ID: 1132730956

View in Genome Browser
Species Human (GRCh38)
Location 16:1361849-1361871
Sequence CTGGGGACACAGATGGCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132730956 Original CRISPR CTGGGGACACAGATGGCATG AGG (reversed) Intronic
900141583 1:1141260-1141282 ATGGGGACAGGGATGGGATGGGG - Intergenic
901059387 1:6465158-6465180 TTGGGGACACACAAGGCAGGTGG + Exonic
901879050 1:12183197-12183219 CTGTGGACCCAGATGGGAGGCGG + Intronic
902616049 1:17624155-17624177 CTGAGGTCACAGGTGGGATGGGG - Intronic
902876664 1:19344594-19344616 CCGGGAGCACAGATGGCAGGTGG - Intronic
903891494 1:26573201-26573223 CTGGGGACACAGTGGGCAAGGGG - Intronic
905389938 1:37629807-37629829 CTGGGGACAGAGAGGGTGTGGGG + Exonic
905774824 1:40661833-40661855 CTGGGGAGCCAGAGGGCAAGAGG - Intronic
905891619 1:41521820-41521842 CAGGGGACAGAGATGGCCTCAGG - Intronic
905925495 1:41746641-41746663 GTGGGGAGACACATGGCATGGGG + Intronic
906046548 1:42835306-42835328 CTGGGGACACACATTGCAAAGGG + Intronic
907422229 1:54355220-54355242 CTGGGCACACAGCAGACATGAGG + Intronic
914747083 1:150508893-150508915 CTGGGAAGAATGATGGCATGGGG - Intronic
914750829 1:150533991-150534013 CTGTGGACAAGGATGGCGTGGGG + Intergenic
915940265 1:160114396-160114418 CTGGGCACAGAGATGGAGTGAGG - Intergenic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916849575 1:168689820-168689842 CTGGAGAAACAGAAGGCATTAGG - Intergenic
916869644 1:168899341-168899363 CACGGGGCAAAGATGGCATGTGG - Intergenic
918706393 1:187668294-187668316 CTAGGGACACAAATGGAATCAGG + Intergenic
919020496 1:192098799-192098821 CTGGGGACAGAGAAGGCAAATGG + Intergenic
922605403 1:226887056-226887078 CAGAGGATACAGATTGCATGGGG + Intronic
922806292 1:228391657-228391679 TTGGGCACACAGGGGGCATGTGG + Intergenic
923257952 1:232237839-232237861 CTTGGGCCAAAGGTGGCATGCGG - Intergenic
923787682 1:237083947-237083969 CTGTGGACACACGTGGCATATGG + Intronic
923979959 1:239310495-239310517 TTGGGGCCACCCATGGCATGGGG - Intergenic
924049248 1:240063782-240063804 CTGGGGAGGCTGATGACATGGGG - Intronic
1063610467 10:7557627-7557649 CTGGGGACCCATCTGGCATGGGG + Intergenic
1066381422 10:34905298-34905320 CTGGGGACCCACATGGTATCTGG + Intergenic
1067271114 10:44792011-44792033 CTGGGGACATAGGAGGCCTGAGG - Intergenic
1067371490 10:45687741-45687763 CTGGGGGAACAGGTGGCATTTGG + Intergenic
1067388293 10:45838409-45838431 CTGGGGGAACAGGTGGCATTTGG - Intronic
1067414389 10:46092429-46092451 CTGGGTACCCAGATGGCATGAGG + Intergenic
1067417832 10:46118874-46118896 CTGGGGGAACAGGTGGCATTTGG + Intergenic
1067445973 10:46346165-46346187 CTGGGGGAACAGGTGGCATTTGG + Intergenic
1067473793 10:46553542-46553564 CTGAGGAGACAGGTGGAATGAGG + Intronic
1067503188 10:46825436-46825458 CTGGGGGAACAGGTGGCATTTGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067591409 10:47514580-47514602 CTGGGGGAACAGGTGGCATTTGG - Intronic
1067638527 10:48022675-48022697 CTGGGGGAACAGGTGGCATTTGG - Intergenic
1067787691 10:49262617-49262639 CTGGCCACACAGATGGGGTGAGG + Intergenic
1067874962 10:49997657-49997679 CTGGGGGAACAGGTGGCATTTGG + Intronic
1069578193 10:69545340-69545362 CTGAGAACAGAGATGGCCTGGGG - Intergenic
1070135126 10:73687092-73687114 CTGGGGGAACAGGTGGCATTTGG - Intronic
1070161400 10:73868753-73868775 CAGGGGACACAAATGTCATGGGG + Intronic
