ID: 1132738073

View in Genome Browser
Species Human (GRCh38)
Location 16:1397296-1397318
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 5, 1: 0, 2: 6, 3: 55, 4: 469}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132738055_1132738073 18 Left 1132738055 16:1397255-1397277 CCCACTCATCCCCGTGCTTCACA 0: 1
1: 0
2: 1
3: 12
4: 122
Right 1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG 0: 5
1: 0
2: 6
3: 55
4: 469
1132738061_1132738073 8 Left 1132738061 16:1397265-1397287 CCCGTGCTTCACACTGGGGCAGG 0: 1
1: 6
2: 1
3: 20
4: 215
Right 1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG 0: 5
1: 0
2: 6
3: 55
4: 469
1132738063_1132738073 7 Left 1132738063 16:1397266-1397288 CCGTGCTTCACACTGGGGCAGGG 0: 1
1: 6
2: 0
3: 26
4: 238
Right 1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG 0: 5
1: 0
2: 6
3: 55
4: 469
1132738054_1132738073 19 Left 1132738054 16:1397254-1397276 CCCCACTCATCCCCGTGCTTCAC 0: 1
1: 1
2: 1
3: 8
4: 180
Right 1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG 0: 5
1: 0
2: 6
3: 55
4: 469
1132738056_1132738073 17 Left 1132738056 16:1397256-1397278 CCACTCATCCCCGTGCTTCACAC 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG 0: 5
1: 0
2: 6
3: 55
4: 469
1132738060_1132738073 9 Left 1132738060 16:1397264-1397286 CCCCGTGCTTCACACTGGGGCAG 0: 1
1: 6
2: 0
3: 9
4: 134
Right 1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG 0: 5
1: 0
2: 6
3: 55
4: 469
1132738053_1132738073 20 Left 1132738053 16:1397253-1397275 CCCCCACTCATCCCCGTGCTTCA 0: 1
1: 0
2: 2
3: 24
4: 259
Right 1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG 0: 5
1: 0
2: 6
3: 55
4: 469
1132738052_1132738073 21 Left 1132738052 16:1397252-1397274 CCCCCCACTCATCCCCGTGCTTC 0: 1
1: 0
2: 0
3: 25
4: 319
Right 1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG 0: 5
1: 0
2: 6
3: 55
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900120498 1:1046730-1046752 CTGGGGGTGAGCAGGGATCAAGG + Exonic
900252906 1:1680677-1680699 CTGGGGGTGAGGACGGTTCATGG - Intronic
900945098 1:5826610-5826632 CTGGGGAGGAGGGGGTGTGGGGG + Intergenic
901129533 1:6953622-6953644 CTGGGCATAAGGAGGTGACAAGG - Intronic
901878697 1:12181507-12181529 CGGGGGATTTGGGGGTGTCATGG - Intronic
902150256 1:14437229-14437251 GTGGGGATGAGTGGGAGTCAGGG - Intergenic
902535864 1:17119044-17119066 CTGGGGCTGAGGCTGTGTTAGGG + Intronic
902641182 1:17767324-17767346 CGGGGGATGAGGCGGAGGCAGGG + Intronic
903966193 1:27091467-27091489 TTGGTGATGAGCAGGTGTAAGGG + Intergenic
903998364 1:27322414-27322436 CTGGGGACGAGGAGGGCCCAGGG + Intronic
904529745 1:31160564-31160586 ATGGGGATCGGGAGGTTTCAAGG - Intergenic
905221728 1:36452458-36452480 CTGGGGGAGAGGAGGTGGCCAGG - Intergenic
905263679 1:36736589-36736611 CTGGGGGAGGGGAGGTGACAAGG + Intergenic
905465828 1:38152414-38152436 CTAGGGATGAGAAGGAGTAAAGG + Intergenic
906151059 1:43588075-43588097 CTGGGGAGGGGCAGGGGTCAGGG - Intronic
906519447 1:46458587-46458609 CTGGGGATGCTGAGGAGTCATGG - Intergenic
906612100 1:47210654-47210676 TTGGGGCTGATGAGGTCTCAGGG - Intergenic
906675179 1:47688264-47688286 CAGGGGATGAGGAGAGGCCAGGG - Intergenic
