ID: 1132736212

View in Genome Browser
Species Human (GRCh38)
Location 16:1387407-1387429
Sequence CCTGCTTCAGACCCTCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 271}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132736199_1132736212 28 Left 1132736199 16:1387356-1387378 CCTGGTGCCATCTCAGTGGCAAC 0: 1
1: 0
2: 0
3: 18
4: 113
Right 1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 271
1132736208_1132736212 -7 Left 1132736208 16:1387391-1387413 CCTTGCACTTCCTGTCCCTGCTT 0: 1
1: 0
2: 4
3: 72
4: 530
Right 1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 271
1132736205_1132736212 0 Left 1132736205 16:1387384-1387406 CCCTATCCCTTGCACTTCCTGTC 0: 1
1: 0
2: 7
3: 81
4: 875
Right 1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 271
1132736201_1132736212 6 Left 1132736201 16:1387378-1387400 CCCGCCCCCTATCCCTTGCACTT 0: 1
1: 0
2: 1
3: 19
4: 339
Right 1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 271
1132736203_1132736212 2 Left 1132736203 16:1387382-1387404 CCCCCTATCCCTTGCACTTCCTG 0: 1
1: 3
2: 63
3: 166
4: 615
Right 1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 271
1132736200_1132736212 21 Left 1132736200 16:1387363-1387385 CCATCTCAGTGGCAACCCGCCCC 0: 1
1: 0
2: 0
3: 6
4: 143
Right 1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 271
1132736204_1132736212 1 Left 1132736204 16:1387383-1387405 CCCCTATCCCTTGCACTTCCTGT 0: 1
1: 2
2: 21
3: 228
4: 1044
Right 1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 271
1132736207_1132736212 -6 Left 1132736207 16:1387390-1387412 CCCTTGCACTTCCTGTCCCTGCT 0: 1
1: 1
2: 17
3: 146
4: 964
Right 1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 271
1132736206_1132736212 -1 Left 1132736206 16:1387385-1387407 CCTATCCCTTGCACTTCCTGTCC 0: 1
1: 0
2: 3
3: 48
4: 502
Right 1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 271
1132736202_1132736212 5 Left 1132736202 16:1387379-1387401 CCGCCCCCTATCCCTTGCACTTC 0: 1
1: 0
2: 1
3: 23
4: 463
Right 1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132736212 Original CRISPR CCTGCTTCAGACCCTCAGTG TGG Intronic
900590869 1:3459251-3459273 GGTGCGCCAGACCCTCAGTGGGG + Intronic
901023609 1:6267541-6267563 CCTGGTACAGACCATCAGAGAGG - Intronic
901027500 1:6286350-6286372 CCTGCTACAGAGGCTCAGAGAGG - Intronic
901055359 1:6446601-6446623 CCTGCTCCAGAGCCTCAGCCAGG - Intronic
902325042 1:15694458-15694480 CCTGGTTTAGACCCTCAAGGAGG - Intronic
902479007 1:16701988-16702010 CCTGCTCCAGAGCCTCAGCCAGG + Intergenic
902998744 1:20248987-20249009 CCTGATTCAGACCCCAAGAGAGG - Intergenic
903829879 1:26168442-26168464 AGTGCTACAGACCCTGAGTGGGG - Intergenic
904300114 1:29548876-29548898 CCTCCTTCTGATCCTCACTGGGG + Intergenic
904322403 1:29706344-29706366 CCTGATCCAGACCCTAAGAGAGG + Intergenic
905826290 1:41028205-41028227 CCTGCTTCAGCCGGTCAATGTGG + Exonic
906953268 1:50351151-50351173 CCTGCTTCACACCCTGTGAGGGG + Intergenic