1070201467 10:74209800-74209822 GTAGGGACACAGTGGGCATGAGG + Intronic
1070320755 10:75352992-75353014 CTCGGGACACAGCTCCCATGGGG - Intergenic
1071030426 10:81173744-81173766 CTGAGGACACACATGGGTTGTGG + Intergenic
1071249043 10:83797130-83797152 CTGGAGACTCAGAGGGCATGAGG - Intergenic
1071936314 10:90534767-90534789 CTGGGGACTCATATGGCAGTTGG - Intergenic
1073287533 10:102397717-102397739 CTGGTGGCAGAGGTGGCATGAGG + Intronic
1073319192 10:102603986-102604008 CTGGGGAAACAGCTGGGCTGTGG + Intronic
1074104997 10:110382740-110382762 CAGGGGACAGAGGTGGCATCAGG + Intergenic
1075265868 10:120999247-120999269 CTGGGGGCTCAGCTGGCCTGTGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1077864371 11:6210755-6210777 CTGGTGAAAGAGATGGAATGAGG + Intronic
1078455387 11:11470830-11470852 CTGGGGCCACAGATGGTCAGAGG - Intronic
1078756770 11:14218479-14218501 CTGGGGACACAGAAATCATTAGG - Intronic
1080202879 11:29693850-29693872 TTGGGGAAACAGGTGGCATTTGG + Intergenic
1081527150 11:43934994-43935016 CTGGGGAAGCAGATGGGGTGGGG - Intronic
1081731366 11:45374006-45374028 CAGGGCACACAGTTGGCAAGAGG - Intergenic
1083190898 11:61051596-61051618 CTGGCTACACAACTGGCATGTGG + Intergenic
1083433814 11:62629364-62629386 CTGGGGACCCAGAGCGGATGTGG - Intronic
1083686428 11:64378839-64378861 CTGGGGACACAGTCTGCATGGGG + Intergenic
1084013517 11:66365712-66365734 CTGGGGACACAGAGGTCAGCTGG + Intronic
1084496657 11:69509120-69509142 TTGGGGACACTGATGGTTTGGGG + Intergenic
1084560918 11:69905030-69905052 CTGGGGACACTGTGGGGATGGGG - Intergenic
1084785974 11:71441831-71441853 CTGGGGGCAGAGTTGGGATGCGG + Intronic
1088716068 11:112551034-112551056 CTGGTGGGACAGATAGCATGTGG + Intergenic
1089881036 11:121773956-121773978 CAGGGGTCACACATGGCATAAGG + Intergenic
1089945164 11:122462630-122462652 CTGGGGACTGGGATGCCATGTGG - Intergenic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091171793 11:133526254-133526276 CTGTGGGCACACATGGCAGGAGG - Intronic
1091389666 12:118294-118316 TTGAGGTCCCAGATGGCATGAGG - Intronic
1091816330 12:3441526-3441548 CTGGGGAGACACAGGGTATGAGG - Intronic
1092170108 12:6369222-6369244 CCGGGCACAGAGATGGCATGGGG - Intronic
1092704770 12:11270236-11270258 CTGGGCACACAGATGACAGAAGG + Intergenic
1092855137 12:12666082-12666104 CAGGGGAGAGAGATAGCATGTGG + Intronic
1092858543 12:12698422-12698444 ATGTGGATACAGATGGCATCAGG - Intergenic
1094524566 12:31223071-31223093 CTGTGCACACAGTTGGGATGAGG - Intergenic
1094721124 12:33064360-33064382 CTGGGGACTGAGATGCCAAGCGG - Intergenic
1096514936 12:52150523-52150545 CAGGGGACACAGAGAGGATGCGG - Intergenic
1096736415 12:53658960-53658982 CTGGGGACTCAGGAGGCCTGAGG - Intronic
1101688486 12:107050206-107050228 CTGGGAAGAAAGATGGCAAGGGG + Intronic
1101731716 12:107432265-107432287 CTGAGGACACTGATGGAATTGGG + Intronic
1102959194 12:117080950-117080972 CTGAGGTCACAGTTGCCATGCGG + Intronic
1104433733 12:128739080-128739102 CTGGGGATACTGATGTGATGTGG + Intergenic
1104566447 12:129889181-129889203 CTGGGGACAAAAATGGCATCAGG - Intronic
1104701179 12:130905294-130905316 CTGGGCACACAGCTGGTAAGAGG - Intergenic
1104710567 12:130982839-130982861 CTGGGGACACAGAAGGACTCAGG + Intronic
1105964912 13:25374777-25374799 CTGGGGACACTGATGGAAACAGG + Intronic
