735860 13:66483748-66483770 CTCACCTAGGTCCGTGGGGTTGG - Intronic
1111292706 13:86188471-86188493 CTCACCTAGGTCTGTGGGGGTGG - Intergenic
1113444500 13:110355341-110355363 CTCACCTGTGTGTGTGGGGGAGG + Intronic
1113444515 13:110355404-110355426 CTCACCTGTGTGTGTGGGGGAGG + Intronic
1113444522 13:110355437-110355459 CTCACCTGTGTGTGTGGGGGAGG + Intronic
1113444529 13:110355470-110355492 CTCACCTGTGTGTGTGGGGGAGG + Intronic
1113444536 13:110355503-110355525 CTCACCTGTGTGTGTGGGGGAGG + Intronic
1113444543 13:110355536-110355558 CTCACCTGTGTGTGTGGGGGAGG + Intronic
1113444559 13:110355599-110355621 CTCACCTGTGTGTGTGGGGGAGG + Intronic
1113444566 13:110355632-110355654 CTCACCTGTGTGTGTGGGGGAGG + Intronic
1113444587 13:110355730-110355752 CTCACCTGTGTGTGTGGGGGAGG + Intronic
1113559836 13:111269799-111269821 CACTGCTGTGTCTTTGGGGTGGG - Intronic
1113904018 13:113811165-113811187 TGGTCCTGGGTCTGTGGGGTGGG + Intronic
1113904042 13:113811233-113811255 AGGTCCTGGGTCTGTGGGGTGGG + Intronic
1113904079 13:113811330-113811352 TGGTCCTGGGTCTGTGGGGTGGG + Intronic
1116849339 14:49893025-49893047 CTCTGCTGCGCCTGCGTGGTCGG + Intergenic
1118590201 14:67395346-67395368 CTCTCCTGCCTGTGTTGGGTGGG - Intronic
1121109389 14:91302408-91302430 CTCTCCAGAGTCTGAGGGGCAGG - Intronic
1121718614 14:96093990-96094012 CTGTCCTGCCTCGGTGGGGCAGG - Exonic
1123413992 15:20081876-20081898 CTCTCCTTTGTCTGTGAGGCTGG - Intergenic
1123523334 15:21088987-21089009 CTCTCCTTTGTCTGTGAGGCTGG - Intergenic
1125325774 15:38534685-38534707 CTCTTCTGTGTCTGTGGCCTTGG - Intronic
1128133884 15:65248795-65248817 CTGGCCTGGGTCTGTGGGGGAGG - Intronic
1128269070 15:66293350-66293372 CTTCCCTCCGTCTCTGGGGTAGG + Intronic
1128523420 15:68390552-68390574 ATCTCCTGGGGCTGTGGGGGAGG - Intronic
1131005394 15:88973302-88973324 TTCTCCTGCCTCAGTGGGGGAGG + Intergenic
1132519086 16:379177-379199 CGCTCCTGAGTGTGTGGGGAGGG - Intronic
1132566492 16:625833-625855 CCCTGCTGCGGCTGAGGGGTGGG + Intronic
1132729576 16:1354889-1354911 CTCCCCCGCGTCTGTAGGGCCGG + Intronic
1132729588 16:1354921-1354943 GTCTCCCACGTCTGTGGGGTGGG + Intronic
1132729600 16:1354958-1354980 GTCCCCCGCGTCTGTGGGGTGGG + Intronic
1132729612 16:1354990-1355012 CTCCCCCGCATCTGCGGGGTGGG + Intronic
1132729631 16:1355054-1355076 GTCTGCCGCGTCTGCGGGGTCGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729675 16:1355214-1355236 CTCTCCTGCGTCTGTGGGGTCGG + Intronic
1132954179 16:2582456-2582478 CGCTCCTGCGCTTGTGGAGTGGG + Intronic
1132960166 16:2617707-2617729 CGCTCCTGCGCTTGTGGAGTGGG - Intergenic
1133441343 16:5823543-5823565 CTCACCTCCTTCTGTGTGGTTGG - Intergenic
1133748872 16:8708847-8708869 TTCTCATGAGTCTGTGGAGTAGG - Intronic
1134072375 16:11268811-11268833 CTCTCCATCATCTGTGGGCTCGG + Intronic
1134452276 16:14370889-14370911 CCCTCCTGGGTCTGCGGGTTAGG - Intergenic
1138314806 16:56060822-56060844 CTCTCCTGGGCCTGGGGGATGGG - Intergenic