907103139 1:51855313-51855335 ACTGCTGCAAAACCTCAGTGTGG + Intronic
910080386 1:83334632-83334654 CCTTCTTTAGACTCTCAGTTAGG + Intergenic
914505160 1:148282197-148282219 CCCGCTTCCTCCCCTCAGTGGGG - Intergenic
914507405 1:148301951-148301973 CCCGCTTCCTCCCCTCAGTGGGG + Intergenic
915064352 1:153212389-153212411 TCTGATTCAGACCCCCTGTGTGG + Intergenic
915174274 1:154001920-154001942 GCTGCTACAGGCCCTCAGTGTGG - Exonic
916125374 1:161565745-161565767 CTGGCTTTAGACCCTTAGTGAGG - Intergenic
916135262 1:161647136-161647158 CTGGCTTTAGACCCTTAGTGAGG - Intronic
916203895 1:162297135-162297157 CCTCGTTCAGACCCTCTTTGGGG + Intronic
916249285 1:162721250-162721272 CCTGCTCCAGGGCCACAGTGTGG - Intronic
916562741 1:165947554-165947576 CATGCTTCTGCCCATCAGTGTGG + Intergenic
917301304 1:173577201-173577223 CCTGCTGGAGACCATCACTGAGG + Intronic
919744140 1:200998378-200998400 TGTGCTGCAGAACCTCAGTGAGG - Exonic
919895813 1:202009260-202009282 CCTTCTTGAGACCCTGAATGGGG - Exonic
919969048 1:202560265-202560287 CCTGATTCAGACCCCAAGAGAGG + Intronic
920060767 1:203225555-203225577 CCTGCCACAGACCCACTGTGTGG - Intronic
920134637 1:203759644-203759666 CCTGATTCAGACCCCAAGAGAGG - Intergenic
921294181 1:213686677-213686699 CCTGATCCAGACCCTGAGAGAGG + Intergenic
922154884 1:223033095-223033117 CCTGATCCAGACCCTAAGAGAGG - Intergenic
922159740 1:223070370-223070392 CCCGATTCAGACCCTAAGAGAGG - Intergenic
922764775 1:228151090-228151112 CCTGCTTGGGACCCTGAGGGAGG + Intronic
924168862 1:241316065-241316087 CATGCTTCTGACACTCATTGCGG + Intronic
1064042738 10:11982439-11982461 CCTGAGTCAGAGCATCAGTGAGG - Intronic
1064068470 10:12204213-12204235 CCTGCGTCAGACCCAGTGTGTGG - Intronic
1065542259 10:26782067-26782089 CCTTCTTCAGGCTATCAGTGGGG + Intronic
1067475902 10:46565948-46565970 CCTGATTCAGAGCCTGAGTCAGG + Intergenic
1067618837 10:47775827-47775849 CCTGATTCAGAGCCTGAGTCAGG - Intergenic
1069932469 10:71891948-71891970 CCTGCTTCAGTCACCCAGTAAGG + Intergenic
1070189542 10:74099162-74099184 CCTGCTTAAACCCTTCAGTGGGG + Intronic
1070791203 10:79190345-79190367 CCTGCCTCGGATCCACAGTGGGG + Intronic
1072549306 10:96465338-96465360 CCTGCTCCAGTCAATCAGTGAGG - Intronic
1072749538 10:97967756-97967778 TCTGCTTAATACACTCAGTGAGG - Intronic
1072896581 10:99372390-99372412 CTTGCATCAGACCCTCAGGTTGG - Intronic
1073088069 10:100908115-100908137 CCTACTACTGAGCCTCAGTGAGG - Intergenic
1073214500 10:101829137-101829159 GCTGCTCCAGACCCTCAGGCCGG + Exonic
1075387732 10:122069180-122069202 CTTTCTCCAGACCTTCAGTGGGG + Intronic
1076164033 10:128267941-128267963 CCTGCTGCAGACCCGCCGGGTGG + Intergenic
1076217057 10:128703592-128703614 CCTGCTTCAGCACCTCTTTGGGG + Intergenic
1076608331 10:131703816-131703838 CCGGCTCCAGACCCCCACTGTGG - Intergenic
1076684217 10:132189837-132189859 CCTGCTTAAGGCCCCCAGTCAGG + Intronic
1077873608 11:6284131-6284153 CCTGATTCAGACCCCAAGAGAGG - Intergenic