1107795814 13:44050456-44050478 CTGGGGACAGAGACTGAATGTGG + Intergenic
1110544776 13:76744251-76744273 TTGGGGAAACAGGTGGCATTTGG - Intergenic
1111132554 13:83996298-83996320 CTGGGTTCACAGATGGTTTGAGG - Intergenic
1111914905 13:94350783-94350805 TGGGGCACACAGATGGCATTAGG + Intronic
1114493389 14:23117215-23117237 CTGGGGACAGAGGATGCATGTGG - Intergenic
1114549244 14:23523750-23523772 CTGGGGTTCCAGATGGAATGGGG - Exonic
1114556222 14:23563910-23563932 CTGGGGAAGCAGAGGGCCTGAGG - Intronic
1116167210 14:41349654-41349676 GAGGGGACAGAGGTGGCATGGGG - Intergenic
1118257271 14:64215929-64215951 CTGGGGACCAAGATGGCAGAAGG - Intronic
1118921478 14:70153322-70153344 CTAAGGACACAGCTTGCATGGGG + Intronic
1119761531 14:77155346-77155368 ATGGGGACAGAGAGGGCAAGTGG - Intronic
1119896227 14:78222018-78222040 GTGGGGTTGCAGATGGCATGAGG + Intergenic
1120720308 14:87883098-87883120 CTGTGGTCTCACATGGCATGTGG - Intronic
1121220196 14:92279211-92279233 CAGGGGACAGAGAGGGCTTGAGG + Intergenic
1121648995 14:95543036-95543058 CTGAGGACACACATGAGATGAGG - Intronic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1122343821 14:101045776-101045798 ATGGGCACACAGCTGGCAGGTGG + Intergenic
1122641826 14:103164546-103164568 CTGGGGCCACTGAAGGCATCTGG + Intergenic
1122799197 14:104221391-104221413 CAGGGTACACAGATGGCCTGCGG - Intergenic
1122875796 14:104664321-104664343 CTGGGCACACAGATGCCAGCAGG - Intergenic
1124238959 15:28014354-28014376 GAGGGGACACGGATGGCCTGGGG - Intronic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1126325531 15:47473135-47473157 CTGGGGACATAGATGAGAGGAGG + Intronic
1127773672 15:62249783-62249805 GTGGGGGCACAGATGGAAAGGGG + Intergenic
1128310768 15:66630685-66630707 CTGGGCAGAGGGATGGCATGTGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1129037688 15:72660774-72660796 GTGGGGACACAGATAGGAAGGGG - Intronic
1129212199 15:74076447-74076469 GTGGGGACACAGATAGGAAGGGG + Intronic
1129398197 15:75264632-75264654 GTGGGGACACAGATAGGAAGGGG - Intronic
1129401809 15:75288907-75288929 GTGGGGACACAGATAGGAAGGGG - Intronic
1129475394 15:75781596-75781618 GTGGGGACACAGATAGGAGGGGG - Intergenic
1129524917 15:76207674-76207696 CTGGGGACAGAGATAACAGGTGG + Intronic
1129729327 15:77920774-77920796 GTGGGGACACAGATAGGAAGGGG + Intergenic
1130179787 15:81613372-81613394 GTGGCTACACAGATTGCATGAGG - Intergenic
1130642668 15:85693195-85693217 CTGGGCACCCAGATGGCATGTGG - Intronic
1131023120 15:89116531-89116553 CTGAGCATACAGAGGGCATGAGG - Intronic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132730956 16:1361849-1361871 CTGGGGACACAGATGGCATGAGG - Intronic
1133093684 16:3426252-3426274 CTTGGGGCACTGATGGCATTTGG - Intronic
1133344281 16:5059825-5059847 CTGGGGTCAGAGATAGGATGGGG + Intronic
1134234933 16:12458196-12458218 CTGGGCTCACAGATGGAACGTGG - Intronic
1135264389 16:21010139-21010161 CTGGGCACACAGAAGGCACTTGG + Intronic
1136173454 16:28502268-28502290 ATGGGGACACAGCTGGGCTGAGG - Intronic
1137346468 16:47666477-47666499 CTGGGGTTAGAGATGGCCTGGGG - Intronic
1137487605 16:48904745-48904767 ATGGGGACAGAGAGGGAATGAGG - Intergenic
1138338140 16:56268959-56268981 CTGGGGAGGCAGATGGCTTCAGG + Intronic
1138431803 16:56973534-56973556 TAGGGGATCCAGATGGCATGTGG + Intronic
1138440095 16:57029258-57029280 CTGGGGAGACAGATGAGTTGAGG - Intronic