911743823 1:101417245-101417267 TTGGGGAAGAGGTGGTGTGATGG - Intergenic
912040411 1:105383278-105383300 TTGGGGCTGAGGAGGTTTCCAGG - Intergenic
912496403 1:110094819-110094841 GTGGGGATGTGGAGGAGTCCTGG + Intergenic
912608273 1:111015527-111015549 GTGGGGAGGAAGAAGTGTCATGG - Intergenic
912895500 1:113583632-113583654 CTGGGGATTAGGAGGTTCGAGGG - Intronic
913266332 1:117048748-117048770 CTGCAGAGGAGGAGGTGTCAAGG - Intergenic
914913271 1:151803105-151803127 CTTGGGAAGAGCAGGTATCAGGG - Intronic
915065480 1:153221017-153221039 GTGAGGATGAGGAGGTGTGGAGG - Intergenic
915314368 1:155019628-155019650 CTGGGGAAGAGGAGGGGCTAAGG - Intronic
915325000 1:155077276-155077298 CTGGGGATGAGGAGCCTGCAGGG + Intergenic
915345665 1:155195657-155195679 CAGGGGATGAGAAGTTTTCAAGG - Exonic
915831962 1:159139774-159139796 CTGGGGATGAGGTGGAAACAGGG - Intronic
917535176 1:175869313-175869335 CTGGGGAGAAGCAGGTGGCAGGG - Intergenic
917536292 1:175876974-175876996 CTGAAGATGGGGAGGTGGCAGGG - Intergenic
919339688 1:196288515-196288537 TTGTGAATGAGGAGGTGGCATGG + Intronic
919601065 1:199622620-199622642 ATAGGGATGAGGAGGTGTGGAGG + Intergenic
920436935 1:205953182-205953204 TTGGGGAGGAAGAGGTGTCCTGG + Intergenic
921990456 1:221360436-221360458 CTGGGGAGGAGAAGGAATCAGGG - Intergenic
922009367 1:221565962-221565984 CTGGGGCTGAGGCTGTGTAAAGG + Intergenic
923441754 1:234027352-234027374 CTGTGGATGGTGAGGTGGCACGG - Intronic
923962091 1:239097067-239097089 CTAAGGATGAGGAGTTGCCAAGG - Intergenic
924641615 1:245838392-245838414 CGGGGGATGAGGAGGGCTAATGG + Intronic
1063002790 10:1940205-1940227 CTGGGGAGGAGGAGGCCTCATGG + Intergenic
1063651145 10:7938248-7938270 CTAGGGATGGGGAGGTGTGTGGG + Intronic
1064216702 10:13406492-13406514 CTGGGGATGGGAGAGTGTCAGGG - Intergenic
1064997952 10:21313047-21313069 CTGGGGATGGGTAAGTGTGAAGG - Intergenic
1066343111 10:34555797-34555819 CTGGGGAGGCAGAGGTGTCCTGG + Intronic
1068315520 10:55336684-55336706 ATGGGGATGAGGGGGTGAAAGGG - Intronic
1069726952 10:70586254-70586276 CTGAAGATGAGGAGGTGGGAGGG + Intergenic
1070669637 10:78369008-78369030 GTGGGGAAAAGGAGCTGTCATGG - Intergenic
1070923109 10:80201433-80201455 CTGGGGCTCAGGAGGCGTCTTGG - Intronic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071430282 10:85601692-85601714 CTGGGGCTGAGGAGGTGCCCTGG - Exonic
1071502836 10:86215678-86215700 CTGGGGCTGAGGAGGAGCCCAGG - Intronic
1071945235 10:90636266-90636288 CTGGGGGTGAGGAGCTGAAAAGG + Intergenic
1072578559 10:96720869-96720891 CAGGCGATGAGGAGGTGGCTTGG - Intergenic
1072964175 10:99956739-99956761 ATGAGGATGAGGAGGAGCCAGGG - Exonic
1074031814 10:109696749-109696771 CTGGGGATGTGGAGATATAAAGG - Intergenic
1074781259 10:116804009-116804031 GTGGGGATGAGGAGGGGCTAAGG - Intergenic
1075567901 10:123518108-123518130 GTGGGGATGAGCAGGTTTCGTGG + Intergenic
1076277186 10:129211388-129211410 CTGGTGATGTGTAGGTGTCCAGG - Intergenic
1076383989 10:130044370-130044392 CTGGGCTGGAGGAGGCGTCATGG - Intergenic
1076760971 10:132605489-132605511 CTGGGGATGGGGAGGGGACAGGG + Intronic
1076783542 10:132737608-132737630 CTGTGGCTGAGGAGCTGGCAGGG - Intronic
1077080546 11:722876-722898 CTGGGGAGGGGTGGGTGTCAGGG - Intronic
