ID: 1132735194

View in Genome Browser
Species Human (GRCh38)
Location 16:1382471-1382493
Sequence CAGCGCCCAGTGGTGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 354}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132735194_1132735214 28 Left 1132735194 16:1382471-1382493 CCAAGCCCCACCACTGGGCGCTG 0: 1
1: 0
2: 1
3: 36
4: 354
Right 1132735214 16:1382522-1382544 TGGCCTCCTGAGGGAGGGACTGG 0: 1
1: 0
2: 2
3: 30
4: 359
1132735194_1132735211 23 Left 1132735194 16:1382471-1382493 CCAAGCCCCACCACTGGGCGCTG 0: 1
1: 0
2: 1
3: 36
4: 354
Right 1132735211 16:1382517-1382539 CCCCATGGCCTCCTGAGGGAGGG 0: 1
1: 0
2: 1
3: 36
4: 341
1132735194_1132735209 22 Left 1132735194 16:1382471-1382493 CCAAGCCCCACCACTGGGCGCTG 0: 1
1: 0
2: 1
3: 36
4: 354
Right 1132735209 16:1382516-1382538 TCCCCATGGCCTCCTGAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 278
1132735194_1132735204 8 Left 1132735194 16:1382471-1382493 CCAAGCCCCACCACTGGGCGCTG 0: 1
1: 0
2: 1
3: 36
4: 354
Right 1132735204 16:1382502-1382524 CAGGATTCCCACTCTCCCCATGG 0: 1
1: 0
2: 2
3: 30
4: 250
1132735194_1132735208 19 Left 1132735194 16:1382471-1382493 CCAAGCCCCACCACTGGGCGCTG 0: 1
1: 0
2: 1
3: 36
4: 354
Right 1132735208 16:1382513-1382535 CTCTCCCCATGGCCTCCTGAGGG 0: 1
1: 1
2: 2
3: 36
4: 429
1132735194_1132735207 18 Left 1132735194 16:1382471-1382493 CCAAGCCCCACCACTGGGCGCTG 0: 1
1: 0
2: 1
3: 36
4: 354
Right 1132735207 16:1382512-1382534 ACTCTCCCCATGGCCTCCTGAGG 0: 1
1: 0
2: 1
3: 34
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132735194 Original CRISPR CAGCGCCCAGTGGTGGGGCT TGG (reversed) Intronic
900193343 1:1360655-1360677 CAACCCCCAGAGGTGGGGCTAGG - Intronic
900374873 1:2349099-2349121 CAACGCCCAGAGCAGGGGCTCGG + Intronic
900809038 1:4787296-4787318 CAGAGCAGAGTGATGGGGCTGGG + Exonic
901139535 1:7019458-7019480 CAGCTCCTGGTGGTGGGGCAGGG + Intronic
902717946 1:18285411-18285433 CAGGGCCCAGAGGTGGGGTCTGG + Intronic
903134928 1:21303076-21303098 AAGCAGCCAGTGGTGGGGCTGGG - Intronic
903708185 1:25302359-25302381 GACAGACCAGTGGTGGGGCTCGG + Intronic
903718924 1:25390054-25390076 GACAGACCAGTGGTGGGGCTCGG - Intronic
904479646 1:30785881-30785903 CAGAGCCCAGGGCTGGGCCTTGG - Intergenic
904612461 1:31732961-31732983 CTGCGCCGAGAGGTGGGGCTGGG - Exonic
904841464 1:33374387-33374409 CAGGGCCAGGTGCTGGGGCTAGG + Intronic
905444395 1:38016194-38016216 CAGAGCCCAGTTGTGGGGAGGGG + Intronic
905852790 1:41286603-41286625 CAGCACCAAGGGTTGGGGCTAGG - Intergenic
905862827 1:41362125-41362147 CCGCGCCCAGGGGCGGCGCTGGG - Exonic
907246699 1:53113596-53113618 CAGGGCCAAGTGGTGGCCCTGGG - Intronic
907427840 1:54392063-54392085 CAGCTCCCATTGGAGGGGGTGGG - Intronic
907767460 1:57424526-57424548 CTGCGTCCAGTGGTGGTGATGGG - Intronic
908356278 1:63327291-63327313 AAGCACTTAGTGGTGGGGCTGGG + Intergenic
908474145 1:64471434-64471456 CGGCGCCCATTGGTGCGCCTCGG - Intronic
909176767 1:72371291-72371313 AAGCTACCAGTGGTGGGGTTAGG + Intergenic
910755795 1:90689172-90689194 CAGAGCCCAGTGGAGAGGCTGGG + Intergenic
911807914 1:102234866-102234888 CAGCGCCCATCGGGGAGGCTCGG + Intergenic
913045294 1:115068947-115068969 CAGCTCCTCCTGGTGGGGCTTGG - Intronic
913238003 1:116801736-116801758 CAGAGCCCACTGGTGATGCTGGG + Intergenic
913496677 1:119433883-119433905 CAGGGTCCAGTGGTTGGGGTGGG + Intergenic
915466169 1:156099307-156099329 AAGCAGCCAGTGGTGGAGCTAGG - Intronic
919176931 1:194030904-194030926 CAACCCCCAGTGGTGGGGATGGG + Intergenic
919914233 1:202130097-202130119 AAGGGACCAGAGGTGGGGCTGGG - Exonic
920268988 1:204749062-204749084 CAGCACCCAGAGGTGGGGGAAGG - Intergenic