1139682235 16:68574040-68574062 CATGGGACACAGATGGCTAGTGG - Intronic
1140192533 16:72830053-72830075 CTGGGTAAACAGTTGGTATGAGG + Intronic
1141258847 16:82432173-82432195 CTGAGGACAAAGATGCTATGGGG - Intergenic
1141419065 16:83899804-83899826 AAGGGGACACAGTTGGCAGGCGG - Intronic
1141947533 16:87320914-87320936 CTGGGGACACAGATACATTGTGG + Intronic
1142140849 16:88472098-88472120 CTGGGTCCACAGATGGGGTGGGG - Intronic
1142966692 17:3586128-3586150 CTGGGGACACTGAGGCCAAGAGG - Intronic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1145263585 17:21368860-21368882 CAGGGGCCAGAGGTGGCATGTGG + Intergenic
1145902933 17:28499729-28499751 CTGGGGACACAGCTCGAATCAGG - Intronic
1147465426 17:40607243-40607265 CTGGGGCCAAGGATGGCTTGGGG + Intergenic
1149638587 17:58189300-58189322 AGGGGGACACAGAGGGCAGGGGG + Intergenic
1149781943 17:59404752-59404774 CTGGGGCCACAGATAGGGTGTGG - Intergenic
1149815011 17:59714801-59714823 CTGGGACCACAGATACCATGAGG + Intronic
1150286549 17:63957624-63957646 CTGAGGACTCAGATGGTGTGGGG - Intronic
1150588181 17:66537276-66537298 TTGGGGCCACAGATGTCAAGTGG + Intronic
1151391866 17:73792882-73792904 CTGGGGACAAAGAGGAAATGAGG - Intergenic
1151686102 17:75647575-75647597 CTGGGGACTGAGATGGCAGCAGG + Exonic
1152096688 17:78276770-78276792 CTGGGGACCCAGGTGGCAACCGG - Intergenic
1152961447 18:82723-82745 ATGGGGACCCAGGTGGCCTGAGG + Intergenic
1154110864 18:11567448-11567470 CTGGGGAGCCAGCTGGGATGCGG + Intergenic
1155152426 18:23134054-23134076 CTCAGGACAGAGATGGCACGTGG - Intergenic
1155225261 18:23724421-23724443 CTGGGGAGACAGAGGACATCAGG - Intronic
1155926563 18:31662051-31662073 CTGGGGAGTCAGATGGCAACAGG + Intronic
1157595508 18:48861425-48861447 CTGGGAACACAGATGCCCCGCGG + Exonic
1158422171 18:57304813-57304835 CAGGGGACGCTGATGGTATGGGG - Intergenic
1158498984 18:57983194-57983216 CTGAGAAGACAGCTGGCATGAGG + Intergenic
1159548570 18:69871195-69871217 CTGGGGGCAGAGATGGCAGAGGG - Intronic
1159984554 18:74826713-74826735 TTGGGAACACTGATAGCATGAGG + Intronic
1160072162 18:75638624-75638646 CTGGGGAGACACAGGGCAAGGGG - Intergenic
1161040967 19:2110590-2110612 CTGGGGACAAAGGGGACATGGGG + Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161770439 19:6228014-6228036 CTAAGGACACTGATGTCATGCGG + Intronic
1162481088 19:10927601-10927623 CTGGGGAGGCAGGTGGGATGGGG - Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163492281 19:17623807-17623829 CTGAGGACAGCAATGGCATGTGG - Intronic
1165319563 19:35076888-35076910 CTGGGGACCCAGGTGGCAGGAGG - Intergenic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166343301 19:42151133-42151155 CTGGGGACCCAGATGGGAGGAGG + Intronic
1166545724 19:43634076-43634098 CAGGTCACACAGATGGCAAGTGG - Intronic
1167331991 19:48861693-48861715 CTGGGGAGAGAGATGGGAGGAGG + Intronic
1167539233 19:50074751-50074773 CTGGGGCCACAGGGAGCATGAGG - Intergenic
1167630474 19:50623107-50623129 CTGGGGCCACAGGGAGCATGAGG + Intronic
1167672329 19:50860363-50860385 CTGAGGACACAGATAGGATGGGG + Exonic
1168338407 19:55610003-55610025 CTGGGGACAGTGATGTTATGAGG - Intronic
926216758 2:10910741-10910763 CTGTGGAGACAGGGGGCATGTGG - Intergenic
926702811 2:15815114-15815136 CTGGTGAGACAGAAGGCACGTGG - Intergenic
926995626 2:18732422-18732444 CTGGAGACACAGAAGGATTGGGG + Intergenic