1139327066 16:66160907-66160929 CTCTCCTGGGCCAGTGTGGTGGG + Intergenic
1139448466 16:67013263-67013285 CTCACATGGGTCTGTGGGGAGGG + Intergenic
1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG + Intergenic
1139559774 16:67734689-67734711 CTCTCCTGCTTCTCTGTCGTCGG - Intronic
1140775756 16:78247661-78247683 CACTCCTGCGTCTCTGGCCTTGG + Intronic
1143162283 17:4879520-4879542 TGCTCCTGCGTCTCTGGGCTTGG + Intronic
1143345043 17:6243133-6243155 CTCTCCTTTTCCTGTGGGGTGGG - Intergenic
1143377458 17:6475214-6475236 CTCTGCTTCATCTGTGGGCTGGG - Intronic
1143439427 17:6957575-6957597 TTCACCTGTGTGTGTGGGGTAGG - Intronic
1144011269 17:11150483-11150505 CTCTCCAGCGTCTGCGGGAATGG + Intergenic
1144777253 17:17791158-17791180 CTCTCCTGCATTTGTGGGCCAGG + Intronic
1145056867 17:19708545-19708567 CTCACCTGCCTCTGTGCGGGAGG + Intronic
1146535530 17:33647436-33647458 CTCTCCTGCGTCTTGGGGTGTGG - Intronic
1149566382 17:57643453-57643475 CTCTGCTGGGTCAGTGGGGTGGG + Intronic
1150621657 17:66812312-66812334 CCCTGCTGCCTCTGTGGGGCCGG - Intergenic
1151730479 17:75908287-75908309 CTCTCCAGTGTCTGTGGCCTGGG + Intronic
1151945713 17:77318837-77318859 CTCACCTGGCTCTGTGGGGCAGG + Intronic
1152112861 17:78366643-78366665 CTCTCCTGGGGCTCTGGGGCAGG + Intergenic
1152333333 17:79686014-79686036 TTCTCCTGCCTCGGTGAGGTGGG - Intergenic
1152925711 17:83086903-83086925 CTCTCCTGCCTCTGGGGGTGGGG + Intronic
1155903486 18:31420108-31420130 CTTTCCTGTATCTGTGGTGTTGG + Intergenic
1156336059 18:36172544-36172566 CTCTCCTGCCTCTCTGGGCTGGG + Intronic
1156398889 18:36723141-36723163 CTCTCCTGGGTCTCTGGATTAGG + Intronic
1157544603 18:48539147-48539169 CTCTGCTGGGTCTGTGCGCTGGG + Exonic
1158511929 18:58098222-58098244 CTCTCCTGTGTTTGTTGGGAGGG + Intronic
1160801910 19:974215-974237 CTTTCCTGTGTCTTTGGGGAGGG + Exonic
1160957636 19:1700707-1700729 CTCTCCTCTTGCTGTGGGGTGGG + Intergenic
1162060211 19:8090241-8090263 CTGCCGTGTGTCTGTGGGGTGGG + Exonic
1162066526 19:8129143-8129165 CTCATCCACGTCTGTGGGGTGGG + Exonic
1162639830 19:11999699-11999721 CTCACCTAGGTCTGTGGGGGTGG - Intergenic
1162858543 19:13488334-13488356 CTCTCCAGCATCTGTGGGGGTGG + Intronic
1164867879 19:31619879-31619901 CACTCGTGCGTCTGTGATGTAGG - Intergenic
1165138792 19:33687117-33687139 CTCTCCTGAGGCTTTGGGGCTGG + Intronic
1166422996 19:42652943-42652965 CTCTCCGGTGTGTATGGGGTGGG + Intronic
926034974 2:9629631-9629653 CTCTCCTGTTTATGGGGGGTGGG + Intronic
927110277 2:19859484-19859506 CTCCCCTGCGTCTGCAGTGTGGG - Intergenic
927518855 2:23687444-23687466 CTGTCCTGTGGCTGTGGGGCAGG - Intronic
927692278 2:25216381-25216403 TTCTCCTGAGTCTGCGGGGCGGG + Intergenic
927808831 2:26170934-26170956 CTCTCCTGAGTCTGTAGGGGTGG - Intergenic
928093574 2:28391040-28391062 CTCTCCTGGGCCTGCGGAGTTGG + Intergenic
928166511 2:28976487-28976509 CTTTCCTGTGGCTGTGGGGCAGG + Intronic
930397999 2:50847523-50847545 CTCACCTGGGTCCGTGGGGGTGG - Intronic
934715671 2:96541969-96541991 CTCTCCTGGCTCTGTGGAGGAGG - Intronic
