ID: 1132738009

View in Genome Browser
Species Human (GRCh38)
Location 16:1397049-1397071
Sequence TCCCGACCTGTGCCAGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132738004_1132738009 -10 Left 1132738004 16:1397036-1397058 CCACCCCCAGGCTTCCCGACCTG 0: 1
1: 0
2: 0
3: 35
4: 399
Right 1132738009 16:1397049-1397071 TCCCGACCTGTGCCAGCCCTCGG 0: 1
1: 0
2: 2
3: 18
4: 189
1132738001_1132738009 1 Left 1132738001 16:1397025-1397047 CCCTCATGCCTCCACCCCCAGGC 0: 1
1: 0
2: 2
3: 71
4: 630
Right 1132738009 16:1397049-1397071 TCCCGACCTGTGCCAGCCCTCGG 0: 1
1: 0
2: 2
3: 18
4: 189
1132738003_1132738009 -7 Left 1132738003 16:1397033-1397055 CCTCCACCCCCAGGCTTCCCGAC 0: 1
1: 0
2: 9
3: 79
4: 603
Right 1132738009 16:1397049-1397071 TCCCGACCTGTGCCAGCCCTCGG 0: 1
1: 0
2: 2
3: 18
4: 189
1132738002_1132738009 0 Left 1132738002 16:1397026-1397048 CCTCATGCCTCCACCCCCAGGCT 0: 1
1: 0
2: 4
3: 93
4: 705
Right 1132738009 16:1397049-1397071 TCCCGACCTGTGCCAGCCCTCGG 0: 1
1: 0
2: 2
3: 18
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132738009 Original CRISPR TCCCGACCTGTGCCAGCCCT CGG Intronic
900100710 1:960894-960916 TCCCGACCTCCCCCGGCCCTCGG - Intronic
900408760 1:2503666-2503688 TCCCGTGCTGTCCCAGCCCAAGG + Intronic
900555137 1:3276564-3276586 CCCCGAGCTGTCCCAGCCCATGG + Intronic
900598627 1:3493677-3493699 GCCCTACCTGTGCCAGTCCTGGG - Intronic
900915152 1:5632374-5632396 TCCCTCCCTGTGCCAGCACTGGG + Intergenic
901226814 1:7617934-7617956 TGTCGATCTGTGCCAGGCCTTGG - Intronic
902871327 1:19315344-19315366 TCCCTGCCTGTGCCAGGCCCTGG + Intronic
903420666 1:23216503-23216525 TCCCGAACTTTCCCAGACCTGGG + Intergenic
903650821 1:24921071-24921093 GACCATCCTGTGCCAGCCCTGGG - Intronic
904324948 1:29722275-29722297 TCCAGACCCCTGCCTGCCCTGGG - Intergenic
905590761 1:39161259-39161281 TCCAGACCTGTGCCATGACTGGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907248185 1:53121187-53121209 CCCAGGCCTGTGCCAGACCTTGG - Intronic
909323323 1:74317776-74317798 CCTGGACCTGTGTCAGCCCTGGG + Intronic
912008689 1:104933518-104933540 TCCCGCCCTCTGCCAGCACGGGG + Intergenic
912498705 1:110107683-110107705 TGCCGACCTGTGCAAGCAGTGGG + Intergenic
916100513 1:161390003-161390025 TCCGGACCTCTGCGAGCCGTGGG + Intergenic
916484644 1:165247979-165248001 TCCCAGCCTGTGCTAGACCTGGG + Intronic
916571624 1:166033087-166033109 ACCCGGACTCTGCCAGCCCTAGG + Intergenic
919641149 1:200045264-200045286 TCCCAAACTGTGCCAGGCCATGG - Intronic
920192236 1:204201104-204201126 GCCAGGCCTGTGTCAGCCCTGGG - Intronic
920586623 1:207170145-207170167 TCCAGAACTGTCCCAGCCCGTGG - Intergenic