927016977 2:18974490-18974512 CTGGGGATACAGAATACATGAGG + Intergenic
927195366 2:20542844-20542866 CTGGGGGCACAGATGGGAGGTGG + Intergenic
927786758 2:25980226-25980248 CTGGGGGCACATTTGGCAGGAGG + Intronic
929782692 2:44967477-44967499 TTGGGGCTACACATGGCATGTGG - Intergenic
930366839 2:50449961-50449983 ATGGCCACACAGATGCCATGTGG + Intronic
931664668 2:64601661-64601683 CTGGTGACACAGAGCCCATGTGG - Intergenic
933433014 2:82209042-82209064 TTGGGGGAACAGATGGCATTTGG + Intergenic
934657245 2:96122767-96122789 CTGGGGCCCCAGAGGGCAAGGGG + Intergenic
935475011 2:103508627-103508649 CTGGGGACAATGATGGCAGATGG - Intergenic
937138655 2:119578053-119578075 CTGGGAGCTCAGATGGCCTGAGG + Intronic
938709603 2:133964841-133964863 TTGAGGACACAGATTGAATGAGG + Intergenic
940659695 2:156531574-156531596 CTGAGGCCACAGATGTCGTGTGG + Intronic
944676185 2:202035231-202035253 CGGGGGCCTCAGATGGCAGGGGG + Exonic
945252980 2:207779825-207779847 CTGAGGCCCCAGATAGCATGGGG + Intergenic
946238471 2:218340006-218340028 CTGGGGACAGAGATGGGCTGTGG - Intronic
946688569 2:222294565-222294587 CGAGGGACAAAGATGGCATCCGG - Intronic
949018751 2:241728618-241728640 CTGGGGACATGGATGCCAAGCGG + Exonic
1168774275 20:435019-435041 CTGTGGACAGAAAGGGCATGTGG + Intergenic
1168885818 20:1253725-1253747 GTAGGTACACAGATGTCATGTGG + Intronic
1169067155 20:2700562-2700584 GTGGGGACACAGGTGGGATGTGG - Intronic
1169245713 20:4022837-4022859 CTGAGGACAAAGGTGGCATGTGG + Intergenic
1169598206 20:7225821-7225843 CTGGGGACAAAGATAACAGGTGG + Intergenic
1169820557 20:9704993-9705015 CTGGGGAAACATTTGGCAAGAGG + Intronic
1170550861 20:17474845-17474867 CTGAGCCCACAGATGGAATGAGG + Intronic
1171448234 20:25219475-25219497 CTGGGGACACAGCCTGCATCAGG + Intronic
1173654694 20:44691504-44691526 CTGGAAAGACAGAGGGCATGGGG + Intergenic
1174175293 20:48640791-48640813 GTGGGCACACAGATGGAAGGAGG + Intronic
1174445372 20:50587483-50587505 CTGGTGACTCACATGGCCTGGGG + Intronic
1174452907 20:50630797-50630819 CTGGGGACACAGGGGCCGTGGGG - Exonic
1174519202 20:51116675-51116697 CTGGGAACTCAGATTTCATGAGG - Intergenic
1175028029 20:55923669-55923691 CTGGGGTGGCAGATGGTATGTGG - Intergenic
1175236564 20:57516985-57517007 CTGGGGAGGCAGATGGAGTGTGG - Intronic
1175627534 20:60501312-60501334 ATGGGGACAGGGATGGGATGAGG + Intergenic
1175749098 20:61482888-61482910 ATGGGGATGCTGATGGCATGAGG - Intronic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176090109 20:63314910-63314932 CTGGGGACACGCATGTCCTGGGG - Intronic
1176090123 20:63314961-63314983 CTGGGGACACACGTGTCCTGGGG - Intronic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1178794931 21:35735119-35735141 CTGGGGACAGGGATGGGATCTGG + Intronic
1180958853 22:19753673-19753695 CTGGGGCCACAGAAGGGAAGGGG + Intergenic
1181403978 22:22668846-22668868 AAGGTGACACAGATGGCAAGGGG - Intergenic
1182500282 22:30741690-30741712 CTGGGGAAACGGCTGGCTTGAGG - Intronic
1182859757 22:33548932-33548954 TTAGGGACAAAGAAGGCATGTGG - Intronic
1183384017 22:37504656-37504678 CTGGGGAGGCAGCTGTCATGGGG - Exonic
1183725601 22:39587557-39587579 CTGTGGCCACAGGTGGAATGAGG + Intronic
1184483942 22:44765133-44765155 CTGGGGCCACAGCTGGCCCGGGG + Intronic
1184744483 22:46448264-46448286 CAGGGAAGACAGAGGGCATGGGG + Intronic