1077080563 11:722913-722935 CTGGGGAGGGGTGGGTGTCAGGG - Intronic
1077167543 11:1150585-1150607 CTGGGGTTCAGGAGATGTGAGGG + Intergenic
1077938129 11:6812485-6812507 CTGGGAGTGGGGAGGTCTCAGGG + Intergenic
1078006179 11:7534213-7534235 CTGGGGATGTGGACTTTTCAGGG - Intronic
1078355967 11:10631618-10631640 CTGGGGATGAGCAGATGACCAGG + Intronic
1080540302 11:33258029-33258051 CTGGGGATGCGGATGGGGCACGG - Intronic
1081655650 11:44855763-44855785 ATGGGGATAAGGAGATGTCAGGG - Intronic
1082097039 11:48139385-48139407 CTGGGGATGAGAAGGTGGGTGGG - Intronic
1082632343 11:55557365-55557387 CTTGGGCTGAGGATGTTTCATGG + Intergenic
1083630824 11:64094470-64094492 CTGGGGACAAGGAAGGGTCAGGG + Intronic
1083637585 11:64128819-64128841 CTGGGGATCTGGAGGTGTGGAGG - Intronic
1083746078 11:64737103-64737125 GAGGGGGTGAGGAGGAGTCAGGG + Intronic
1083939092 11:65885483-65885505 CTGAGGATGGGGAGGCGTCCAGG + Intronic
1084337927 11:68471956-68471978 GTGAGAATGAGGGGGTGTCAGGG + Intronic
1084370742 11:68741159-68741181 CTGGTGGGGAGGAGGGGTCAAGG - Intronic
1084506418 11:69571131-69571153 CTGAGGATCAGGAGGGGTCTGGG - Intergenic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1084973400 11:72783406-72783428 CTGGGAATGAGTAGGTGGCAGGG + Intronic
1085025823 11:73235955-73235977 CGGGGGATGAGGATATGGCAGGG + Exonic
1086303816 11:85459043-85459065 CTGGTGATGAGAGGGTGTCAGGG + Intronic
1086608184 11:88722769-88722791 CTGGGGATGAGGCGGTATATGGG - Intronic
1087548944 11:99622060-99622082 CTTGGTATGGGGAGGTGTAAGGG - Intronic
1088154004 11:106782423-106782445 CTGAGCATGATGAGGTGTCCAGG - Intronic
1088811959 11:113398096-113398118 CTGGGGATGAGGGGGAGGCCAGG - Intronic
1089257428 11:117201199-117201221 CTGGGGATGAGGTGGGCTCCTGG - Intronic
1089479429 11:118792230-118792252 CTGGGGGTGAGGCGGGGGCAGGG + Intergenic
1089498959 11:118921889-118921911 CAGGGGATGGGGAGATGGCAAGG + Intronic
1090417854 11:126552965-126552987 CTGGGGAAGAGGATGTGGGAAGG - Intronic
1090486303 11:127115376-127115398 ATGTGAATGAGTAGGTGTCATGG - Intergenic
1090624342 11:128592740-128592762 CTGGTGATAAGGAAATGTCAAGG - Intergenic
1090701411 11:129299096-129299118 CTGGGGCTGGGGATGTGACAGGG + Intergenic
1090908929 11:131101403-131101425 CAGGGTATGGGGAGGTGTGAGGG + Intergenic
1091947783 12:4563718-4563740 CTGGAGATGAGGAGATGCAAGGG + Intronic
1091992049 12:4963379-4963401 CTGGTCATGAGGATGTGTCCTGG - Intergenic
1092229832 12:6770234-6770256 CTGGGCCTGAGGGGCTGTCAGGG + Intronic
1092487179 12:8913139-8913161 CGGGGTATGAGGAGGTGAAAGGG - Intergenic
1092658223 12:10710088-10710110 CTGGGGAGGAGGAGGAGGAAGGG - Exonic
1096783014 12:54001599-54001621 CTGGGTGTGAGGAAGTGTCTGGG + Intronic
1096979533 12:55720314-55720336 CTGAGGAGGAGGAGGAGCCAGGG - Intronic
1099120343 12:78681861-78681883 CTGGGGATGAGGGAGAGTAAAGG - Intergenic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1101575712 12:105994471-105994493 CTGGGGCTGAGGAAGTTCCAAGG - Intergenic
1102311854 12:111851314-111851336 CTGTAGATCAGGAGGTCTCAAGG + Intronic
1102527612 12:113522970-113522992 CTGGGGATGAGCAGGTGAAACGG + Intergenic
1102812778 12:115838754-115838776 CTGAGGATGAGGACGAGGCATGG + Intergenic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103188380 12:118980842-118980864 CTGTGCATGCGGAGCTGTCAAGG - Intergenic