921750999 1:218794324-218794346 TCCCGACCTGTCCAAGCCTTAGG - Intergenic
922022951 1:221722510-221722532 TCCTAACATGGGCCAGCCCTGGG - Intronic
922485951 1:225973100-225973122 TCCCCACCTAAGCCAGCCCTGGG + Intergenic
1069703152 10:70440802-70440824 TCGCGAACTGTGGCAGCCTTGGG - Intronic
1071502972 10:86216669-86216691 TCCCTTCCTTTGCCAGCCCCAGG - Intronic
1072696736 10:97609474-97609496 TCCTCTCCTGTGCCAGCTCTGGG + Intronic
1072915031 10:99532662-99532684 TCCCGACCTAGGCCAGTTCTGGG - Intergenic
1074198248 10:111208067-111208089 TCCCTACCTCTGACAGCCCCAGG + Intergenic
1074729612 10:116355802-116355824 CCCCTAACTCTGCCAGCCCTAGG - Intronic
1075446808 10:122518968-122518990 TCCTGACCTGTCCCAGACATGGG - Intergenic
1077061084 11:618173-618195 TGCCAACCTGTGCCAGGCTTGGG + Intronic
1077221566 11:1420323-1420345 TCCCAACCTGTGCACGCCCTTGG + Intronic
1078066380 11:8081642-8081664 TCCCCACCTATCCCAGCACTGGG + Intronic
1078093788 11:8284014-8284036 TGCAGACCTGTGCGGGCCCTGGG - Intergenic
1078519859 11:12054054-12054076 CACAGACCTGTGCCACCCCTGGG + Intergenic
1078866543 11:15302882-15302904 TGCAGACTTTTGCCAGCCCTGGG + Intergenic
1081771044 11:45650800-45650822 GCCCGGCCTCTGCCAGCCCGGGG + Exonic
1083827424 11:65211473-65211495 CCCCTGCCTGTGCCAGCCATGGG + Exonic
1084035434 11:66507087-66507109 TCCAGCCCTGTGCGAGCCATGGG + Intronic
1084226044 11:67715439-67715461 TGCGGCCCTGTGCCCGCCCTGGG + Intergenic
1084430022 11:69105877-69105899 TCCCTACCTCTGCCAGCCCGGGG + Intergenic
1084609239 11:70191695-70191717 TTTCGACCTGTGGCAGGCCTCGG + Intergenic
1084968429 11:72756422-72756444 ACCCACCCTGGGCCAGCCCTGGG + Intronic
1089615530 11:119692636-119692658 TGCTGATCTGTGCCAGGCCTGGG + Intronic
1098298293 12:69027133-69027155 TCCCGTCTTGTCCCAGCCCCTGG - Intergenic
1102453613 12:113057879-113057901 TCCCTACCTGAGCCAGCCGAGGG + Exonic
1103164037 12:118754854-118754876 TCAGGACCTGTGCCAGCACATGG + Intergenic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1104472039 12:129037016-129037038 TCCCCACCTCTGCCATCCCATGG - Intergenic
1107878854 13:44815654-44815676 TCCCCACCTGTGTCCCCCCTGGG + Intergenic
1110228494 13:73144230-73144252 TCCTGTCCTGTGCCAGCGCCTGG - Intergenic
1111037046 13:82689557-82689579 TTCCAAGCTGTGCCAGCACTGGG - Intergenic
1112278979 13:98046150-98046172 CCCCCACCTCTGCCAGCCCATGG - Intergenic
1117081201 14:52153843-52153865 TCCCAATCCCTGCCAGCCCTGGG - Intergenic
1118101057 14:62602808-62602830 TCCCCACCTGTCCCAGACCCTGG - Intergenic
1120521143 14:85529839-85529861 TCCGGACCAGACCCAGCCCTCGG - Intergenic
1122602604 14:102929083-102929105 TCCCCACCGGAGCCAGCCCGAGG - Intronic
1122876066 14:104665952-104665974 ACCAGCCCGGTGCCAGCCCTCGG - Intergenic