1184795789 22:46731665-46731687 CTGGGGAGGCACAGGGCATGCGG + Intronic
1184804934 22:46788595-46788617 CTGAGGACACAGACGCCCTGTGG - Intronic
1185097525 22:48819538-48819560 CTGGGAACACAGATTGCAGTGGG - Intronic
1185391392 22:50563187-50563209 CTGGGGACACAGCAGGCAAACGG - Intergenic
949135311 3:557984-558006 CTGGGGAGACAGAAAGAATGAGG + Intergenic
950119923 3:10474948-10474970 ATGGGGACACTGAATGCATGAGG - Intronic
950626677 3:14252632-14252654 CTGGGGCCACACATGGCAATCGG - Intergenic
952241166 3:31532731-31532753 CTGGGGATACGGATGGCTAGTGG + Intronic
952760833 3:36912758-36912780 CTGGCAACACAGATGGCCTATGG + Intronic
953038750 3:39236558-39236580 CTGGGGACAGGGATGGGAGGAGG - Intergenic
953736522 3:45498613-45498635 CTGGGGAAAAAGGTGGCTTGAGG + Intronic
953899491 3:46831690-46831712 CTGGGGGCACTGCTGGCATGTGG - Intronic
954451204 3:50572645-50572667 CTGGGCCCAGAGATGGCAGGAGG - Intronic
955139985 3:56259526-56259548 CTGGGGACACAACAGGTATGGGG + Intronic
956788698 3:72663680-72663702 CTGGGGAAGCAGCTGGCATAAGG + Intergenic
958141204 3:89564631-89564653 CTCTGGACACATCTGGCATGTGG + Intergenic
958171711 3:89947398-89947420 CTGGGGAGACTTATGGCCTGGGG + Intergenic
958678305 3:97293928-97293950 TTGGGGACCGAGGTGGCATGGGG + Intronic
958912130 3:100005911-100005933 ATGGGGACACAGCTGGTCTGTGG - Intronic
959605878 3:108241652-108241674 CTGGTGACCCAGATGGAATTGGG + Intergenic
960940470 3:122929783-122929805 CTGGGGACACAGCTTTCATGTGG + Intronic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961625926 3:128263799-128263821 CCCGGCACACAGGTGGCATGAGG + Intronic
961642363 3:128372548-128372570 CTGGGGGTACAGAGGGCCTGGGG + Intronic
962447804 3:135483774-135483796 CTGGGGACACACAGGTCATCTGG - Intergenic
965480412 3:169211969-169211991 ATGGGAAAACAGATGGCAGGTGG - Intronic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
966303746 3:178507852-178507874 GTGGGGACACTAATGGCATTTGG - Intronic
968648529 4:1751441-1751463 CCCGGGACAGAGAGGGCATGGGG - Intergenic
968662369 4:1804044-1804066 TTGGGGACCCAGATGGGAAGTGG - Intronic
968877929 4:3283955-3283977 TTGGGGACACAGGTGGAATGGGG + Intergenic
969443771 4:7232774-7232796 CTGTGGACAGGGATGCCATGGGG + Intronic
969988244 4:11234040-11234062 CTGGGGAGACAGAGGTCATCGGG - Intergenic
971236501 4:24847112-24847134 CTGGTGAGACACCTGGCATGTGG - Intronic
972712425 4:41610714-41610736 CTGAGGTCACAGCTGGCAAGGGG + Intronic
974091717 4:57317987-57318009 CTGTGCACCCAGATGCCATGAGG - Intergenic
975349931 4:73333818-73333840 GTGAGGCCACAGATGGCATTTGG - Intergenic
977664950 4:99635532-99635554 CTCGTGCCAGAGATGGCATGGGG + Intergenic
978372755 4:108045792-108045814 CTGAGGTCACAGCTGGCATGCGG - Intergenic
978414894 4:108464603-108464625 CTGGAGTCACAGACGGTATGGGG + Intergenic
979473243 4:121125573-121125595 CAGGGCACCCAGCTGGCATGTGG + Intergenic
980782694 4:137512204-137512226 CTGGGGAAGCTGATGGCAGGAGG + Intergenic
981107272 4:140895152-140895174 CAGGGGGCACAGGTAGCATGAGG + Intronic
981777381 4:148385744-148385766 CTGTGGATGCAGGTGGCATGGGG - Intronic
985512066 5:318630-318652 CTGGAGACACAGCAGTCATGGGG + Intronic
985678665 5:1244968-1244990 CTGGGATCAGAAATGGCATGGGG + Intronic
985999614 5:3620246-3620268 CTGGGTTCACAGATGGCTGGCGG - Intergenic
987063861 5:14268831-14268853 CCGTGGACACAGATGGCACTGGG - Intronic