1077874064 11:6288720-6288742 CCTGATTCAGACCCCAAGTGAGG - Intergenic
1078458717 11:11496614-11496636 CCTTCTTCCCACCCTCTGTGTGG - Intronic
1080749654 11:35140076-35140098 CCTGCTTCTGCCAATCAGTGTGG + Intronic
1081397384 11:42602781-42602803 ACTGCTTCAGACACTCAGGAGGG - Intergenic
1081715059 11:45244210-45244232 CCTGCTGCAGGCCTCCAGTGTGG - Exonic
1081804092 11:45880699-45880721 CCTGCATCAGCACCTCAGAGGGG + Intronic
1084463514 11:69309128-69309150 CCTGCTTCAGGCCCTGCCTGGGG - Intronic
1087053084 11:93905636-93905658 CTTTCTTCAGGCCCTCTGTGGGG - Intergenic
1089287256 11:117415615-117415637 CCTGCTTCATTCCCAGAGTGTGG - Intergenic
1091846040 12:3657013-3657035 CCTGCTTCAGCACCTCTCTGTGG - Intronic
1092248515 12:6877721-6877743 CCTGCTTCAGCCTCTCAAAGTGG - Intronic
1092271701 12:7029066-7029088 CCTGCCTCAGCCCCCCATTGAGG + Intronic
1093016165 12:14156639-14156661 TTTGCTGCAGACCCTCAGTAGGG + Intergenic
1093168792 12:15836036-15836058 TCTGTTTCAGAGCTTCAGTGAGG - Intronic
1093502628 12:19829377-19829399 GCTGCTTCAGACCCCAAGTCAGG - Intergenic
1093747937 12:22764269-22764291 CCTGCTTTAGAACCTCAGGAAGG + Intergenic
1096593643 12:52679847-52679869 CCTTCTTCAGCCCCTCAATGTGG - Exonic
1096665789 12:53163258-53163280 CCTGCCTCAGACTCCCACTGTGG - Intronic
1097101908 12:56595797-56595819 CCTGTTCCATACCCTCTGTGTGG - Exonic
1098858825 12:75684593-75684615 CCTGATTCAGACCGCCAGAGAGG - Intergenic
1101050600 12:100859711-100859733 ACTGCTTCAGAGCCTCTGTGAGG + Intronic
1101921264 12:108935012-108935034 CCTGATTCAGACCCCAAGAGAGG - Intronic
1102998266 12:117365934-117365956 CCTGAATTAGACCCTCAGGGTGG + Intronic
1104232952 12:126903090-126903112 CCTGATCCAGACCCCCAGAGAGG + Intergenic
1104338786 12:127927812-127927834 CATGCTTCAGCCCATCTGTGGGG - Intergenic
1105346672 13:19579208-19579230 CCTGCTTGTGACCCTCGGTCGGG - Intergenic
1106197236 13:27504314-27504336 CATGCGTGAGGCCCTCAGTGTGG - Intergenic
1112591367 13:100766270-100766292 CCTGATCCAGACCCTAAGAGAGG + Intergenic
1112889730 13:104214081-104214103 CCTGCTTCAGACACTGATTGAGG + Intergenic
1113166391 13:107448204-107448226 CCTGATACAGACCCTCAGCCAGG - Intronic
1114524738 14:23360474-23360496 CCTGCTGCAGGCCCTGGGTGGGG + Intronic
1116860593 14:49992508-49992530 CCTGCATGAGTCCCTCAGTGAGG + Intronic
1117072880 14:52071829-52071851 CCTGATCCAGACCCTAAGAGAGG - Intergenic
1117443480 14:55781030-55781052 CCTGCTCCAGGCCCTCAGCTGGG + Intergenic
1118118681 14:62810901-62810923 CCTGATTCAGACCCCAAGAGAGG - Intronic
1118399924 14:65369963-65369985 CCTGATTCAGACCCAAAGAGAGG - Intergenic
1119322357 14:73739507-73739529 CCCGCTTCAGTGCCTCAGGGTGG + Exonic
1119545590 14:75469331-75469353 CCTGCTTCAGCTCCTCAATCTGG - Exonic
1120941887 14:89956925-89956947 CCTTCTTAAAGCCCTCAGTGGGG + Intronic
1123858265 15:24435981-24436003 CCTCCTTCACACCATCTGTGGGG + Intergenic
1123862897 15:24486445-24486467 CCTCCTTCACACCATCTGTGGGG + Intergenic