921032473 1:211345593-211345615 CAGGACCCATTGGTGGGCCTTGG + Intronic
922152328 1:223017069-223017091 CGGCGCCCACTGCTGGGTCTTGG + Intergenic
922206881 1:223455817-223455839 CTGAGTCCAGTGGTGGAGCTGGG - Intergenic
922774441 1:228208295-228208317 CAGCTCCCTGTGGCGGGGCTGGG + Intronic
923299769 1:232630233-232630255 CCGCGCCCAATCGTGGGGCGGGG - Intergenic
923596863 1:235367296-235367318 CCCCGCCCAGAGGCGGGGCTTGG + Intergenic
1063115951 10:3071943-3071965 CAGAGCTCCGTGGTGGGGCCGGG + Intronic
1064220207 10:13433969-13433991 CAGTGCCCAGTGGCTGGGCGTGG + Intergenic
1064875771 10:19992983-19993005 CAGAGCCGAGTCGTGAGGCTAGG - Intronic
1066366523 10:34782304-34782326 CAGCGCCCAGTGGAGGAGGCTGG - Intronic
1067048700 10:43000063-43000085 CACTGCCCAGTGGAGGGGCCTGG - Intergenic
1067774704 10:49154535-49154557 CAGAGTCCAGTGGTGGTGTTGGG + Intergenic
1067781277 10:49209215-49209237 CAGGGCCCAGGAGTGGGGTTGGG - Intergenic
1069280790 10:66651515-66651537 CAGCGCCCATCGGGGAGGCTCGG + Intronic
1070531705 10:77342837-77342859 CACTTCCCAGTGATGGGGCTCGG - Intronic
1070540710 10:77413329-77413351 CAGCCCCGAATGCTGGGGCTGGG + Intronic
1072610158 10:97012640-97012662 GGGCTCCCAGGGGTGGGGCTTGG - Intronic
1074130125 10:110566814-110566836 CAGCGGGCGGGGGTGGGGCTGGG + Intergenic
1074445945 10:113520912-113520934 CAGGGGCCAGTGCGGGGGCTGGG - Intergenic
1074867550 10:117553694-117553716 CAGCGCCCAGAGCTGGGGTCCGG + Intergenic
1075077161 10:119359185-119359207 CAGAGGCCAGGGGTGGGGCTGGG + Intronic
1076317320 10:129551709-129551731 CTGCACCCAGTGGTGGGGTCTGG - Intronic
1076963434 10:133786055-133786077 CAGCGCCCCGTGCTGGCGCCAGG - Intergenic
1077107600 11:848782-848804 TTGTGCCCTGTGGTGGGGCTGGG + Intronic
1077179487 11:1205908-1205930 CAGAGCCCAGGGGTGGAGCCTGG + Intergenic
1077563515 11:3281281-3281303 CAGAGCCCATTGATGGGGCCGGG + Intergenic
1079336887 11:19577771-19577793 CAGCCCCCAATAGTGGGGCCTGG - Intronic
1081834478 11:46142889-46142911 CAGGGGCCTGTGGTGGGGGTGGG - Intergenic
1081863109 11:46345467-46345489 CTGGGCCCAGTGGAGGCGCTGGG + Intronic
1082819662 11:57536467-57536489 TGTGGCCCAGTGGTGGGGCTTGG + Intergenic
1082991478 11:59210970-59210992 CAGCCTCCACTGGTGGGTCTGGG + Exonic
1083000607 11:59287594-59287616 CAGCCTCCACTGGTGGGTCTGGG + Intergenic
1083201440 11:61123371-61123393 CAGTGGTAAGTGGTGGGGCTAGG - Intronic
1084673641 11:70622017-70622039 CAGCGCCATGTGGAGGGGCCTGG + Intronic
1085411914 11:76296474-76296496 CCCGGCCCAGTGTTGGGGCTGGG + Intergenic
1085707434 11:78799279-78799301 CAATGACCAGTGTTGGGGCTGGG + Intronic
1087779456 11:102287339-102287361 CCCCGCCCAGAGGTGGGGCAAGG + Intergenic
1089659514 11:119976946-119976968 CAGCACCCTGTGCTGGGTCTAGG - Intergenic
1089733519 11:120534378-120534400 TAGAGACAAGTGGTGGGGCTGGG + Intronic
1090743854 11:129691580-129691602 CAGCTCCCTGTGGGGGGGCAGGG + Intergenic
1091498274 12:991155-991177 CTGCGCCCCGCGGCGGGGCTGGG + Intronic
1094215084 12:27932060-27932082 CAGCGCTCAGTAGAGGGACTCGG - Intergenic
1096509524 12:52119960-52119982 CGGCACTCAGGGGTGGGGCTGGG + Intergenic
1096526618 12:52213677-52213699 CGGCTCCCAGAGGTGAGGCTGGG + Intergenic
1096550702 12:52369956-52369978 CTGAGCCCAGGGCTGGGGCTGGG + Intergenic
1096812925 12:54183140-54183162 CTGCCCCCAGTGGGGGTGCTTGG - Intronic
1097908688 12:64946556-64946578 CTGCCAGCAGTGGTGGGGCTTGG + Intergenic
1100283965 12:93146519-93146541 CAGCTGCAACTGGTGGGGCTTGG - Intergenic
1100398357 12:94204706-94204728 CAGAGCCCAGTGGAGGGGCGAGG - Intronic
1100853624 12:98739107-98739129 CACAGCCAAGTGGTGGAGCTGGG + Intronic
1101328265 12:103735925-103735947 GAGGTCACAGTGGTGGGGCTGGG - Intronic