990332580 5:54742325-54742347 CTGGGGCCAGATTTGGCATGGGG + Intergenic
991519010 5:67473968-67473990 CTGAGGACAAAGTTGTCATGAGG - Intergenic
991554991 5:67885899-67885921 TTGGGGACACTGATGGCAGATGG - Intergenic
992508640 5:77412077-77412099 CTGAGCAAACAGATGGGATGGGG - Intronic
995456186 5:112354634-112354656 ATGGGGAGCTAGATGGCATGGGG - Intronic
997354539 5:133253878-133253900 CTGAAGACACAAATGCCATGGGG - Intronic
997524625 5:134544391-134544413 CTGGGGTCACAGATGTCCTCGGG - Intronic
1000836182 5:166156909-166156931 ATGGGGCCACAGTTGGCATGAGG + Intergenic
1001847936 5:174938061-174938083 CTGGGGATACAGAGGGGATGAGG - Intergenic
1002178580 5:177417305-177417327 CTTGGGACATAGATTTCATGTGG + Intronic
1002871442 6:1170224-1170246 ATAGGGACCGAGATGGCATGAGG - Intergenic
1006372725 6:33655450-33655472 CTGGGCACAGACATGGCATAAGG + Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1006797611 6:36741587-36741609 CTAGACACACAGATGGCCTGTGG - Exonic
1006836628 6:37002861-37002883 GTGGGGCCTCAGAAGGCATGTGG - Intergenic
1007414562 6:41684158-41684180 TTTGGGACTCAGATGGCAGGAGG - Exonic
1008483077 6:52006715-52006737 TTGGGGGAACAGATGGCATTTGG + Intronic
1010331705 6:74630493-74630515 CTGGGGACCTGGATGGAATGAGG + Intergenic
1010676096 6:78745436-78745458 CTGGGGGCAGGGATGGCAGGTGG + Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011531180 6:88322674-88322696 CTGGGGACATCAATGGCAAGCGG - Intergenic
1012218367 6:96616943-96616965 CTGGGGGCACAACTGGCTTGGGG - Intergenic
1013376014 6:109515005-109515027 GTGGGGACACAGATAGAAGGTGG + Intronic
1016844106 6:148554136-148554158 CTGGGGACAGAGAGGGCCAGAGG + Intergenic
1017751365 6:157492814-157492836 GTGGGGACCCAGATGGGAGGAGG + Intronic
1018133625 6:160756510-160756532 CTGGGGACACAAATGGGCTGGGG - Intergenic
1018486661 6:164247193-164247215 CTGGTGTCACAGCTGGCATGTGG + Intergenic
1018629204 6:165807532-165807554 CTGGGGGCCAGGATGGCATGGGG + Intronic
1019053244 6:169200788-169200810 CTGGGGAGGCTGATGGCATGAGG - Intergenic
1019262515 7:89485-89507 GTGGGGGCAGAGAGGGCATGAGG - Intergenic
1019466751 7:1193883-1193905 CTGGGGAGACAGCTGCCCTGGGG - Intergenic
1019496512 7:1342906-1342928 ATGGGGACACAGATGAGATTTGG - Intergenic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1020090380 7:5335647-5335669 CTGGGGAGAGAGAGAGCATGGGG - Intronic
1020152597 7:5695046-5695068 ATGGGGACACAGATGGGTTAGGG + Intronic
1022307702 7:29163694-29163716 CTGGTGACAGAGATGGCAGGAGG - Intronic
1022729266 7:33007338-33007360 ATGGGGGCACAGAGGGGATGGGG - Intergenic
1023041980 7:36180325-36180347 CTGGGGAGGCAGAGGGGATGAGG + Intronic
1023660376 7:42465593-42465615 TTAGGGACACAGAAGGGATGTGG + Intergenic
1023842189 7:44104101-44104123 CTGGGAAGACAGAGGGCCTGAGG - Intergenic
1023870146 7:44258929-44258951 GTGGGGACAGAGAAGCCATGAGG + Intronic
1023896658 7:44439428-44439450 CTGGGCACTCAGAGGGCACGTGG - Intronic
1024388049 7:48775663-48775685 CTGAGGACAGAGATAGGATGAGG - Intergenic
1024982746 7:55171393-55171415 CTGAGGACAAAGTTGGCACGTGG - Intronic
1025044389 7:55680642-55680664 ATGGGGGCACAGAGGGGATGGGG + Intergenic
1026448357 7:70505627-70505649 CTGCCGACACAGATTGCACGTGG + Intronic
1028968093 7:96825406-96825428 CTGGGTACACAGATGTCTTCTGG + Intergenic
1032471097 7:132179922-132179944 CTGGGGGCACACAGGGCAAGAGG + Intronic