1124426993 15:29570785-29570807 CTTGCCTCGGACCCTCTGTGAGG - Intergenic
1124707812 15:31979798-31979820 CCAGGTGCAGACCCTCAGTACGG - Intergenic
1124707830 15:31979896-31979918 CCAGGTGCAGACCCTCAGTACGG - Intergenic
1125517814 15:40332542-40332564 CCTGCTTCAGTCCCATTGTGAGG + Intronic
1127614923 15:60674843-60674865 CCTGTATCTGTCCCTCAGTGTGG + Intronic
1130845908 15:87745330-87745352 CGTGGTTCAGATCTTCAGTGTGG + Intergenic
1131320558 15:91386036-91386058 CTTGCTTCAGAGCCTCAAAGAGG + Intergenic
1131552019 15:93365387-93365409 CCTGATCCAGACCCCCAGAGAGG - Intergenic
1132160565 15:99537699-99537721 CCTGCTTTAGACCTTGAGTTAGG + Intergenic
1132464120 16:69902-69924 CCTGCTACAGGCCATCTGTGAGG + Intronic
1132617868 16:851348-851370 CCCGCACCAGGCCCTCAGTGTGG - Intergenic
1132736212 16:1387407-1387429 CCTGCTTCAGACCCTCAGTGTGG + Intronic
1132747382 16:1442706-1442728 CCCGCTGCGGACCCTCTGTGGGG - Intronic
1132799564 16:1745204-1745226 CCTGCTCCTGACCCTCATGGTGG - Intronic
1132826112 16:1906506-1906528 CTTTCTCCAGACCCTCAGTCGGG + Intergenic
1132956007 16:2593991-2594013 CTTGCTTCAGACCCACAGGATGG + Intronic
1135688837 16:24520215-24520237 CCTGCCACAGCCCATCAGTGAGG + Intergenic
1137704760 16:50526869-50526891 CCTGCTGGAAGCCCTCAGTGAGG - Intergenic
1138434409 16:56989223-56989245 CCTGTCTCAGTGCCTCAGTGGGG - Intergenic
1138853013 16:60652944-60652966 CCTTCTCCACACCCTAAGTGAGG - Intergenic
1139354812 16:66361173-66361195 CCTGCCTGAGCTCCTCAGTGTGG + Intergenic
1139546906 16:67653719-67653741 GCTGCGTCAGACCCTCTGGGGGG - Intronic
1140717403 16:77739150-77739172 CCTGATCCAGACCCTAAGAGAGG + Intronic
1142118700 16:88375249-88375271 CCTGCGTCAGGCCCTCAGGGCGG - Intergenic
1145257503 17:21334859-21334881 CCTGCTGCAAAACCTCAGTGTGG + Intergenic
1145319137 17:21753176-21753198 CCTGCTGCAAAACCTCAGTGTGG - Intergenic
1145785733 17:27592690-27592712 CCTGCCTCAGAGGCTCAGTGGGG + Intronic
1145901786 17:28494579-28494601 CCTGCTTCTGTCCCACAGAGGGG + Intronic
1146822838 17:35998515-35998537 CCTGCTTCAGACCCTCCCCAGGG + Intronic
1147543381 17:41379650-41379672 CCTGGTTCAGGTCCACAGTGGGG + Exonic
1148091609 17:45025599-45025621 GCTACTTCAGCCCCTCAGTGAGG + Intronic
1149639054 17:58191481-58191503 CCTGCTCCAGACTCCCAGGGAGG - Intergenic
1150979492 17:70125542-70125564 CCTGGTCCAGACCCCAAGTGAGG + Intronic
1152482354 17:80563076-80563098 CCTGGGTCAGACCCGCAGTTTGG + Intronic
1152809711 17:82375670-82375692 CCTCCTGGAGACCCTCAGGGAGG - Intergenic
1153097164 18:1420056-1420078 ACTGCTTCAGATCCTCAATAGGG - Intergenic
1156458672 18:37308976-37308998 TCAGCTTCAGACCCTCTTTGAGG + Intronic
1156458684 18:37309029-37309051 CCAGCCTCAGACCCTCTCTGAGG + Intronic
1157048862 18:44136155-44136177 CCTGATTCAGACCCCAAGAGAGG - Intergenic
1157614677 18:48979464-48979486 GCTGCCTCAGACCCTCAGCTGGG - Intergenic
1157767228 18:50308722-50308744 ACTACTTGAGACCGTCAGTGGGG + Intergenic
1160607176 18:80059920-80059942 CCTGATCCAGACCCTAAGAGAGG + Intronic