1102726099 12:115066413-115066435 CAGCGTCCAGCAGTGGGGATGGG + Intergenic
1103063193 12:117875459-117875481 CAGCGCCAAGGGAAGGGGCTTGG + Intronic
1103722726 12:122983199-122983221 CAGAGCCAGGTGCTGGGGCTGGG + Intergenic
1104186255 12:126434946-126434968 AGGCTCTCAGTGGTGGGGCTGGG - Intergenic
1104890977 12:132140062-132140084 CAGCGGCCACTGGGGGGTCTGGG - Intronic
1104934425 12:132356928-132356950 AAGCGCCAGATGGTGGGGCTGGG - Intergenic
1104945904 12:132414820-132414842 CAGCTCCCTGGGGTGGGGCAGGG - Intergenic
1104971795 12:132534135-132534157 CAGGGCTGAGTGGTGGTGCTTGG - Intronic
1109299340 13:60574767-60574789 CAGAGCCTAGGGGTGGGGTTGGG + Intergenic
1109995915 13:70125885-70125907 CAACCCCCGGTGGTGGGGTTTGG - Intergenic
1110064579 13:71087551-71087573 CAGCGCCCATTGGGGAGGCTAGG - Intergenic
1110833123 13:80054249-80054271 CAGCCCCCAGAGGTGGAGGTTGG - Intergenic
1112324488 13:98434269-98434291 CAGTGCTCAGTGGCAGGGCTGGG - Intronic
1113722839 13:112573803-112573825 CAGCACTCAGTGGTGGGGGTGGG - Intronic
1113989863 13:114352891-114352913 CAGCGCCCCGTGCTGGCGCCGGG - Intergenic
1114264131 14:21061501-21061523 CAGGGCTCAGTGGTGAAGCTGGG + Intronic
1114616882 14:24073049-24073071 CAGCACGCAGGGGTGGGGTTTGG - Exonic
1116828347 14:49693417-49693439 CGGCGGCCAGCGGAGGGGCTGGG - Intronic
1117625761 14:57636190-57636212 CAGCGCCCAGTGTTTAAGCTTGG - Intronic
1118092901 14:62502330-62502352 CAACGACCAGTGGTGGGACCTGG - Intergenic
1119484653 14:74979711-74979733 CAGCTCCCACTGGTGGTGTTAGG - Intergenic
1119666459 14:76488626-76488648 CTGTGCCCAGTCGTGGGGGTGGG + Intronic
1120463289 14:84824592-84824614 TAGCGCCAAATGGTGGGGGTGGG - Intergenic
1120827644 14:88969915-88969937 CAGTGGCCAGAGCTGGGGCTTGG - Intergenic
1121495986 14:94391515-94391537 CAGGGCCCTGTGGTGGGGCAGGG - Intergenic
1122544491 14:102514667-102514689 CACCCACCAGTGGTGGGACTGGG + Intergenic
1122573701 14:102726802-102726824 GAGCTGCCATTGGTGGGGCTCGG - Exonic
1122681632 14:103468922-103468944 CAGCGCCCAGTTCTAGCGCTGGG - Intronic
1123224005 14:106883322-106883344 CAGCGCCCACTGCTGGCGCCGGG - Intergenic
1123476734 15:20596260-20596282 CTGGGCCACGTGGTGGGGCTGGG + Intergenic
1123641277 15:22404104-22404126 CTGGGCCACGTGGTGGGGCTGGG - Intergenic
1124410588 15:29433149-29433171 CAGCCACCAGTGCTGGGGCTGGG - Intronic
1124606326 15:31172551-31172573 CAGAGCCCAGTGGGGTGGCTTGG - Intergenic
1125543804 15:40488239-40488261 CAGAGCCCAGTGGTGGGGAGGGG - Intergenic
1125689696 15:41585938-41585960 AAGGCCCTAGTGGTGGGGCTGGG + Intergenic
1125758175 15:42079792-42079814 CAGCGCCCCATGCTGGGCCTCGG - Intronic
1127099509 15:55550893-55550915 CAGGGACCAGTGGTGGGGGATGG + Intronic
1128257973 15:66212309-66212331 CAGCACACAGAGGTGGGACTTGG + Intronic
1128260001 15:66226732-66226754 CAGCATCCACTGGGGGGGCTTGG + Intronic
1128522061 15:68381953-68381975 CACCTCCCAGAGGTGGGGCGAGG - Intronic
1128731982 15:70027313-70027335 CAGTGCCCAGTGCAGGGTCTGGG - Intergenic
1129176586 15:73844556-73844578 CAGAATCCTGTGGTGGGGCTGGG - Intergenic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1129670773 15:77606566-77606588 CAGCACCCAGAGCTGGGGCTGGG - Intergenic
1129698171 15:77752479-77752501 CAGAGCCCTGTGGGGAGGCTGGG - Intronic
1130546306 15:84859362-84859384 CAGCGCCCAGTGGGCGAGGTGGG + Exonic
1131112870 15:89776408-89776430 CTTCGCCCAGGGCTGGGGCTGGG + Exonic
1131358840 15:91771188-91771210 CAGCACCCAGTGTAGGGGTTTGG - Intergenic
1131865031 15:96699239-96699261 CAGAGTTCAGTGGTCGGGCTGGG + Intergenic
1132735194 16:1382471-1382493 CAGCGCCCAGTGGTGGGGCTTGG - Intronic
1132855788 16:2044021-2044043 CCGCTCCCAGGAGTGGGGCTTGG + Intronic
1132958181 16:2607555-2607577 CAGGGCCCAGTGATGGGGTGTGG + Intergenic