1033466626 7:141596948-141596970 CTGTGGACAGAGATGGCCTAAGG - Intronic
1034548182 7:151802619-151802641 CTGGGCACACAGATAGCCTGGGG - Intronic
1034955457 7:155331553-155331575 TTGGAGACACAGATGGCTTGGGG + Intergenic
1035580046 8:733919-733941 CTGGGGACATGGATGCCTTGGGG - Intronic
1036226146 8:6959402-6959424 CTGGGGATACAGAGAGCATCAGG + Intergenic
1036651374 8:10646201-10646223 GTGGTGACAAAGTTGGCATGGGG - Intronic
1037311544 8:17561653-17561675 GTGAGGACACAGATGGCACGTGG + Intronic
1039532444 8:38275706-38275728 CTGGTGACACAGGAGCCATGGGG + Exonic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1044378085 8:91499953-91499975 CTGGGGACAAGGATGGCAGTGGG - Intergenic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1046713201 8:117536993-117537015 CTGGGGCCACATGTGGCCTGTGG + Intronic
1046714719 8:117554975-117554997 CTGGGGAGACACAGGGCATTGGG - Intergenic
1047214696 8:122866637-122866659 GTGGGAAGACAGATGGCATGAGG + Intronic
1047487503 8:125345091-125345113 CTGGGGACATAGATGGTTTCTGG + Intronic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1048982864 8:139712472-139712494 CTGGGGACCCAGAAGGTACGTGG - Intergenic
1049212673 8:141393885-141393907 CTGGGCTCAAAGATGACATGAGG + Intronic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049422928 8:142524850-142524872 CTGGGGTCACAGATGAGCTGCGG + Intronic
1049466414 8:142752972-142752994 CTTGGAACACAGATGACCTGAGG - Intergenic
1049478442 8:142807662-142807684 CTGGGGACACACATGGCATGTGG + Intergenic
1051312821 9:15794693-15794715 CATGTGATACAGATGGCATGTGG + Intronic
1056070713 9:82983823-82983845 CTGGGGACTGAGATGCCACGTGG + Intronic
1057576445 9:96246464-96246486 CTGGGGACACAGAGTCCATCTGG - Intronic
1057852390 9:98575682-98575704 CTGGGCACCCTGAGGGCATGAGG + Intronic
1058814185 9:108668511-108668533 CTGAGGACAAAGATGTAATGGGG + Intergenic
1059389957 9:113992789-113992811 ATGGACACACAGATGGCATTTGG + Intronic
1059676858 9:116548276-116548298 AAGGGGACAGAGATGGCAGGAGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060814658 9:126628214-126628236 CTGGGGACTCAGAGGGCCAGTGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061510322 9:131057087-131057109 CAGGGGACACAGCTGGCATAGGG - Exonic
1061822592 9:133236786-133236808 CAGGGGACCCAGTTGGGATGAGG + Intergenic
1062068766 9:134543915-134543937 CAGGGGACACAGATGTCGTAGGG + Intergenic
1062189886 9:135242545-135242567 GCAGGGGCACAGATGGCATGTGG - Intergenic
1062736707 9:138141395-138141417 ATGGGGACCCAGGTGGCCTGAGG - Intergenic
1189876176 X:45438551-45438573 TTGGTGACACACATGGCATCAGG - Intergenic
1190719489 X:53135697-53135719 CAGGTGATACAAATGGCATGGGG - Intergenic
1191183280 X:57584420-57584442 CTAGGGACAGGGATGGGATGGGG + Intergenic
1194434024 X:93848522-93848544 CTGGGGACCGAGATGCCAGGCGG + Intergenic
1194769707 X:97886720-97886742 CTGGGGAAACAAATGGGGTGAGG - Intergenic
1195906648 X:109850895-109850917 ATGGGGACAAAGATGGCATCAGG - Intergenic
1197796502 X:130304641-130304663 CTGGGGACTGAGATGGCAGGCGG + Intergenic
1198229490 X:134675698-134675720 TTGGGGACATAAATGGCAGGAGG - Intronic
1198284739 X:135178339-135178361 TTAGGGACACAGATGTGATGAGG + Intergenic
1198974228 X:142317817-142317839 CAGGGGAAACAGATGTCAGGGGG - Intergenic
1200110316 X:153737598-153737620 CTGGGGACACAGGTGATCTGTGG - Intronic