1123056707 14:105574263-105574285 TCCCGACCGGCCGCAGCCCTTGG - Intergenic
1123081502 14:105697522-105697544 TCCCGACCGGCCGCAGCCCTCGG + Intergenic
1124071458 15:26396785-26396807 ACCCCACCTGTGCCAGCCCCTGG + Intergenic
1125608003 15:40953155-40953177 GCCCGCCCGGTGCCCGCCCTGGG + Exonic
1125727419 15:41875169-41875191 TCCCCACCACTGCCAACCCTCGG + Intronic
1127275571 15:57440564-57440586 TCTTGCCCTGTGCCAGCCGTTGG + Intronic
1128311160 15:66632436-66632458 TCCAGACCTGCCCCAGCTCTTGG + Intronic
1129412201 15:75356249-75356271 TTCCGAACTGGGCCTGCCCTCGG - Exonic
1129844305 15:78761222-78761244 TCTCTACCTGTGCCAGCTCCTGG - Intronic
1129869510 15:78931685-78931707 TCCCGACATGTGCCAGCTGCTGG - Intronic
1130068456 15:80626642-80626664 TCCTGCCCTGTGCAGGCCCTGGG + Intergenic
1130527321 15:84718378-84718400 TCCCCAACTCTCCCAGCCCTAGG - Intergenic
1131110058 15:89759299-89759321 TCCAGCCCAGTGCCAGACCTCGG - Intergenic
1131526746 15:93158773-93158795 CCCCGCCCTGCCCCAGCCCTGGG - Intergenic
1132476751 16:143129-143151 TCCCAGCCTGGGCCTGCCCTTGG + Intergenic
1132738009 16:1397049-1397071 TCCCGACCTGTGCCAGCCCTCGG + Intronic
1134629703 16:15748017-15748039 GCCCTACCTGGGCCAGACCTTGG + Intronic
1137608390 16:49802296-49802318 TCCCTCCCTGTGCCAGCCCCAGG + Intronic
1138423080 16:56912525-56912547 TCCAGCCCTGTGCCAGCCTGTGG - Intronic
1141087798 16:81109096-81109118 CCCCGCCCCGTGCCATCCCTTGG - Intergenic
1141521089 16:84580097-84580119 TCCAGACCAGTGCCAGCCCTTGG - Intronic
1142892031 17:2949986-2950008 TCACCAACTGTGCCAGCCCCAGG + Intronic
1146638091 17:34520774-34520796 TACCAGACTGTGCCAGCCCTGGG - Intergenic
1146826562 17:36028384-36028406 CCCTCACCTCTGCCAGCCCTTGG - Intergenic
1146884186 17:36459977-36459999 TCCCTTCCTTTGCCAGCCCTGGG + Intergenic
1147133414 17:38421759-38421781 TCTGGCCCTGAGCCAGCCCTGGG - Intergenic
1147668909 17:42165535-42165557 TCAGGACCTCAGCCAGCCCTCGG + Exonic
1151886180 17:76924490-76924512 TCGCGGCCTCAGCCAGCCCTGGG + Intronic
1151902882 17:77028692-77028714 TTTCGCCCTCTGCCAGCCCTTGG - Intergenic
1152758229 17:82096020-82096042 GCCCTGCCTGGGCCAGCCCTCGG + Intronic
1160511980 18:79457901-79457923 TCCCGACCTGTGCCAACGAGGGG - Intronic
1161577698 19:5064022-5064044 TCCCGGCCTGTGCCAGCCACAGG + Intronic
1161672770 19:5623409-5623431 ACCCACCCTGTGCCCGCCCTCGG - Intronic
1163756553 19:19109912-19109934 CCCCGACCTGCGCCCTCCCTGGG - Intronic
1164753598 19:30673493-30673515 TCCCGCCCTGTGCCTGCCACGGG + Intronic
1165318539 19:35072355-35072377 TCCCGAGCTGTTCCAGCCCCAGG - Intergenic
1165961590 19:39539696-39539718 TCTGGACCTGGGCCTGCCCTCGG + Exonic