1161085387 19:2332776-2332798 CACACTGCAGACCCTCAGTGTGG - Intronic
1161490456 19:4558241-4558263 ACTGCTTGAGTCCCCCAGTGGGG + Intronic
1161510698 19:4669700-4669722 CCGGCCTCACACCCTCGGTGAGG + Intronic
1161753507 19:6114682-6114704 CCTGCTTAAAACCCTCCATGGGG - Intronic
1162551301 19:11359915-11359937 GCCGCTTCAGCCCCCCAGTGCGG + Exonic
1162974931 19:14203200-14203222 CCTCCTCCAGCCCCTCTGTGGGG - Intronic
1163134081 19:15296689-15296711 GGTGCTTCAGAATCTCAGTGTGG - Intronic
1164436333 19:28233144-28233166 CCCGCTGCAAAGCCTCAGTGTGG - Intergenic
1164941560 19:32255218-32255240 CCTGCTTAAGACCTTCAGCCAGG - Intergenic
1165171397 19:33894519-33894541 CCTGTGTGAGAACCTCAGTGTGG - Intergenic
1165177206 19:33939115-33939137 CCTGCTTCCCACCCTCAGGGAGG + Intergenic
1166077672 19:40423156-40423178 CCTGACTCAGGCCCTCAATGTGG + Exonic
1166650670 19:44572049-44572071 CCTGCCCCAAACTCTCAGTGTGG - Intergenic
1167009580 19:46798187-46798209 CCTGCTTCAGACTCCCAATTAGG - Intergenic
1167279672 19:48559626-48559648 CCTCCTCCAGACCCTCTGGGTGG - Intronic
1202713048 1_KI270714v1_random:27895-27917 CCTGCTCCAGAGCCTCAGCCAGG + Intergenic
925008492 2:464802-464824 CTTGCTTCAGAGCCTCATAGAGG + Intergenic
928478056 2:31651710-31651732 CATGGTTCATAACCTCAGTGAGG + Intergenic
929969328 2:46560137-46560159 ATAGCTTCAGACCCTCAGGGAGG + Intronic
930019758 2:46994383-46994405 CCTGCTGCACTCCCTGAGTGAGG + Exonic
930673862 2:54179386-54179408 CCTGATCCAGACCCTAAGAGAGG + Intronic
932100038 2:68890205-68890227 CATCCTTCAGACTCACAGTGGGG - Intergenic
932305947 2:70704447-70704469 CCTGCTTCAGTCTTTCAGGGAGG - Exonic
937074161 2:119088887-119088909 CCTGCTACAGTCACCCAGTGAGG - Intergenic
937514407 2:122637366-122637388 CCTGATCCAGACCCCCAGAGAGG - Intergenic
937514446 2:122637695-122637717 CCTGATCCAGACCCCCAGAGAGG - Intergenic
937981860 2:127620435-127620457 GCTGCTTCCCACCCTCAGAGAGG + Exonic
938060457 2:128250621-128250643 CCTTCTTCACACCCTCAGCCTGG - Intronic
938894983 2:135741372-135741394 CCTCGTTGAGACTCTCAGTGTGG - Intergenic
940887266 2:159000652-159000674 CCTTCTTCATTCCCACAGTGTGG - Intronic
941658404 2:168169317-168169339 AATGCTACAGACCTTCAGTGTGG - Intronic
942123479 2:172801448-172801470 TAGGTTTCAGACCCTCAGTGGGG + Intronic
942221385 2:173772312-173772334 TATGCTTCAGACCCTCAAAGGGG + Intergenic
942547496 2:177080034-177080056 CCTGCTTCACCCCCTCTGTGGGG - Intergenic
942898337 2:181085092-181085114 CCTGCTTGAGACCCTGGGAGAGG - Intergenic
944565765 2:200989564-200989586 CCTGCTTCAGCCTCTCAAAGTGG - Intronic
945252220 2:207773197-207773219 CCTGATTCAGACCCCAAGAGAGG - Intergenic
946997522 2:225412072-225412094 CCTGCCTCAGTCCCTCAGCTGGG + Intronic
947819500 2:233060310-233060332 CCTGTTTCAGGCGCTCAGTGAGG - Exonic
948579162 2:238972242-238972264 CATGCCTCACACCCTCACTGTGG - Intergenic
948737155 2:240016637-240016659 TCAGCTTCAATCCCTCAGTGGGG + Intronic
1169190853 20:3658490-3658512 CCTGCTCCAGAGCCCCTGTGGGG - Intergenic