1103413761 12:120730702-120730724 CTGGGGATGAGATGGAGTTATGG + Intronic
1103481061 12:121249875-121249897 CTGGGGATGGAGAGGCGTCAGGG + Intronic
1103602089 12:122060637-122060659 CTGGGGGTGGGGTGGGGTCATGG + Exonic
1103703125 12:122858279-122858301 CTGGGGATGGGAAGGAGGCAGGG - Intronic
1104440043 12:128786918-128786940 CTGGGCATGGGGAGGTGCGAGGG + Intergenic
1104807090 12:131596597-131596619 CTGGGGATGGCGGGGTCTCAGGG - Intergenic
1104973640 12:132542456-132542478 CTGCTGGTGAGGAGGGGTCAGGG + Intronic
1105070051 12:133228698-133228720 TGGGGGATGAGCAGGTGCCACGG - Intronic
1105418176 13:20231381-20231403 CTGGGGAGCAGGAAGGGTCAGGG - Exonic
1105878863 13:24585892-24585914 ATGGGGATGAGGAGATGTGTGGG - Intergenic
1105920980 13:24963165-24963187 ATGGGGATGAGGAGATGTGTGGG + Intergenic
1106218002 13:27720301-27720323 CAGGGGAGGAGGAGGTGGCAAGG + Intergenic
1106458535 13:29948442-29948464 TTGGGGATGAGGACGTGGGAGGG - Intergenic
1106590770 13:31096822-31096844 CTGGTGATGAGGTGCTGGCATGG - Intergenic
1112040110 13:95538717-95538739 CAGAGGAAGAGGAGGAGTCATGG - Intronic
1112156408 13:96822262-96822284 TTGGGCATGAGGATGTCTCAAGG - Intronic
1113415603 13:110126158-110126180 CTGGGGGTGAGATGATGTCAGGG - Intergenic
1114728875 14:24969277-24969299 CTGGGGATGAGTAGCAGCCAAGG + Intronic
1115475073 14:33805714-33805736 CTGGGGCTGAGGAGGTGGCAGGG - Intergenic
1118617628 14:67585677-67585699 TTGAGGAAGAGGAGGGGTCAGGG - Intronic
1119251348 14:73157629-73157651 CTGGGGATGGGGAGGAATCAGGG - Intronic
1120907549 14:89633513-89633535 CTGGGGAAGAAGAGCTCTCAGGG - Intronic
1123106075 14:105841633-105841655 CTGGGGAGGAGGCGGTGTGGGGG + Intergenic
1123979977 15:25592698-25592720 CTGGGGATCAGGAGTGCTCATGG + Intergenic
1124244628 15:28058549-28058571 AGGGGGATGAGGAGGTGACAGGG - Intronic
1124377798 15:29139772-29139794 CTGGGGAGGCTGAGGAGTCAAGG - Intronic
1124553046 15:30699886-30699908 CTGTGCAAGAGTAGGTGTCAGGG - Intronic
1124604277 15:31159397-31159419 CTGGGGAGGAGGAGGTCACGTGG + Intronic
1124678197 15:31705784-31705806 CTGTGCAAGAGTAGGTGTCAGGG + Intronic
1124708157 15:31982681-31982703 CTGGAAATGAGAAGGTCTCAGGG + Intergenic
1126143354 15:45455175-45455197 CTGGGGGTGGGGAGGAGGCAGGG - Intergenic
1126497105 15:49303763-49303785 CTGGGGCTGAGGAGATGTACAGG - Intronic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1127335459 15:57979502-57979524 CTGTGGAGGAGAAGGGGTCAAGG - Intronic
1127399578 15:58572803-58572825 ATGGGGATGAGCAGGTTCCAGGG - Intergenic
1128217413 15:65944142-65944164 CTGGGGGTTAGGAGGTGGCAGGG + Intronic
1130098950 15:80877434-80877456 TTGGGGGTGAGGAGGTGGGAAGG - Intronic
1130577428 15:85105056-85105078 CAGGGGATGAGGAGGTGGTCAGG + Intronic
1131145653 15:90009865-90009887 CTGGGCATGAGTAGGTGGCCAGG - Intronic
1131777999 15:95823189-95823211 CTGGGGAAGGGGAGGTGTCAAGG + Intergenic
1132072848 15:98794929-98794951 CTGGGGTTGGGGAGGTGTCAAGG - Intronic
1132418447 15:101642669-101642691 CTGGGGTGGAGGTGGTCTCATGG - Intronic