1166685390 19:44793458-44793480 TCCCGACCTCCCCCAGCACTCGG + Exonic
1167314761 19:48756825-48756847 TCCGGCTCTGTCCCAGCCCTGGG - Intronic
1167705652 19:51079495-51079517 CCCAGGCCTGTGCCAGCCCCGGG - Exonic
1168332933 19:55580310-55580332 CCCCGACCTCTCCCAGCCCCTGG - Intronic
925866451 2:8232206-8232228 CCCAGACCTATGCCAGCTCTAGG + Intergenic
927614081 2:24572217-24572239 TACCCACCTGTCCCAGGCCTAGG - Intronic
927997771 2:27498206-27498228 TCCCAACCTGAGCCAGGCCCTGG + Intronic
936242842 2:110802717-110802739 TCCCTACCTTTCCCAGCCCCTGG - Intronic
936514271 2:113172119-113172141 CCCCAACATTTGCCAGCCCTGGG + Intronic
937026184 2:118699646-118699668 TCCAGGCCTCTGTCAGCCCTGGG - Intergenic
937230890 2:120397573-120397595 GCCTGACCTAGGCCAGCCCTTGG + Intergenic
938712464 2:133987337-133987359 TCCTGTCCTCTGCCAGCCGTTGG - Intergenic
941112313 2:161428221-161428243 TCCCCAACTGTGACAGCCCCGGG - Intronic
942312355 2:174667466-174667488 TCTGGACCTCTTCCAGCCCTAGG + Intronic
944901290 2:204219279-204219301 TACAGACCTGTGCCAGTCCATGG - Intergenic
945234945 2:207625216-207625238 GCCCGGCCTGGGCGAGCCCTGGG - Exonic
945925841 2:215803683-215803705 TCCCCACCCCTTCCAGCCCTAGG - Intergenic
947604799 2:231479011-231479033 TCCTGCCCTGTGCCAGGCATCGG - Intronic
948005370 2:234603823-234603845 TCCAGGCCTGGGCCAGCCCTGGG - Intergenic
948759170 2:240179837-240179859 GCCCCACCTGTGCCAGCCCTAGG + Intergenic
948894596 2:240922312-240922334 TCCCCTCCTCTGCCAGCCGTGGG + Intronic
949048009 2:241881108-241881130 TCCTGACCTGTGTCGGCGCTGGG + Intergenic
1169131489 20:3168250-3168272 CCCCGGCCTCAGCCAGCCCTGGG - Intronic
1172619536 20:36309827-36309849 TCCAGCCCTGTGCCAGGCTTGGG + Intronic
1173182436 20:40815325-40815347 TCCCTCCTTGTGCCAGCCCTAGG + Intergenic
1175497031 20:59422410-59422432 CCCCAACCTGGGCCAGCCTTTGG + Intergenic
1179784672 21:43722643-43722665 TCCCGGCCTCTTCCAGCTCTCGG + Intronic
1179902165 21:44399936-44399958 TCCTGGGCTGTGCCAGGCCTAGG + Intronic
1180052202 21:45336308-45336330 CCCCAGCCTGTGCCAGCCCCAGG + Intergenic
1180198876 21:46213160-46213182 TCCAGGCCAGTGCCAGGCCTCGG - Intronic
1180955420 22:19739185-19739207 TCCCTACCCGTGCCCGCCCCAGG - Intergenic
1183233187 22:36595874-36595896 GCCAGAGCTGTGCCAGCCCACGG - Intronic
1183286394 22:36967016-36967038 TCCCAACCTCAGCCAGCCCTAGG - Intergenic
1183832510 22:40425853-40425875 CCCTGGCCTGTACCAGCCCTGGG - Intronic
1184787755 22:46680087-46680109 CTTCGCCCTGTGCCAGCCCTGGG - Intergenic
1185165291 22:49258220-49258242 TCCCGGCCTGAGCCAGCCCGGGG - Intergenic
953530452 3:43735730-43735752 TCCACCCCTATGCCAGCCCTGGG + Intergenic
953976466 3:47385345-47385367 GCCTGTCATGTGCCAGCCCTGGG + Intronic