939990834 2:148875798-148875820 CTCCGCTGCGTCTGGGGCGTCGG - Intronic
942083365 2:172422526-172422548 ATCTCCTGTGTTGGTGGGGTGGG - Intergenic
947991237 2:234489225-234489247 CTGTCCATCCTCTGTGGGGTAGG + Intergenic
948384751 2:237574599-237574621 CCCACCTGCTTCTGGGGGGTTGG - Exonic
948523958 2:238559124-238559146 GTCTCCTGCATCTGTGGGTGGGG - Intergenic
948905630 2:240978301-240978323 CCCTCCTCAGTCTCTGGGGTAGG + Intronic
948906026 2:240979921-240979943 CCCTGCTCCGTCTCTGGGGTAGG + Intronic
948965056 2:241372753-241372775 CTCTCTTGCCTCTGCTGGGTGGG + Intronic
1172300715 20:33848126-33848148 CTCACCTGAGTCTGTGAGCTGGG + Intronic
1172689719 20:36782125-36782147 CTCTCCTGGGGTTGAGGGGTGGG - Exonic
1172693336 20:36805188-36805210 CTCTGCAGCGTCTGTGCCGTGGG + Intronic
1174814893 20:53678176-53678198 TTCTCCTGTGTGTGCGGGGTGGG + Intergenic
1175751273 20:61499647-61499669 CTGGCCTGCGTTTGTGGGCTGGG - Intronic
1175936405 20:62516103-62516125 CTCACCTGCCTCTGTGGAGGGGG - Intergenic
1176159111 20:63639669-63639691 GTGTCCTGCACCTGTGGGGTCGG - Intergenic
1180832865 22:18914929-18914951 CCCTCCTGCGTCTGTGATCTGGG - Intronic
1180839673 22:18953459-18953481 CTCACCTAGGTCCGTGGGGTTGG + Intergenic
1181060085 22:20278239-20278261 CTCTCCTGCGTGGTTGTGGTTGG + Intronic
1181062231 22:20287020-20287042 CTCACCTAGGTCCGTGGGGTTGG - Intergenic
1181066957 22:20311323-20311345 CCCTCCTGCGTCTGTGATCTGGG + Intergenic
1182193193 22:28485604-28485626 CCTTGCTGGGTCTGTGGGGTGGG + Intronic
1182546127 22:31077691-31077713 CTCTCCTTTGTCTGTGAGGCTGG + Intronic
1184195229 22:42923061-42923083 CTCACATGCTTCTGTGGGGCAGG + Intronic
1184885259 22:47341113-47341135 CTCTGCTGCAGCTGTGGGGAGGG + Intergenic
1203282950 22_KI270734v1_random:140233-140255 CCCTCCTGCGTCTGTGATCTGGG - Intergenic
950101337 3:10358716-10358738 CTCACCTGCATCTGCGTGGTGGG - Exonic
950541630 3:13616636-13616658 CTCTGCTGCCTGGGTGGGGTGGG + Intronic
950638245 3:14331086-14331108 CCCTCCTGTGTGTGTGGAGTGGG - Intergenic
951136352 3:19107886-19107908 TTCTTCTGAGTCAGTGGGGTGGG - Intergenic
952324162 3:32306084-32306106 TTTTCGTGAGTCTGTGGGGTTGG + Intronic
953513961 3:43572081-43572103 GTCTCCTCCTTCTGTTGGGTGGG - Intronic
954149362 3:48649705-48649727 CTCTCCCTTGTCTCTGGGGTTGG + Intronic
954662792 3:52234964-52234986 CTCTGCTGCCTCTGTGGGTGGGG - Intronic
955040162 3:55308688-55308710 CTCTCCACCGCCAGTGGGGTAGG - Intergenic
957659475 3:83128856-83128878 CTCTCCTGCCTCTGAGTGGGTGG - Intergenic
959905178 3:111703327-111703349 CTCTCCCTCTTCTGTGGGATGGG + Intronic
959924802 3:111909130-111909152 CTCTACTGGGACAGTGGGGTGGG - Intronic
961509485 3:127392163-127392185 ATCTCCGGTGCCTGTGGGGTGGG - Intergenic
963225364 3:142856603-142856625 CCTTCCTGCTTCTGTGGGTTCGG - Intronic
967088581 3:186115774-186115796 CTCTGCTGGGCCTGTGGAGTGGG + Intronic
967568154 3:190995323-190995345 CTCCCCAGCTTCTGTGGGGGTGG + Intergenic
967875461 3:194265572-194265594 TTCTCTTGCGTCTGAGGGTTTGG - Intergenic