1132970655 16:2686803-2686825 CAGGGCCCAGTGATGGGGTGTGG + Intronic
1133103613 16:3493697-3493719 CAGCGCCCAGGCCTGGGCCTCGG - Exonic
1133172855 16:3992574-3992596 CAGTGCCCAGTGGTAACGCTGGG + Intronic
1133322888 16:4925170-4925192 CAGAGCCCAGAGAAGGGGCTGGG + Intronic
1136276366 16:29181428-29181450 CAGCCCCCAGGGGTGTGGGTGGG + Intergenic
1136368363 16:29820399-29820421 CCAAGCCCAGGGGTGGGGCTTGG - Exonic
1136887287 16:33937424-33937446 CAGGGCTCAGTGGTGTGGATGGG + Intergenic
1136928146 16:34394376-34394398 CAGTGCCCAGTGGCTGGGCGTGG - Intergenic
1136976428 16:35017430-35017452 CAGTGCCCAGTGGCTGGGCGTGG + Intergenic
1137564873 16:49526622-49526644 CAGGGGTCAGTGGTGGGGATGGG + Intronic
1138206773 16:55131060-55131082 CACAGCCCAGGGGTGGGGCAGGG + Intergenic
1139054161 16:63161384-63161406 CAGCTCCCAGTTCTGGAGCTGGG + Intergenic
1139447536 16:67007078-67007100 CAGCTCCCAGTACTGGGGCTGGG - Intronic
1141491773 16:84378684-84378706 AAGCGCTCAGTGGTGGGGGCAGG + Intronic
1141767981 16:86071252-86071274 CAGAACCCAGAGGTGGGGCCAGG + Intergenic
1141842586 16:86583650-86583672 GAGCGGGCAGTGGTGGGGCTTGG + Intergenic
1141930652 16:87200260-87200282 CATCCCCCAGTGCTGGGTCTGGG + Intronic
1142080749 16:88147488-88147510 CAGCCCCCAGGGGTGTGGGTGGG + Intergenic
1203085166 16_KI270728v1_random:1180414-1180436 CAGGGCTCAGTGGTGTGGATGGG - Intergenic
1142808903 17:2386172-2386194 CAGAGCCCAGTGGCAGGGATTGG + Exonic
1144777837 17:17793679-17793701 CAGCGGCCTGTCATGGGGCTGGG - Exonic
1146647600 17:34585394-34585416 CAGACCCCAGTGGTGGGAGTTGG - Intronic
1146653700 17:34622905-34622927 GAGAGATCAGTGGTGGGGCTGGG + Intronic
1147057240 17:37844069-37844091 CAGCCCCCAGAGGTTGGGGTGGG - Intergenic
1147191801 17:38742220-38742242 AAAAGCCCAGGGGTGGGGCTTGG + Intronic
1147609456 17:41793099-41793121 CAGCGGCCAGTGGTGGTGGAGGG + Intergenic
1147649096 17:42051777-42051799 CAGCAGCCACTGGTGGGGCTGGG - Intronic
1147854064 17:43465314-43465336 CAGCGCCTGGTGCTGGGGCTGGG + Intergenic
1148109662 17:45137334-45137356 CAGCACCCAGAGGTGGGCCTGGG - Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148271376 17:46264702-46264724 CAGAGTCCAGTGCTGGGTCTTGG - Intergenic
1149085293 17:52709636-52709658 CACAGCCCAGAGGTGCGGCTGGG + Intergenic
1150988512 17:70227595-70227617 CAGCGGCCAGCGGGGAGGCTGGG - Intergenic
1151783705 17:76265140-76265162 CCGCGCCCATTGGCGGAGCTCGG - Intergenic
1152091608 17:78250576-78250598 GGGCACACAGTGGTGGGGCTGGG + Intergenic
1152299324 17:79486024-79486046 CAGCACCAAGGGGTGGGGCGTGG - Intronic
1152361719 17:79835966-79835988 CTGAGCACAGAGGTGGGGCTTGG - Intronic
1152565219 17:81097357-81097379 CAGTGCCCGGTGGTAGTGCTGGG + Intronic
1152567806 17:81107964-81107986 GAGCGCCCAGGTGTGGCGCTGGG - Intronic
1152609726 17:81309717-81309739 CAGCTCCCCCTGGAGGGGCTGGG - Intergenic
1154160959 18:11980951-11980973 CAGCGCGCGGCGGTGGGGCGGGG + Intergenic
1154355477 18:13620870-13620892 CAGCTCCCTGTGGTGGGGGATGG + Intronic
1155746562 18:29361979-29362001 CAACGCGCAGGGGAGGGGCTGGG - Intergenic
1156486992 18:37472661-37472683 CAGCTCAGAGTGGTGGAGCTGGG + Intronic
1157488977 18:48109090-48109112 CAGCTCCCAGTTGTGGGGTGAGG + Intronic
1157592295 18:48843096-48843118 CAGGGGCCAGTCCTGGGGCTTGG - Intronic
1160234802 18:77077559-77077581 CATAGCCCTGTGGTGGGGCAGGG + Intronic
1160370482 18:78368743-78368765 CAGCACCCAATGGTGGAGCGTGG + Intergenic
1160438171 18:78867167-78867189 CCACGCCCAGTGGTGGAGCTGGG - Intergenic
1160591529 18:79947576-79947598 CAGAGAGCAGAGGTGGGGCTGGG - Intronic
1160811885 19:1016361-1016383 CTGGGCCCAGTGGTGGGTCACGG + Intronic