954370982 3:50169505-50169527 TCCCAACCTGTGCCCAGCCTGGG + Intronic
954471526 3:50700432-50700454 TCCCTACCTTTTCCAGCCTTTGG + Intronic
955991710 3:64634716-64634738 ACCCGAGCTGTTTCAGCCCTGGG - Intronic
958708640 3:97689807-97689829 TCCCGCTCTTTCCCAGCCCTAGG + Intronic
960698734 3:120420117-120420139 CCTCACCCTGTGCCAGCCCTTGG - Intronic
961332679 3:126152185-126152207 TCCCCACCTCTGTCAGCCTTTGG - Intronic
961575951 3:127836666-127836688 TCAGGCCCTGGGCCAGCCCTAGG - Intergenic
962516343 3:136155625-136155647 TCCCAACCTGTGCCGCCCATGGG + Intronic
965752930 3:171995846-171995868 TCCCTTCCTCTGCCAGCTCTGGG - Intergenic
965773926 3:172209243-172209265 TCCCGCCCTCTGCCAGCACTAGG - Intronic
966876196 3:184323203-184323225 TCCCCACCTGGCCCACCCCTTGG - Exonic
969725452 4:8915658-8915680 TCCCCTCCTCTGCCAGCCCCAGG - Intergenic
972371231 4:38425028-38425050 TCCAAAGCTGTCCCAGCCCTTGG + Intergenic
973290305 4:48464324-48464346 TCCCCACCTGTGTATGCCCTGGG + Intergenic
977908115 4:102501032-102501054 TCCCTACCGGCTCCAGCCCTTGG + Intergenic
978330473 4:107607785-107607807 CCCGGACCTGTACCAGCACTGGG - Intronic
978516575 4:109575037-109575059 TTCTGACCTGCGGCAGCCCTGGG - Intronic
979724314 4:123942381-123942403 TCCCACCCTCTGCCAGCACTGGG + Intergenic
983779891 4:171655453-171655475 TCCCATCCTCTGCCAGCCCCTGG + Intergenic
983934397 4:173490925-173490947 TCCCGTCCTCTCCCTGCCCTGGG + Intergenic
985671745 5:1210342-1210364 CCACACCCTGTGCCAGCCCTGGG + Intronic
986436147 5:7733477-7733499 CCCCAACCTGTGCCTGCCCCAGG - Intronic
990943861 5:61230124-61230146 TCCCAACCTGTGCCTCCCCCAGG + Intergenic
991620449 5:68539657-68539679 TTTCGTCCTGTGCCAGTCCTGGG + Intergenic
991640934 5:68751720-68751742 TCCGGACCTGTGCTAGGCATTGG + Intergenic
992195331 5:74333587-74333609 TCCCAACCCCTGCCAACCCTAGG + Intergenic
994713595 5:103295870-103295892 TCACCACTTGTGCCAACCCTGGG - Intergenic
997588907 5:135061129-135061151 CCTCTACCTGTCCCAGCCCTGGG + Intronic
998381541 5:141729524-141729546 TCCTGACCAGAGCCAGGCCTGGG - Intergenic
999664750 5:153901227-153901249 TCCCCAACTCTGTCAGCCCTGGG - Intergenic
1001907740 5:175487071-175487093 TACCCTCCTGTGCCTGCCCTCGG - Intronic
1001908101 5:175489887-175489909 TACCCTCCTGTGCCTGCCCTCGG + Intronic
1003451497 6:6237802-6237824 TCCCACTCTGTGCTAGCCCTGGG - Intronic
1003674480 6:8190491-8190513 CCCCACCCTCTGCCAGCCCTAGG + Intergenic
1005885463 6:30094160-30094182 TCCCTCTCAGTGCCAGCCCTAGG - Intergenic
1007978787 6:46129609-46129631 TCCAGACTTGTGCCGGACCTTGG + Intergenic
1010563867 6:77384521-77384543 TCCCGTCCCCTTCCAGCCCTTGG - Intergenic