968451005 4:675996-676018 TTCTCCAGCTTCTGTGAGGTTGG + Intronic
968660501 4:1796843-1796865 AGCTCCTGGGCCTGTGGGGTGGG + Intronic
968670988 4:1851464-1851486 CTCTCCTGGTTCTGTGGGGAAGG + Intronic
969271816 4:6108217-6108239 CTCTGCTGCTTCTGTGGCATAGG - Intronic
970152253 4:13102120-13102142 CTCTCCTGGGGCTCTGGGGTAGG - Intergenic
972031473 4:34464717-34464739 CTCTACTGCTTATGTGTGGTAGG - Intergenic
978114505 4:105003258-105003280 GTCTCCTGCCTCAGTGTGGTAGG + Intergenic
979844848 4:125494923-125494945 CTCTTCTGCATCTGTGTTGTGGG + Intergenic
985120005 4:186630974-186630996 CTGTCCTGCGTGTGTGGCTTAGG - Intronic
985134651 4:186774217-186774239 CTATTCTGCTTCTGTGGAGTAGG + Intergenic
985551639 5:536187-536209 CTCTCATGCGTCTGTTGTTTCGG + Intergenic
986958876 5:13189707-13189729 CTTCCCTGCGTCTGTGGCATTGG + Intergenic
989094309 5:37767243-37767265 CTGTCCTGAGGATGTGGGGTGGG - Intergenic
989322558 5:40153724-40153746 CTATCCTCCATCTGTTGGGTGGG - Intergenic
997395798 5:133558832-133558854 CTCTCCTGTGGCTGTGGTGAGGG - Intronic
997608194 5:135191681-135191703 CTCTCCTGCGACAGTGCGGTGGG + Intronic
998038827 5:138937952-138937974 CTCTCTTGCTTCCGTGGGGAGGG - Intergenic
998052084 5:139044283-139044305 CCCTCTTGGGTATGTGGGGTGGG - Intronic
999758436 5:154682577-154682599 CACCCCTGCCTCTGTGGGATGGG - Intergenic
1000184518 5:158846236-158846258 CCCTCCAGTGTGTGTGGGGTGGG - Intronic
1001135389 5:169098414-169098436 CTCTCCTTAGGCTGTGGGCTTGG - Intronic
1003131109 6:3396195-3396217 CTCACCTAGGTCTGTGGGGATGG - Intronic
1003292125 6:4788667-4788689 CTCTCCTGGGTCACTGGGGTGGG + Intronic
1003973595 6:11322435-11322457 CTCTCCTGCCTCTGTGTGTTTGG - Intronic
1004027367 6:11831994-11832016 CTCACCTAGGTCTGTGGGGGTGG + Intergenic
1004457032 6:15800793-15800815 CTCACCTGAGTCTGTGGGGTAGG - Intergenic
1004953681 6:20702813-20702835 CTCACCTAGGTCTGTGGGGGTGG + Intronic
1007644966 6:43372684-43372706 CTCTCCTGCCACTCTGGGGCGGG - Intergenic
1009858635 6:69295593-69295615 CTCTCCTTCCTCTATTGGGTGGG - Intronic
1011626098 6:89285134-89285156 CTGCCCTGCCTCTGTGAGGTTGG + Intronic
1011788874 6:90876514-90876536 CTCTCTTGTGTCTGTGCTGTAGG - Intergenic
1012599385 6:101075862-101075884 CTCTCCAGCATCTGTGGGTTTGG - Intergenic
1017488505 6:154923894-154923916 CTATCCTGAGTCTGAGAGGTTGG - Intronic
1017598230 6:156053216-156053238 CTCCCCTAAGTCTCTGGGGTTGG - Intergenic
1019428167 7:987037-987059 CTGGGCTGGGTCTGTGGGGTGGG + Intronic
1020002249 7:4762537-4762559 TTCTCCTCCGTCTGTGGGTGCGG - Exonic
1020009362 7:4799929-4799951 CTGTCCTGGGCCTGTGGGGACGG - Intronic
1021639319 7:22722716-22722738 CTCTTCTCCATCTGTGGGGTAGG - Intergenic
1023539445 7:41249978-41250000 CTCTCCTTCCTCTGGAGGGTAGG - Intergenic
1024268191 7:47622439-47622461 CTCACCTAGGTCTGTGGGGGTGG + Intergenic
1024845129 7:53633787-53633809 CTCACCTAGGTCTGTGGGGGTGG + Intergenic
1026913414 7:74105984-74106006 CGGTCCTGAGTCTGTGGGGCAGG + Intronic