1160827821 19:1088933-1088955 CTCAGCCCAGGGGTGGGGCTTGG - Intronic
1160990009 19:1856657-1856679 CAGGGCCCAGTGGTTGAGATGGG - Intronic
1161043002 19:2120105-2120127 TAGCGGCCAGTGGTGGTGATGGG + Intronic
1161118608 19:2512930-2512952 CAGCCTCCTGTGGTTGGGCTGGG - Exonic
1161210526 19:3062965-3062987 CAGGGCCCTGGGGTGGGGCGGGG + Exonic
1162724097 19:12679612-12679634 CAGAACACAGAGGTGGGGCTGGG - Exonic
1162751830 19:12834046-12834068 CGGCGCCCTGGGGCGGGGCTGGG + Intronic
1163167829 19:15509638-15509660 CAGTGCCCAGTGGGAGAGCTGGG + Intronic
1163313998 19:16530595-16530617 CAGAGCCCAGCCCTGGGGCTTGG - Exonic
1163484224 19:17576780-17576802 CAGGGCTGAGTGGTGCGGCTGGG + Intronic
1163484889 19:17579768-17579790 CAGGGCTTAGAGGTGGGGCTGGG + Intronic
1164037669 19:21468486-21468508 CAGAGACCTGTGGTAGGGCTAGG + Intronic
1164809949 19:31147895-31147917 CAGGGCTCAGTGGTTGGGGTAGG + Intergenic
1165129543 19:33623079-33623101 CAGTGCCCGATGCTGGGGCTTGG + Intronic
1165474036 19:36019246-36019268 CAGCGGCCAGTGGGTGGGCGTGG - Exonic
1166267257 19:41691936-41691958 CAGAATCCAGGGGTGGGGCTGGG + Intronic
1166381387 19:42357007-42357029 CAGGGCCCAGTGTGAGGGCTGGG - Intronic
1166381531 19:42357573-42357595 CACCCCCCACAGGTGGGGCTGGG + Exonic
1166853435 19:45771008-45771030 CAGTGCCCGCTGGTGGGGCCAGG - Exonic
1166929055 19:46290203-46290225 CAGAGGCCAGTGGTGGGGAAGGG - Intergenic
1167211129 19:48134816-48134838 CAGCACCCAGTGGGGGGCCCTGG + Intronic
1168110514 19:54189301-54189323 CGGCGCCCAGTGGCGAGGCGAGG - Intronic
1168170727 19:54586954-54586976 CAGAGCCCAGGAGTGAGGCTGGG + Intronic
1168352041 19:55681396-55681418 CAGGGCCCAGAGGGTGGGCTCGG - Intronic
1168728568 19:58606504-58606526 CAGCGCCCCGTGCTGGCGCAGGG - Intergenic
925799282 2:7581690-7581712 TAGCCCCCAGTGATGGGGTTTGG + Intergenic
925898803 2:8494182-8494204 GAGCCCCCAGTGGTGGGCATGGG - Intergenic
925998130 2:9308422-9308444 CAGTCCCCAGTGTTGGAGCTGGG - Intronic
926095692 2:10079822-10079844 CGGCGCCCAGGGCTGGGGCGGGG + Intronic
926143486 2:10382856-10382878 GAGTGCCCTGTGGTGTGGCTGGG - Intronic
927098330 2:19765181-19765203 CAGTGTCCAGTGGAGGGCCTGGG + Intergenic
927247098 2:20965849-20965871 CAGTGCCCAGAGCTGGTGCTGGG + Intergenic
927948141 2:27149632-27149654 CAGCAGCCAGTGGTAGGACTGGG + Intronic
928862550 2:35875659-35875681 TGGCCCCCAGTGGTGGGGTTTGG + Intergenic
929442275 2:41973486-41973508 CAGCGCCCAGGTGTGGGGCCAGG + Intergenic
929564440 2:42975653-42975675 CAGTGCCCCGAGCTGGGGCTTGG + Intergenic
932087265 2:68773588-68773610 CATCGCCTAATGGTGGGGATTGG - Intronic
932358119 2:71083412-71083434 CTGGGCCCAGTGGAGGTGCTGGG + Intergenic
932370458 2:71182979-71183001 CTGGGCCCAGTGGAGGTGCTGGG + Exonic
934973944 2:98787178-98787200 AAGGGCTCAGGGGTGGGGCTGGG + Intergenic
935294601 2:101638116-101638138 CATGGCCCAGTGCTGGGCCTTGG + Intergenic
936041079 2:109150016-109150038 CAGGGCCCTGTGATGGGTCTGGG + Intronic
936493972 2:113001641-113001663 CAGTGCACAGGGTTGGGGCTGGG - Intergenic
936556463 2:113502023-113502045 CAGCTACCAAAGGTGGGGCTTGG - Intergenic
936568647 2:113598239-113598261 CAGTGCCCAGTGCTGGGTCAGGG + Intergenic
937529308 2:122808982-122809004 TAGGGACCAGTGGTGGGGGTTGG - Intergenic
937954828 2:127416277-127416299 AAGTGCCCAGTGCTGGGGGTTGG - Intergenic
938745571 2:134275115-134275137 CACTGCCCAGGGGTGGAGCTGGG - Intronic
942931062 2:181493022-181493044 CAGTGCCCAGTGGCAGAGCTCGG + Intronic
943520574 2:188944487-188944509 CAGCGCCCACTGGTGAGGCTCGG + Intergenic
946174758 2:217915749-217915771 CAGCTCGCAGTGGCAGGGCTGGG - Intronic
948020961 2:234732871-234732893 CAGAGCCCTGGGGTGAGGCTTGG - Intergenic
948079171 2:235191552-235191574 CAGGGCCGAGTGGCGGGGTTTGG - Intergenic