1010714991 6:79218151-79218173 TCTCACCCTGTACCAGCCCTAGG + Intronic
1013022843 6:106236001-106236023 TCCTGACCTGGCCCAGACCTTGG + Intronic
1013046218 6:106488494-106488516 TACCCACATGTGCCTGCCCTTGG - Intergenic
1017053511 6:150417093-150417115 TCCCTTCCTGCTCCAGCCCTTGG - Intergenic
1017241312 6:152172153-152172175 TCCCCACTTCTCCCAGCCCTGGG - Intronic
1019442556 7:1054834-1054856 TTCCGACCTGAACCTGCCCTCGG + Intronic
1020139868 7:5606359-5606381 TCCCGTCCAGCCCCAGCCCTGGG + Exonic
1022476451 7:30713735-30713757 TCCCTAACTGCGCCAGCCCTCGG + Intronic
1022543357 7:31160343-31160365 TCCAGACCTGGGGCAGCCCCTGG + Intergenic
1023104118 7:36746944-36746966 TCCAGTCCTGTGCCTTCCCTAGG - Intergenic
1024219140 7:47274038-47274060 CCCCGACCAGAGCCAGCCCTGGG - Intergenic
1026968551 7:74454604-74454626 TCCCGGTCTGGGCCAGCCCCTGG + Intronic
1029371740 7:100154924-100154946 TCCCGGGCTGTGCCTCCCCTGGG - Exonic
1030348003 7:108455479-108455501 CCCCGACAAGTCCCAGCCCTCGG + Intronic
1035220012 7:157400872-157400894 TCCCCACCCTGGCCAGCCCTTGG + Intronic
1035287641 7:157816418-157816440 GCTCGGCCTCTGCCAGCCCTTGG - Intronic
1035988165 8:4457377-4457399 TCCCTTCCTGTTCCAGACCTCGG - Intronic
1036046941 8:5153434-5153456 TCCCTGCCTTTGCCAGCCTTTGG - Intergenic
1036739486 8:11347795-11347817 CCCCGACCTCGGCCGGCCCTGGG - Intergenic
1041102076 8:54406407-54406429 TCCCCAACTCTCCCAGCCCTAGG - Intergenic
1048182909 8:132212848-132212870 TCCAGGCCTGAGCCATCCCTGGG + Intronic
1049195695 8:141314524-141314546 TCCCCACATGGGCCCGCCCTGGG + Intergenic
1049220117 8:141425229-141425251 GCCCCTCCTGTGGCAGCCCTGGG + Intronic
1049411794 8:142476902-142476924 GGCCGGCCTGTGCCATCCCTGGG - Intronic
1049693942 8:143974595-143974617 TCCTGACCTGTTCCAGCCGGAGG - Intronic
1051674887 9:19548803-19548825 TCCCGCCAAGGGCCAGCCCTGGG + Intronic
1053469557 9:38336472-38336494 TCCCTCCCTTTGGCAGCCCTGGG - Intergenic
1054735612 9:68746939-68746961 ACCAGACCTGTCCCTGCCCTTGG + Intronic
1057144658 9:92749714-92749736 TGGGGACCTTTGCCAGCCCTGGG - Intronic
1058670839 9:107359330-107359352 GGGCCACCTGTGCCAGCCCTGGG - Intergenic
1060996465 9:127877120-127877142 TCCTGACCAGGGCCAGCGCTTGG - Intronic
1062104510 9:134746206-134746228 TCCCGAGCTGGGCCTGCCCAGGG + Intronic
1062537252 9:137026505-137026527 TCCCCACCTGCTCCAGCCATGGG + Intronic
1188324796 X:28787980-28788002 CCCCATCCTGTCCCAGCCCTTGG - Intronic
1190285816 X:48960742-48960764 TTCCATCATGTGCCAGCCCTAGG - Intergenic
1190304874 X:49076231-49076253 TCCGGACCTGCCCCACCCCTGGG - Intronic
1190357235 X:49617159-49617181 ACCCCACCTCTTCCAGCCCTAGG - Intergenic
1200145870 X:153926352-153926374 TCGCGGGCAGTGCCAGCCCTGGG - Intronic