1170765018 20:19282481-19282503 CGTGGTTCAGTCCCTCAGTGGGG - Intronic
1172013310 20:31858905-31858927 CCTGCATCAGAACCTCACGGGGG - Intronic
1172367261 20:34359576-34359598 CCTGATTCAGACCCCAAGAGAGG - Intergenic
1173143542 20:40505686-40505708 CCTTCCTCAGCTCCTCAGTGAGG - Intergenic
1174133086 20:48359669-48359691 CCTGAATCAGAACCTCAGGGTGG - Intergenic
1174723800 20:52840382-52840404 GCTGATCCAGACCCTCAATGAGG + Intergenic
1175097410 20:56552537-56552559 CCTGATCCAGACCCCCAGAGAGG - Intergenic
1175692638 20:61076519-61076541 CCTCCTGCAGAGCCTCTGTGGGG - Intergenic
1178022290 21:28422884-28422906 CCTGCTTAAAACCTTCAGTGTGG - Intergenic
1178899832 21:36589885-36589907 CCTGCATCAGCCCCTCTTTGTGG + Intergenic
1179394696 21:41028122-41028144 CCTGATCCAGACCCCCAGAGAGG + Intergenic
1179468289 21:41593021-41593043 CCTGGTTCAGATGCTGAGTGAGG - Intergenic
1181463741 22:23099803-23099825 CCTGTGTCTGTCCCTCAGTGTGG - Intronic
1182809741 22:33105643-33105665 GCTGAGTCAGACCCTCAGAGTGG + Intergenic
1183174442 22:36212567-36212589 CCTGCCTCACATCCTCAGGGTGG + Intergenic
1183591381 22:38781149-38781171 CCAGCTGCAGGCCCTCAGTCAGG - Intronic
1184197181 22:42937720-42937742 CCTGCTCCTCACCCACAGTGGGG - Intronic
1184230237 22:43154830-43154852 CCTGGGTCCCACCCTCAGTGGGG + Intronic
1184769673 22:46589866-46589888 CCTCCCTCAGCCCCTCAGAGAGG + Intronic
1185365806 22:50436223-50436245 CCTGCTTCAGGCCCTCAGACGGG + Intronic
949247332 3:1940637-1940659 CCTGGTTGTGAACCTCAGTGAGG - Intergenic
949548982 3:5096710-5096732 CCCTTTTCATACCCTCAGTGGGG - Intergenic
951350403 3:21600318-21600340 CCTGATTCAGACCCCAAGAGAGG - Intronic
951472120 3:23067843-23067865 CCTGCTATAAAACCTCAGTGTGG - Intergenic
951785547 3:26414725-26414747 CCTGCTTCTGCCCTTCACTGTGG - Intergenic
952279696 3:31911087-31911109 CCTGCTTCAGACCCTGTTTGAGG + Intronic
952327200 3:32332281-32332303 CCTGCTGCAGACCTGCAGTGGGG + Intronic
952502971 3:33981127-33981149 CCTGTTTCAAAGCATCAGTGGGG - Intergenic
952886668 3:38016660-38016682 ACTTCTCCAGACCCTCCGTGCGG + Exonic
953929719 3:46999826-46999848 CCTGCTCCAGACCCTCATCCAGG - Intronic
956767485 3:72496229-72496251 CCTGTTTCAGACCCTGCATGAGG + Intergenic
957539202 3:81546894-81546916 CCTGATCCAGACCCTAAGAGAGG - Intronic
960030857 3:113053500-113053522 CCTGCGTCACCCCCTGAGTGGGG - Intergenic
960184995 3:114627469-114627491 CCTACTTCTGACCCTCAGTTAGG + Intronic
960386359 3:117026299-117026321 CCTGATCCAGACCCTGAGAGAGG - Intronic
961925384 3:130473956-130473978 ACTGCTTGAGACCATCATTGTGG - Intronic
962246796 3:133802156-133802178 CCTGCTTCAGCCCCCCAGAGTGG - Intronic
962480488 3:135793997-135794019 CCTGCTTCAGCCAGCCAGTGGGG - Intergenic
963082215 3:141404440-141404462 CCAGCTTCAGGGCCTCTGTGAGG + Intronic
965617669 3:170611530-170611552 CCTGCCTCAGAGCCTCTGTCTGG + Intronic
967145235 3:186600874-186600896 CCTGCTTCACTCCCTCAGGGTGG - Intergenic
967339628 3:188382032-188382054 CCTGCCTCAGCCTCCCAGTGTGG + Intronic