1132738073 16:1397296-1397318 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738157 16:1397557-1397579 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738186 16:1397644-1397666 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738215 16:1397731-1397753 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132738244 16:1397818-1397840 CTGGGGATGAGGAGGTGTCAGGG + Intronic
1132957628 16:2603859-2603881 CTGGGGATGAGCTGGCGACAAGG - Intergenic
1132977742 16:2719078-2719100 CTGGGAGTGAGGACGTGTCCAGG + Intronic
1134208939 16:12259910-12259932 CGGGGGATTAGGGGGTGGCAGGG - Intronic
1135414500 16:22258392-22258414 CTGTGGATGAAGGGGTTTCAGGG + Intronic
1135510803 16:23081432-23081454 CTGAGGAGGCGGAGGTATCAGGG - Intronic
1135710394 16:24711487-24711509 CTGGGGATGGGGAGATTGCAGGG - Intergenic
1135851051 16:25964097-25964119 CCCGGGAAGAGGAGGTGGCAGGG + Intronic
1136282547 16:29222305-29222327 CTGGGGGAGAGGAGGTGTTGGGG - Intergenic
1136284514 16:29233265-29233287 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1136510612 16:30736339-30736361 CTGAGGATGAGGAGATGTCCCGG + Exonic
1138044124 16:53703626-53703648 CTGAGGATGTGGAGGTGTCTTGG + Intronic
1138095549 16:54208508-54208530 GTGGGGAGGAGGAGGTGTCTTGG + Intergenic
1138371537 16:56530860-56530882 CTGGGGATGGGCAGGAGTCAGGG - Intergenic
1139645525 16:68326836-68326858 CTGAGGAGAAGGAGGTGTGAAGG + Intronic
1140126898 16:72125221-72125243 CTGGAGGTGAGGAGCTGCCAGGG - Exonic
1140657001 16:77151402-77151424 TGGGGGAAGATGAGGTGTCAGGG - Intergenic
1140675273 16:77322221-77322243 CTGGAGAAGAGCAGGTGGCATGG - Intronic
1140749145 16:78007680-78007702 CTGGGGAGGTGGAGGTTGCAGGG - Intergenic
1140788583 16:78367652-78367674 CTGGGGAGAAGGTTGTGTCATGG + Intronic
1141397257 16:83716260-83716282 CTGGTGATCATGACGTGTCAAGG - Intronic
1141593687 16:85085008-85085030 CTCAGGAAGAGGAGGGGTCAGGG + Intronic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1142086924 16:88188229-88188251 CTGGGGGAGAGGAGGTGTTGGGG - Intergenic
1142089549 16:88202778-88202800 CTGGGGGTGAGGAGGTGATGAGG + Intergenic
1142237145 16:88927703-88927725 CTGGGGAGGAGGAGGCGGAAGGG - Intronic
1143185441 17:5007329-5007351 CTGAGGATGGAGAGGTGTGAGGG + Exonic
1143513402 17:7407800-7407822 GTGGGAGTGGGGAGGTGTCAGGG + Intronic
1143685773 17:8514516-8514538 GTGGGGCTGAGGAGGTGACAGGG - Intronic
1144851536 17:18246463-18246485 CTGGGGATGTGGAAGTGTTAGGG + Intronic
1145004924 17:19332396-19332418 CTGGGGGTGAGGAAGAGCCAGGG + Intronic
1145928333 17:28664855-28664877 CTGGGGAAGAGGAGTAGTAAAGG - Intronic
1145987928 17:29060181-29060203 CAGGTGATGAGGAGGTGACAGGG + Intergenic
1146723125 17:35137246-35137268 TTGGGAATGGGGAGGTGCCATGG - Intronic
1147189560 17:38730644-38730666 CTAGGAAGGAGGAGGTGACAGGG - Intronic
1147924652 17:43938906-43938928 GAGGGGATGAGGAGGGGTCGAGG - Exonic
1148288139 17:46414978-46415000 CTGGGGAGGAGGAGGTTGCAGGG - Intergenic
1148310309 17:46632562-46632584 CTGGGGAGGAGGAGGTTGCAGGG - Intronic
1149627687 17:58091246-58091268 TTGGGGATGAGGGGTTGGCATGG + Exonic
1150607348 17:66705686-66705708 CAGGGGATGAGCAGGTACCAAGG + Intronic
1151045180 17:70911588-70911610 CTGTGGATGAAGAGTGGTCATGG + Intergenic
1151314152 17:73311632-73311654 GTGTGGAGGAGGAGGTGGCAGGG - Intronic