948196805 2:236102955-236102977 CAGAGCCAAGAGGTGGGGCGGGG - Intronic
948660803 2:239505450-239505472 CAGAGCCCTGTGGTCGGGGTGGG + Intergenic
948687370 2:239677607-239677629 CAGCTCCCTGAGGTGGGGCAGGG - Intergenic
949031643 2:241799931-241799953 CAGCGGCCAGATGTAGGGCTGGG - Intronic
1170562330 20:17569090-17569112 CGGCGCGCAGGGGTGTGGCTGGG - Intronic
1170607787 20:17886716-17886738 CAGGGCCCAGTGGTGGAGGGTGG + Intergenic
1172763251 20:37336622-37336644 CAGGGCTCTGTGGTGGGGCTGGG - Intergenic
1173417429 20:42869305-42869327 CAGCTCTCAGTGGTTGGGGTTGG - Intronic
1174080381 20:47967217-47967239 CACAGCCCACTGCTGGGGCTGGG + Intergenic
1174137212 20:48388056-48388078 CACAGCCCACTGCTGGGGCTGGG - Intergenic
1174447766 20:50602108-50602130 CAGCTCCCGGAGCTGGGGCTGGG + Exonic
1174636254 20:52002313-52002335 CAGCCCCCAGTGGTGGATCAGGG - Intergenic
1174855487 20:54041377-54041399 CAGCACCAAGGGGTGGGGGTAGG + Intronic
1175957492 20:62618805-62618827 CAGAGCCCCGGGGAGGGGCTGGG - Intergenic
1176203257 20:63873829-63873851 CAGCCCCCAGGGGTGCGCCTGGG - Intronic
1179189040 21:39107831-39107853 CAGGGCGCAGTGGTGGGTGTTGG - Intergenic
1179508123 21:41855268-41855290 CAGCACCCTGTGGCGGAGCTGGG - Intronic
1179874955 21:44262666-44262688 CAGGGCTCAGTGGCGGGGGTCGG + Intergenic
1179949394 21:44701188-44701210 CAGCGCGGAGTGGTCGGGCCGGG + Intronic
1181007693 22:20021741-20021763 CAAAGCCCAGCGGTGGGGCAAGG - Intronic
1181022228 22:20109561-20109583 CTGCTCCCTGGGGTGGGGCTTGG + Intronic
1181864369 22:25843840-25843862 CAGGGCCGAGAGGTTGGGCTTGG - Exonic
1183068685 22:35381255-35381277 CAGTGTCCCGGGGTGGGGCTAGG - Intronic
1183623341 22:38987271-38987293 GAGAGCCCAGGGCTGGGGCTGGG - Intronic
1183627644 22:39014467-39014489 GGGAGCCCAGAGGTGGGGCTGGG - Intronic
1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG + Intergenic
1184388932 22:44192118-44192140 GAGGGCCCATGGGTGGGGCTGGG + Intronic
1184665934 22:45989080-45989102 CAGCACCCAGGGCTGAGGCTGGG + Intergenic
1184916556 22:47573083-47573105 CAGCTCCCAGGGGTGGGGTCAGG - Intergenic
1184920614 22:47603267-47603289 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1184920636 22:47603345-47603367 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1184920658 22:47603423-47603445 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1184920680 22:47603501-47603523 CAGCCCCCAGTGTTGGAGGTGGG + Intergenic
1185009453 22:48305095-48305117 CTGCGCCCACTGCTGGGGCCAGG + Intergenic
1185419240 22:50726257-50726279 CTGTGGCCAGTTGTGGGGCTCGG - Intergenic
950052740 3:10004634-10004656 CAGGGCCACGTGGTGGAGCTGGG - Intronic
950345621 3:12288798-12288820 CAGCCCCCCGGGGTGCGGCTGGG - Intronic
950400929 3:12768846-12768868 CAGCGCTCATTGGGGAGGCTCGG + Intronic
950563634 3:13750776-13750798 CAGTGCACAGTGGCTGGGCTGGG + Intergenic
953258666 3:41315701-41315723 CAGTTCCCAGTGGTGGGGAAAGG + Intronic
953311734 3:41887151-41887173 TCGCCCCCAGTGGTGGGGCCAGG - Intronic
955463134 3:59207773-59207795 CAGCTCCCAGTGATGGAGCTTGG + Intergenic
956066585 3:65402935-65402957 CGGCCCCCAGTGGTGGGACCTGG - Intronic
957371528 3:79300527-79300549 CAGCGCTCAGTGGGGAGGCTGGG - Intronic
958268549 3:91469419-91469441 CAACTCCCATTGGTGAGGCTTGG - Intergenic
958822079 3:98987223-98987245 CAGGGCTCTGTGGTGGGGGTGGG + Intergenic
962974356 3:140433266-140433288 CAGGTCCCAGTGGTGGGCCTGGG - Intronic
964768098 3:160197909-160197931 CAGGGCCCAGGGCAGGGGCTTGG - Intergenic
964813815 3:160695077-160695099 CAAGGCCCAGGGGTGGGGCTAGG - Intergenic
967214613 3:187199623-187199645 CCGCGCCCAGCGGGCGGGCTCGG + Exonic
967266842 3:187698917-187698939 CCGCGCCCAGCGGGCGGGCTCGG - Exonic
