ID: 1132737379

View in Genome Browser
Species Human (GRCh38)
Location 16:1393678-1393700
Sequence GGGGTCTGTCCGCCCCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1454
Summary {0: 1, 1: 1, 2: 0, 3: 65, 4: 1387}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132737379_1132737389 7 Left 1132737379 16:1393678-1393700 CCGAGCTGGGGCGGACAGACCCC 0: 1
1: 1
2: 0
3: 65
4: 1387
Right 1132737389 16:1393708-1393730 CACAAGGGAGGTGGTGCTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 222
1132737379_1132737386 -2 Left 1132737379 16:1393678-1393700 CCGAGCTGGGGCGGACAGACCCC 0: 1
1: 1
2: 0
3: 65
4: 1387
Right 1132737386 16:1393699-1393721 CCCTCTCTCCACAAGGGAGGTGG 0: 1
1: 0
2: 3
3: 24
4: 273
1132737379_1132737380 -9 Left 1132737379 16:1393678-1393700 CCGAGCTGGGGCGGACAGACCCC 0: 1
1: 1
2: 0
3: 65
4: 1387
Right 1132737380 16:1393692-1393714 ACAGACCCCCTCTCTCCACAAGG 0: 1
1: 0
2: 2
3: 17
4: 228
1132737379_1132737395 27 Left 1132737379 16:1393678-1393700 CCGAGCTGGGGCGGACAGACCCC 0: 1
1: 1
2: 0
3: 65
4: 1387
Right 1132737395 16:1393728-1393750 TGGGTGGGTGCCTGGCAAGATGG 0: 1
1: 0
2: 3
3: 62
4: 674
1132737379_1132737381 -8 Left 1132737379 16:1393678-1393700 CCGAGCTGGGGCGGACAGACCCC 0: 1
1: 1
2: 0
3: 65
4: 1387
Right 1132737381 16:1393693-1393715 CAGACCCCCTCTCTCCACAAGGG 0: 1
1: 0
2: 1
3: 16
4: 236
1132737379_1132737382 -5 Left 1132737379 16:1393678-1393700 CCGAGCTGGGGCGGACAGACCCC 0: 1
1: 1
2: 0
3: 65
4: 1387
Right 1132737382 16:1393696-1393718 ACCCCCTCTCTCCACAAGGGAGG 0: 1
1: 0
2: 0
3: 14
4: 197
1132737379_1132737390 8 Left 1132737379 16:1393678-1393700 CCGAGCTGGGGCGGACAGACCCC 0: 1
1: 1
2: 0
3: 65
4: 1387
Right 1132737390 16:1393709-1393731 ACAAGGGAGGTGGTGCTCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 185
1132737379_1132737392 12 Left 1132737379 16:1393678-1393700 CCGAGCTGGGGCGGACAGACCCC 0: 1
1: 1
2: 0
3: 65
4: 1387
Right 1132737392 16:1393713-1393735 GGGAGGTGGTGCTCCTGGGTGGG 0: 1
1: 0
2: 20
3: 45
4: 387
1132737379_1132737393 19 Left 1132737379 16:1393678-1393700 CCGAGCTGGGGCGGACAGACCCC 0: 1
1: 1
2: 0
3: 65
4: 1387
Right 1132737393 16:1393720-1393742 GGTGCTCCTGGGTGGGTGCCTGG 0: 1
1: 0
2: 4
3: 46
4: 420
1132737379_1132737391 11 Left 1132737379 16:1393678-1393700 CCGAGCTGGGGCGGACAGACCCC 0: 1
1: 1
2: 0
3: 65
4: 1387
Right 1132737391 16:1393712-1393734 AGGGAGGTGGTGCTCCTGGGTGG 0: 1
1: 0
2: 7
3: 49
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132737379 Original CRISPR GGGGTCTGTCCGCCCCAGCT CGG (reversed) Intronic