967739512 3:192989604-192989626 CCTGCCTCAGTCCCTCAGCTGGG + Intergenic
968393510 4:212656-212678 CCTGCTTCCACCCCTCAGGGAGG + Intergenic
968410492 4:386192-386214 CCTGCTTCCACCCCTCAGGGAGG + Intergenic
969452604 4:7283464-7283486 ACTGCTGCAGAGCCTCAGGGCGG + Intronic
975046999 4:69817958-69817980 CCCCCCTCAGTCCCTCAGTGTGG + Intronic
978153994 4:105468919-105468941 GCTGCTGCAGAACCTCAGAGAGG - Intronic
978479552 4:109173800-109173822 AATGCTTGAGACCATCAGTGAGG + Intronic
982220257 4:153118535-153118557 CCTGATCCAGACCCCAAGTGAGG - Intergenic
985971098 5:3379202-3379224 CCAGCATGAGACCCTCAGGGTGG + Intergenic
986459225 5:7952872-7952894 CCTACTCCCGACCCTCAGTTAGG + Intergenic
987249974 5:16089996-16090018 CATGCATCAGAACCTCAGAGGGG + Intronic
988702064 5:33685404-33685426 CCTGCCTCAGACCCTGAGTTGGG + Intronic
989741891 5:44783539-44783561 CCTGATCCAGACCCCAAGTGAGG + Intergenic
996351146 5:122543164-122543186 CCTGATCCAGACCCCCAGAGGGG - Intergenic
996953953 5:129161615-129161637 CCTGCTTAATACTCTCAGTGAGG + Intergenic
998545367 5:143023086-143023108 CCAGGGTCAGACCCTTAGTGTGG + Intronic
999950314 5:156642345-156642367 CCTGCTTAAAACCTTCACTGTGG + Intronic
1000240346 5:159403086-159403108 CCTGCTTGAGACATGCAGTGTGG - Intergenic
1001292706 5:170475452-170475474 CCTGCTGCAGACCCACTGAGAGG + Intronic
1002410372 5:179069950-179069972 CCTACTTCAGACTTTCAGTCAGG + Intronic
1003082049 6:3028659-3028681 CCAGCTGCAGACCCTTAGGGTGG - Intergenic
1003147536 6:3521296-3521318 CCTGCTTCAGACACTGCCTGTGG - Intergenic
1004744126 6:18492966-18492988 CCTGTCTCAGACTCTCAGTCAGG - Intergenic
1005312113 6:24568781-24568803 CCTTCTTCACAGCCACAGTGAGG + Exonic
1008928150 6:56909089-56909111 CCTGATTGAGACCCCCAGAGAGG - Intronic
1010234684 6:73565504-73565526 CCTGATCCAGACCCTTAGAGAGG - Intergenic
1011018728 6:82787412-82787434 CCAGCTTCTGACCCTCAGGTGGG + Intergenic
1015483473 6:133741836-133741858 CCTGCCTCTCACCCTCAGAGGGG + Intergenic
1015570660 6:134618076-134618098 CATGGGTCAGACCCTAAGTGAGG + Intergenic
1016293272 6:142546952-142546974 CCAACTGTAGACCCTCAGTGGGG + Intergenic
1016809786 6:148248847-148248869 CCTTCTTCTGACAATCAGTGAGG + Intergenic
1018865331 6:167742865-167742887 CCTGCTTCACACCAACAGAGTGG + Intergenic
1018908268 6:168087748-168087770 CCTGCTTCAGCCCCTCTTTAAGG - Intergenic
1019094305 6:169566405-169566427 CCTGCCACAGACCCTGAGAGTGG + Intronic
1020207494 7:6130416-6130438 CCTGCCTCTGACCCTCACCGGGG + Intronic
1021583322 7:22180072-22180094 CCTGATTCAGACCCCAAGAGAGG - Intronic
1021734209 7:23627267-23627289 CCTGCCTCAGTCCCCCAGAGTGG - Intronic
1022514682 7:30967992-30968014 CCATCTTCAGACCAGCAGTGTGG + Intronic
1025101096 7:56135897-56135919 CCTGCTGCAAAACCTCAGTGTGG - Intergenic
1025120176 7:56295180-56295202 CCTGCTTCAGGCTCTCCGGGTGG + Intergenic
1026227295 7:68453483-68453505 CCTGATTCAGACCCCAAGAGAGG + Intergenic