1151340773 17:73469396-73469418 CTGGGCAGAAGCAGGTGTCAGGG + Intronic
1151665173 17:75541512-75541534 CTGGGGAAGAGCAGGTGGCCGGG - Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152120037 17:78412938-78412960 CTGGGGAAGAGGGGGTGGGAGGG + Intronic
1152191694 17:78892065-78892087 CTGGGGAGGAGGACGGGCCAGGG - Exonic
1152533318 17:80934464-80934486 CTGGGGAGGAAGAGGTGGGAGGG - Intronic
1152594919 17:81233368-81233390 GTGGGGATGAGGAGGTGGTGGGG - Intronic
1152603783 17:81278769-81278791 CTGGGGGTAAGCACGTGTCATGG - Intronic
1153518600 18:5930010-5930032 CTGGGGAGGAGGGAGTGGCAGGG + Intergenic
1154173535 18:12067547-12067569 CAGGGGATGAGGAGGAGTAGGGG + Intergenic
1156487325 18:37474809-37474831 GTGGGGAAGAGAAGGGGTCATGG - Intronic
1156557672 18:38085857-38085879 CTGGGGAAGAAGAGGGGTTAGGG + Intergenic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1157586551 18:48804896-48804918 CTGGGGATGAGGATGAGACTGGG - Intronic
1158170040 18:54587307-54587329 CTTGGGATGCGGAGGTGGGAGGG + Intergenic
1159019273 18:63129849-63129871 CTGGGGAAAGGGAGCTGTCAGGG + Intronic
1159242398 18:65759318-65759340 CTCGGGAGGTGGAGGTTTCAGGG - Intronic
1160255966 18:77249558-77249580 CTGGGGAGGAGGAGGAGGAAAGG + Intergenic
1160348328 18:78152990-78153012 CTGGGGATAAGGAAGGGTCCTGG - Intergenic
1160356681 18:78232964-78232986 CGGGGGAGGAGGGGGTGGCAGGG + Intergenic
1160394018 18:78559015-78559037 CTGGGGAGGAGGGGGTGGGAGGG - Intergenic
1160762398 19:792042-792064 CTGGGCATAGGGAGGTGTCCTGG + Intergenic
1160983266 19:1826415-1826437 GAGGGGATGAGGAGGAGGCAAGG + Intronic
1161461977 19:4402940-4402962 CTGGGGATGAGAAGGCCCCAGGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162191146 19:8947975-8947997 CTGTGGATGAGGTGATGTCCTGG + Exonic
1162385709 19:10359393-10359415 ATGTGGCTGGGGAGGTGTCAGGG + Intronic
1162520326 19:11175821-11175843 CTGAGGATGAGGAGAGGCCACGG + Intronic
1162740879 19:12772913-12772935 CTGGGGAGAAGGGGGTGTCAGGG + Intronic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1163029850 19:14537086-14537108 CTGAGGAGGAGGAGGGGGCAGGG + Intronic
1163446780 19:17351658-17351680 CTGGGGGTGAGGAAGTGGCTGGG + Exonic
1163493425 19:17630696-17630718 ATGAGAATGAGGAGGTGTCCCGG - Exonic
1163634722 19:18432702-18432724 CGGGGGATGAGGAGGAGTAGGGG - Exonic
1163638646 19:18449606-18449628 CTGGGGAGGAGGCTGAGTCAGGG - Intronic
1163845262 19:19634996-19635018 CTGGGGATGATGAAGGGTCAGGG + Intronic
1164583495 19:29450029-29450051 CTGGGGAGGCTGAGGTGTGAGGG + Intergenic
1164802962 19:31092892-31092914 CTGAGGATGAGGAGATTTGATGG - Intergenic
1165091552 19:33390756-33390778 CTGGGGATGAGGAGGCTGCAGGG + Intronic
1165369493 19:35395585-35395607 CTGGGAATGGAGAAGTGTCAGGG + Intergenic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1165489429 19:36114716-36114738 GTGGGGAGGGGGAGGTGCCAGGG + Intronic
1165661755 19:37586957-37586979 CTGTGGAAGAGGAGATGCCATGG - Intronic
1165897281 19:39150379-39150401 CTGAGGATGAGGTGGTGTCAAGG - Intronic
1166158026 19:40929950-40929972 GTGGGCATGACGAGGTGTCTGGG + Intergenic
1166166893 19:40996979-40997001 ATGGGCATGAAGAGGTGTCTGGG + Intronic
1166303226 19:41923727-41923749 CTGGGGAGGCGGAGGTGTGCTGG + Intronic