967989424 3:195120251-195120273 CAGAGGGCAGTGGTGGGGTTGGG - Intronic
968440823 4:623682-623704 GAGGGCCCTGGGGTGGGGCTGGG - Intergenic
968636843 4:1685062-1685084 CAGCCTCCCGTGCTGGGGCTCGG + Intergenic
969321682 4:6416709-6416731 CAGAGCCCAGTGCTGCTGCTTGG - Intronic
969483509 4:7459187-7459209 CAGCGTCCCATGGTGGGGCAGGG - Intronic
972279780 4:37590716-37590738 CAGCCCCCAGTGGGGGAGCATGG + Exonic
974309556 4:60187488-60187510 CAGCTTGCAGTGGTGAGGCTTGG - Intergenic
977155696 4:93570196-93570218 CAGTAGCCAGTGGTGGAGCTGGG + Intronic
980623663 4:135344285-135344307 CTGGACCCAGTGGTGAGGCTGGG + Intergenic
981576729 4:146213420-146213442 CAGGACCCAGTGGAGGGGGTGGG + Intergenic
985427116 4:189841728-189841750 CACTGCCTAGTGGTGGGCCTGGG - Intergenic
985492268 5:186856-186878 CAGCTCCCAGTGCTGAGGCATGG - Exonic
986184390 5:5422606-5422628 CCGCGCCCAGGGGAGGGGCGGGG + Intronic
986733941 5:10654311-10654333 CTGTGCACAGGGGTGGGGCTCGG + Intergenic
987193224 5:15500314-15500336 CAGCGCCCACCGGAGGGGATCGG + Exonic
989559727 5:42836677-42836699 CAGCGCCCAAGGGGGAGGCTCGG - Intronic
992641526 5:78772418-78772440 CAGCGGTCTGAGGTGGGGCTGGG + Intergenic
996575848 5:124976170-124976192 CGGCGCCCATTGGGGAGGCTCGG + Intergenic
997210613 5:132074699-132074721 CAGCCCCCAGGAGTAGGGCTTGG - Intronic
999147280 5:149405011-149405033 CTGCTCCCAATGGTGGGGCTGGG - Intergenic
1000393560 5:160749611-160749633 CATCACCTAGTTGTGGGGCTGGG + Intronic
1000568617 5:162882780-162882802 CAGCGCCCAGCGGGGAGGCTTGG - Intergenic
1001236552 5:170034586-170034608 CAGAACCCTGTGGGGGGGCTTGG + Intronic
1001732088 5:173968229-173968251 CACTGCCCAGTGCAGGGGCTAGG + Intergenic
1001757141 5:174179265-174179287 CCAAGCCCAGTGCTGGGGCTGGG - Intronic
1002325756 5:178404574-178404596 CAGGGACCAATGGAGGGGCTGGG - Intronic
1004284723 6:14310616-14310638 CAGCACCTAGTGGTGTGCCTGGG + Intergenic
1006175844 6:32121028-32121050 CAGCTCCAAGTGAGGGGGCTGGG + Exonic
1006397792 6:33798425-33798447 CAGGGCCGATTGTTGGGGCTGGG - Intronic
1006518006 6:34555399-34555421 CAGAGCCCAGTAGCTGGGCTGGG - Intronic
1007126699 6:39431779-39431801 CAGCGCCCAGCAGTGAGGGTTGG - Intronic
1007174271 6:39885498-39885520 CAGGGCCCTGAGGTGAGGCTGGG + Intronic
1007448054 6:41921861-41921883 CAGTGGCCAGTAGTGGGGCGGGG + Intronic
1007607163 6:43125378-43125400 CAGCACCCACTCCTGGGGCTGGG - Intronic
1008986655 6:57552162-57552184 CAACTCCCATTGGTGAGGCTTGG + Intronic
1012251017 6:96980989-96981011 CAGAGCAAAGTGGTGGGGCGGGG + Intronic
1012476698 6:99621514-99621536 CAGGGGGCAGAGGTGGGGCTGGG + Intergenic
1014718605 6:124892282-124892304 CAGCGCTCACTGGGGAGGCTCGG - Intergenic
1017066178 6:150531355-150531377 CAGGGGCCAGTGAGGGGGCTAGG - Intergenic
1017396201 6:154002549-154002571 CAGGAAGCAGTGGTGGGGCTGGG - Intergenic
1018707994 6:166476772-166476794 CAGGGCCCAATTGAGGGGCTGGG - Intronic
1019450500 7:1095279-1095301 CAGCGCCCAGGTGTGGGGGGTGG - Intronic
1019522948 7:1468795-1468817 CAGCCCCCAGGGGTGGGGCGTGG - Intergenic
1019523237 7:1469777-1469799 CAGCTCCCAGGGGAGGGTCTGGG - Intergenic
1019605155 7:1906443-1906465 CAGGGCCCTGGGGCGGGGCTGGG - Intronic
1020213447 7:6171747-6171769 CAGCGCCCAGTGCTGTAGGTGGG - Intronic
1021307074 7:19045516-19045538 AAGCACCCAGAGGTGGGCCTAGG - Intronic
1021312657 7:19112527-19112549 CAGCGGCCAGACGCGGGGCTGGG + Intronic
1022142054 7:27501031-27501053 CAGAGCCCAGAGGAGGTGCTAGG + Intergenic
1024157483 7:46639714-46639736 CAGTGGCCTGGGGTGGGGCTTGG + Intergenic
1024232650 7:47374384-47374406 CAGCTCCAAGTGGCAGGGCTGGG + Intronic
1026881671 7:73910064-73910086 CAGCTCTAAGTGGTGGGACTGGG - Intergenic