1027687492 7:81295355-81295377 CCCTACTGAGTCAGTGGGGTAGG - Intergenic
1029861951 7:103581926-103581948 CTCTCATGGTTTTGTGGGGTTGG - Intronic
1032262541 7:130348538-130348560 CTCTCCTACTTCTGCGGGGATGG + Intronic
1034489908 7:151387596-151387618 CTCTCCTGCTTCTGCTTGGTTGG - Intronic
1035012347 7:155730485-155730507 CTTTCCTGCCCCTGTGAGGTAGG + Intronic
1035121412 7:156571048-156571070 CTCTCCTGCGGATGTGAGCTCGG - Intergenic
1035246607 7:157566493-157566515 CTCTCCTGAGACTGTGGCCTGGG + Intronic
1035359810 7:158303921-158303943 CTCTCCTGGGGCTGTGGCCTGGG - Intronic
1035888916 8:3323717-3323739 CCCTCCTGGGTCTCTGGGGTTGG - Intronic
1035888933 8:3323786-3323808 CCCTCCTGGGTCTCTGGGGTTGG - Intronic
1035888995 8:3324072-3324094 CCCACCTGGGTCTCTGGGGTTGG - Intronic
1035889027 8:3324215-3324237 CCCTCCCGGGTCTCTGGGGTTGG - Intronic
1035889132 8:3324643-3324665 CTCTACTGGGTCTCTGGGGTGGG - Intronic
1037163401 8:15798635-15798657 CTCTCCTGGGTGTGTGGGGGGGG + Intergenic
1038336799 8:26652159-26652181 CTCTTTTGTCTCTGTGGGGTTGG + Intronic
1039066965 8:33617422-33617444 CATGCCTGGGTCTGTGGGGTTGG + Intergenic
1039848374 8:41342278-41342300 CTCCCCTCCCTCTGAGGGGTAGG + Intergenic
1040389239 8:46935442-46935464 CTCCACTGTGTCTGTGTGGTGGG - Intergenic
1046056706 8:109086902-109086924 CTCTCTTGAATCTGTGGGGCAGG + Intronic
1046125486 8:109901300-109901322 CTCCTCTGCGTCTGTGAAGTTGG - Intergenic
1047802064 8:128320017-128320039 TTCTCTTGCGTCAGTGGGTTGGG - Intergenic
1048389503 8:133948147-133948169 CTCTTCTGTGTGTATGGGGTGGG + Intergenic
1048879629 8:138861598-138861620 CTCTCTTGCTGCTTTGGGGTTGG + Intronic
1049316911 8:141974270-141974292 CCATCATGCTTCTGTGGGGTAGG - Intergenic
1050342540 9:4654891-4654913 CTCACCTAGGTCTGTGGGGATGG + Intronic
1052778470 9:32756145-32756167 CTCACCTAGGTCTGTGGGGATGG + Intergenic
1055243827 9:74217375-74217397 CTCACCTAGGTCTGTGGGGGTGG - Intergenic
1057129284 9:92641992-92642014 CTCTCCTGGGGGTGTGAGGTGGG + Intronic
1058276916 9:103054752-103054774 CTCTCCTGACTCTGTGTGGATGG - Intergenic
1058311996 9:103515145-103515167 CTCACCTAGGTCTGTGGGGATGG + Intergenic
1061396907 9:130348442-130348464 CTCCCCTTCGTCACTGGGGTTGG - Intronic
1062449741 9:136610457-136610479 CCCTCCAGCGCCCGTGGGGTGGG - Intergenic
1062559510 9:137134559-137134581 CTCACCTGAGCCTGGGGGGTTGG + Intergenic
1186479856 X:9888295-9888317 CTCTCCTGTGTCTGGTGCGTGGG + Intronic
1190285909 X:48961346-48961368 ATCTCCTGGCTCTGTGGGTTTGG - Intergenic
1190444948 X:50514978-50515000 CTCTTCTGAGTTGGTGGGGTGGG - Intergenic
1191782849 X:64886906-64886928 ATCTCCTGCAGCTGAGGGGTGGG - Intergenic
1194463923 X:94208274-94208296 CTCTCCTCGGTCCGTGGGGGTGG - Intergenic
1195478980 X:105321062-105321084 CTCTCCTGTGGCTATGGGTTTGG + Intronic
1197564072 X:128059770-128059792 TGCTCTTGCTTCTGTGGGGTGGG - Intergenic
1199525360 X:148785539-148785561 CTCTTCTGTGTCTGTGGGTCAGG + Intronic
1200105321 X:153708865-153708887 TTCTCCAGCGTCTGTGTGCTGGG - Intronic