1166542571 19:43615086-43615108 CTGGGGTTGGGGAAGTGTTATGG + Intronic
1166705471 19:44905787-44905809 CTGGGGCTGAGTAGGACTCAAGG - Exonic
1166746030 19:45142280-45142302 CTGGGGACGGGGAGGGGGCACGG - Intronic
1167270245 19:48502143-48502165 CAGGGGAGGGGGAGGGGTCAGGG - Intronic
1168233005 19:55045149-55045171 CTGAGGATGAGGAGGTGGCCCGG - Exonic
1168454919 19:56499228-56499250 CTGGGGAGGCGGAGGTTTCAGGG + Intergenic
1168524904 19:57081035-57081057 CTGTGGATGAGGTGGTTCCAGGG + Intergenic
925309488 2:2872336-2872358 CTGGGGAAGGGGAGGGGACAAGG - Intergenic
925611226 2:5705318-5705340 CTGGGGAGGAGGAGCTGAGAAGG + Intergenic
928077535 2:28278831-28278853 CTGGGGAGGTGCAGGTGACAAGG + Intronic
928328048 2:30335543-30335565 CTGGGGATGAGGGGTTCTGAAGG + Intergenic
929949111 2:46392923-46392945 CTGGAGGTGAGGAGGGGTGAAGG + Intergenic
930376509 2:50573950-50573972 ATGTGGATGAGGAGGGGTCATGG + Intronic
930596680 2:53398129-53398151 CTGAGGTTGAGGAGGTGCCCAGG - Intergenic
931198484 2:60075039-60075061 CTGGGGATGGGGAGGTGAGATGG - Intergenic
931706547 2:64951288-64951310 CTGGGGATGAGGTGCTGTAGTGG + Intergenic
932016550 2:68033844-68033866 CTGGTGAGGAGGAGGTGCAATGG + Intergenic
932438406 2:71716688-71716710 CCGGGGATGGGAAGGTGTCTGGG + Intergenic
933720389 2:85393988-85394010 CTGGGGGTGAGGATGAGTCAGGG + Intergenic
933725136 2:85422528-85422550 CTGGGGATGGGGAGGTAGGAGGG + Intronic
935137846 2:100322593-100322615 CTGGGGAAGAGCAGGTGCCGCGG - Exonic
936093004 2:109512816-109512838 GAGGGGGTGAGGAGGGGTCAGGG - Intergenic
936521618 2:113215359-113215381 CTGAGGATGAAGAGGAGTGAGGG + Intergenic
936709913 2:115120339-115120361 CTGGGGATTTGAAGATGTCAGGG + Intronic
936955623 2:118019360-118019382 CTTGGGATGAAGGGGTGTCTGGG + Intergenic
937295812 2:120809331-120809353 AGGGAGATGAGGAGGTGCCAGGG + Intronic
937572082 2:123376180-123376202 CTGGGAGTAGGGAGGTGTCAGGG + Intergenic
938738572 2:134209091-134209113 CCGGGGATGAGGAGGTGGATGGG + Intronic
938825159 2:134997402-134997424 CTGGGGATGAATAGTTGTGATGG + Intronic
939658269 2:144854323-144854345 CTGGGTAAGAAGAGGTTTCAGGG - Intergenic
940145866 2:150543042-150543064 CTGAGGCCGAGGAGGTGCCAAGG + Intergenic
941516772 2:166490252-166490274 CTGGGGATGAGGGGGTGAATGGG - Intronic
944875588 2:203961415-203961437 CTGGGGATGAGGATGTGTCGAGG - Exonic
946157680 2:217817903-217817925 CTGGTGACGGGGAGGTGGCAGGG + Exonic
946253573 2:218428128-218428150 CAGGGGCTGAGGAGGGGTGAGGG + Intronic
947636308 2:231682342-231682364 CTGGGGATTAGGAAGAGGCAGGG - Intergenic
947722875 2:232380117-232380139 CTGTGCATGAGGAGGGGGCACGG + Intronic
947727222 2:232408198-232408220 CTGTGCATGAGGAGGGGACACGG + Intronic
947899662 2:233711098-233711120 CTGGAGATGAGGAGGGGTCTGGG - Intronic
947900360 2:233716882-233716904 CTGGAGATGAGGAGGGGTCTGGG - Intronic
947901762 2:233727252-233727274 CTGGAGATGAGGAGGGGTCTGGG - Intronic
948644730 2:239397428-239397450 CGGGGGATGAGGATGTATCCTGG - Intronic
948753513 2:240145638-240145660 CTGGGAATGAGGAGGGGACGTGG + Intergenic
948792524 2:240386331-240386353 CAGGGGATGAGGAGGAGCCTGGG + Intergenic
948839595 2:240642459-240642481 CGGGGGTGGAGGAGGTGCCACGG + Intergenic
1170511670 20:17083926-17083948 CTGGGAAGGAGGAGCTGTCCTGG - Intergenic