1026227400 7:68454674-68454696 CCTGATTCAGACCCCAAGAGAGG - Intergenic
1026317765 7:69241941-69241963 CCTGCTGCAAAACCTCAGTGTGG - Intergenic
1026318254 7:69246168-69246190 CCTGCTGCAAAACCTCGGTGTGG + Intergenic
1026562306 7:71460549-71460571 CCTGATTCAGACCCCAAGAGAGG + Intronic
1029586505 7:101475484-101475506 CCTGCTTCTCTCCATCAGTGGGG - Intronic
1029700490 7:102243551-102243573 CCTGCTTCAGCCTCCCAATGTGG - Intronic
1035174959 7:157044011-157044033 CCTAATTCAGAACCCCAGTGGGG - Intergenic
1036946133 8:13096579-13096601 CATGCTTCAGATTCTCGGTGGGG - Intronic
1038775028 8:30521548-30521570 CCTGCTTCTCTCCCTCAGTTAGG + Intronic
1040378552 8:46850039-46850061 CCTGCTTCATAACCACAGAGGGG + Intergenic
1041257433 8:55991243-55991265 CCTGTTTCACACCAGCAGTGGGG + Intronic
1044363039 8:91310468-91310490 CAAGCTCCAGATCCTCAGTGAGG - Intronic
1045484732 8:102622159-102622181 CCAGCTTCACAGCCCCAGTGTGG + Intergenic
1047209490 8:122829944-122829966 CATGCTTCCGTCCCTCAATGTGG - Intronic
1048966116 8:139615932-139615954 CCTGCTGCATGCCCCCAGTGGGG + Intronic
1049018114 8:139935954-139935976 CCTGCTCCAGTCCCACAATGGGG + Intronic
1052292501 9:26859159-26859181 CCTCCTTGAGAACCTGAGTGTGG + Intronic
1052988123 9:34502540-34502562 CCTGCTTCCGAACCTGGGTGCGG - Intronic
1053527269 9:38842815-38842837 CTTGCTTCAGTCCATCAGTGTGG - Intergenic
1054199492 9:62067246-62067268 CTTGCTTCAGTCCATCAGTGTGG - Intergenic
1054638863 9:67521111-67521133 CTTGCTTCAGTCCATCAGTGTGG + Intergenic
1056759332 9:89404262-89404284 CCTGGAGCAGACGCTCAGTGGGG + Intronic
1057126450 9:92619661-92619683 CCTGCCTCAGAACCTGAGGGTGG + Exonic
1057135186 9:92682464-92682486 CCTGCATCTTACCCTGAGTGAGG + Intergenic
1059280145 9:113125929-113125951 CCTTCTTCAGTCCTTCAGTGAGG + Intergenic
1059438221 9:114288992-114289014 CCTGCCTCCCACCCTGAGTGGGG + Intronic
1059723931 9:116987408-116987430 CCTGCTCCAGACTCTCAGCCAGG + Intronic
1060519001 9:124283309-124283331 CCTGCGACGGAGCCTCAGTGGGG + Intronic
1061779034 9:132984978-132985000 GCTGCTTCAGAACAGCAGTGAGG - Intronic
1062211221 9:135365363-135365385 CATGCCTCAGACCCTCCCTGGGG + Intergenic
1062282935 9:135760015-135760037 CCCGCCGTAGACCCTCAGTGGGG - Intronic
1187306661 X:18101291-18101313 CCTGATTCAGACCCTAAGAGAGG - Intergenic
1190089054 X:47421595-47421617 CCTGCTTCAGAGCCCTGGTGTGG + Intergenic
1190463174 X:50699043-50699065 CCTGAATCAGACCTTCAGGGTGG + Intronic
1195005353 X:100680332-100680354 CATGCTACATACCCTCATTGGGG + Intronic
1198222200 X:134612963-134612985 GATGCTTCAGAGCCTCAGAGGGG + Intronic
1198226665 X:134651813-134651835 CCTGCCTGAGACCCTCAGGCTGG + Intronic
1199684695 X:150255724-150255746 CATGCTACAGACCTTCTGTGAGG - Intergenic
1202304853 Y:23458267-23458289 CCTGATTCAGACCCCAAGAGAGG + Intergenic
1202388366 Y:24345783-24345805 CCTCCTTCAGCCTCACAGTGGGG + Intergenic
1202482421 Y:25324345-25324367 CCTCCTTCAGCCTCACAGTGGGG - Intergenic
1202565957 Y:26212324-26212346 CCTGATTCAGACCCCAAGAGAGG - Intergenic