1027182157 7:75948374-75948396 CAGCCAACAGGGGTGGGGCTTGG - Intronic
1027615198 7:80414514-80414536 CAGCGCCCAGTGCTGCACCTTGG + Intronic
1028844794 7:95467722-95467744 CACTGCCCACAGGTGGGGCTAGG - Intergenic
1032086112 7:128884752-128884774 GAGGGCACAGTGGTGGGGCTGGG - Intronic
1032339693 7:131059070-131059092 CAGCGCTCATTGGGGAGGCTTGG - Intergenic
1034951661 7:155301094-155301116 CACCACCCAGTACTGGGGCTGGG - Intronic
1035297720 7:157876645-157876667 CAGCGCCCCCACGTGGGGCTGGG + Intronic
1035403961 7:158586891-158586913 GAGTGCCGAGTGGCGGGGCTCGG + Intronic
1035924395 8:3711455-3711477 CAGCGCCCTTTGGTTGGGGTTGG - Intronic
1036258135 8:7221333-7221355 GAGGGGCCAGTGGTGGGGGTAGG - Intergenic
1036310184 8:7679929-7679951 GAGGGGCCAGTGGTGGGGGTAGG - Intergenic
1037784266 8:21893231-21893253 CACAGCCTTGTGGTGGGGCTTGG - Intergenic
1038427531 8:27473951-27473973 CACCAGCCAGTGGTGGGGCCAGG - Intronic
1040489145 8:47903570-47903592 CAGCGCCAAGTGGTGATGCAGGG + Intronic
1040965525 8:53077684-53077706 CAGTGCCCACTGGGGAGGCTTGG + Intergenic
1044698980 8:94949439-94949461 CACCGCCGATTGGTGGGGCCCGG - Intronic
1045036045 8:98177169-98177191 CAGTGCCAAGTGCTGGGGCAGGG - Intergenic
1047527887 8:125649259-125649281 CAGCCTCCAGTTGTGGGGCCAGG + Intergenic
1048189676 8:132276455-132276477 CAGAGCCCATTGCAGGGGCTGGG - Intronic
1048280797 8:133104170-133104192 CAGTGGCCAGTGGAGGGACTGGG + Intronic
1049188536 8:141272611-141272633 AAGGGCCCCGTGGTTGGGCTGGG - Intronic
1049263042 8:141649936-141649958 CAGCACACAGGGGTGGGGCCAGG - Intergenic
1049415424 8:142492788-142492810 CAAAGCCCAGGGGTGGGCCTGGG - Intronic
1049513725 8:143042830-143042852 AAGCAGCCAGTGGTGGGGCCTGG + Intronic
1050864372 9:10479396-10479418 AAGCCCCTAGTGGTGGGGATGGG + Intronic
1051761608 9:20472513-20472535 CAACCCCCAGTGGTAGGGGTGGG - Intronic
1053146409 9:35715048-35715070 CAGCGCCTGGAGGTGAGGCTGGG - Exonic
1053739665 9:41125552-41125574 CAGCTACCAAAGGTGGGGCTTGG + Intergenic
1054688687 9:68305768-68305790 CAGCTACCAAAGGTGGGGCTTGG - Intergenic
1054836258 9:69677234-69677256 CAGCTCCCAGTCCTGGAGCTGGG + Intergenic
1055849436 9:80608633-80608655 CAGTGCACTGTGGTGTGGCTGGG - Intergenic
1056580526 9:87885971-87885993 CTGGGCCATGTGGTGGGGCTGGG - Exonic
1060676238 9:125517726-125517748 CAGAGCCCATTCGTGAGGCTAGG - Intronic
1060937174 9:127522375-127522397 CTGCGCCCAAGGGTGGGGCGGGG + Intronic
1060974143 9:127754899-127754921 GGGCGCCCAGAGGTGAGGCTGGG + Intronic
1061213340 9:129206140-129206162 CAGGGCCTAGGGGTGTGGCTTGG + Intergenic
1061245936 9:129401383-129401405 CAGGGCCCAGAGCAGGGGCTGGG - Intergenic
1061673579 9:132202767-132202789 AAGCTCTCAGTGGTGGGGCTGGG - Intronic
1061817701 9:133206540-133206562 CAGAGCTCGGGGGTGGGGCTGGG + Intronic
1061971674 9:134048634-134048656 CAGCTGGCAGTGGTGAGGCTGGG + Intronic
1062242671 9:135548563-135548585 CAGAGCTCAGGGGTGGGGCTGGG - Intronic
1062276740 9:135734916-135734938 CGGCGCCCAGGGGTGGTGCGGGG + Intronic
1062499202 9:136845097-136845119 CAGCGCCATGTGGCGGGGCCCGG - Exonic
1185835732 X:3345312-3345334 CAGCGCCCAGAGGCGGAGCCCGG - Intronic
1187734738 X:22292235-22292257 GAGCTCCCAGAGCTGGGGCTGGG - Intergenic
1188616480 X:32164801-32164823 CCGCACACAGTGGTGGGGTTGGG - Intronic
1190735032 X:53250545-53250567 CTGGGCCCAGTGGTGTGGCTGGG - Exonic
1192174597 X:68877943-68877965 CAGACCCCAGGGCTGGGGCTGGG + Intergenic
1192912946 X:75624455-75624477 CAGACCCCAGTGGTGGAGCTGGG + Intergenic
1192986805 X:76408549-76408571 GAGCCCCCAGTGCTAGGGCTCGG - Intergenic
1194245782 X:91510362-91510384 CTGCGGCCTGTGGTGGGGTTGGG - Intergenic
1195148711 X:102043917-102043939 CAGCTCCCACTGGGAGGGCTGGG + Intergenic