1172126489 20:32627764-32627786 CTGAGGCTGAGGAGGTGGCGGGG - Intergenic
1172619670 20:36310656-36310678 CTGGTGAGGTGGAGGTGCCAGGG + Intronic
1172620453 20:36315409-36315431 CTTGGGATGAGGAACAGTCAAGG + Intronic
1173009564 20:39169548-39169570 CTGAGGATGAGTAGGAATCAAGG - Intergenic
1173161036 20:40652878-40652900 CTGGGGATGTGCAGGGGGCAGGG - Intergenic
1173356958 20:42302534-42302556 GAGGGGATGAGGAGGTGCCTAGG - Intronic
1173528254 20:43749370-43749392 CTGGGGGAGAGGAGGGGACATGG - Intergenic
1173853997 20:46238039-46238061 CTGAGGATGGGGAGGTGCCAGGG - Intronic
1175206545 20:57316076-57316098 CTGGGGTGGGGAAGGTGTCACGG + Intergenic
1175524423 20:59623783-59623805 GTGGGGATGGGGAGGTGGCTTGG + Intronic
1175707168 20:61188276-61188298 CTAGGGATGTGGTGGTGTCAAGG - Intergenic
1175730907 20:61353262-61353284 CTGGGGGTGCAGAGGTGCCAGGG + Intronic
1175913972 20:62417155-62417177 CAGGAGAGGAGGAGGTGACAGGG - Intronic
1176107730 20:63397493-63397515 CTGCTGATGGGGAGGTGACATGG - Intergenic
1178641149 21:34345566-34345588 CTGGGGGTGCAGAGGTGTGAAGG + Intergenic
1179009755 21:37547033-37547055 CGGGGGATGAGGACCTGACAAGG + Intergenic
1179290724 21:40015730-40015752 ATGGGAATGAGAAGGAGTCAAGG - Intronic
1179608580 21:42534082-42534104 CAGGGGATGGGGAGCTGTCTGGG - Intronic
1179963403 21:44784948-44784970 CTGGGGATGAACAGCTGTCTAGG + Intronic
1180070966 21:45435622-45435644 CTGGGGCAGAGGTGGGGTCAGGG + Intronic
1180195318 21:46190444-46190466 CTGAGTATGGGGTGGTGTCATGG - Exonic
1180195330 21:46190496-46190518 CTGCGTATGGGGTGGTGTCATGG - Exonic
1180783658 22:18535329-18535351 CTGGAGAAGAGGCTGTGTCAGGG + Intergenic
1181127228 22:20709380-20709402 CTGGGGGAGAGGCTGTGTCAGGG + Intronic
1182143702 22:27983801-27983823 CGAGGGAGGAGGAGCTGTCAAGG + Exonic
1182247359 22:28969766-28969788 CTGGGGAAGGGGCAGTGTCAGGG + Intronic
1183069135 22:35384155-35384177 CTTAGGATGCGGAGGTTTCAGGG - Intronic
1183585101 22:38748807-38748829 CGGGGGAGGCGGAGGTGTGAGGG + Intronic
1184098459 22:42329248-42329270 CTGGGGATGAGGATGGTTTATGG - Intronic
1184110662 22:42392222-42392244 AAGGGGCTGAGGAGGTGTGATGG + Intronic
1184144594 22:42602018-42602040 ATGGGGATGAAGTGGTGCCATGG + Exonic
1184210073 22:43030292-43030314 GTGGGCATGTTGAGGTGTCAGGG - Intergenic
1184367084 22:44058628-44058650 CTCGGGAGGAGGAGGTTGCAGGG - Intronic
1184859503 22:47165192-47165214 GTGGTGAGGAGGATGTGTCAGGG + Intronic
1184905484 22:47482782-47482804 CTGGGGATGAGGGGAAGTTAGGG + Intronic
1185106145 22:48871067-48871089 CGGGCGATGTGGAGGTGCCACGG - Intergenic
949501608 3:4685387-4685409 CTGGGGATGAGGATTATTCACGG - Intronic
949522624 3:4870552-4870574 TTGGGGAGGAGGCAGTGTCAAGG + Intronic
950674001 3:14543812-14543834 CTGGGGACATGGAAGTGTCAGGG - Intergenic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
952711501 3:36436638-36436660 CTGGGCATTAGAAGGTGACAAGG - Intronic
952885892 3:38010749-38010771 CAGGGGAGGAGGAGGAGACAGGG - Intronic
953066937 3:39482191-39482213 GTGGTAATGAGGAGGAGTCAAGG - Intronic
953116069 3:39993616-39993638 CTGAGAGTGAGGAGGTGACAAGG - Intronic
953379608 3:42458393-42458415 CAGGGGAGGAGGAGGTGGAAGGG + Intergenic
953469310 3:43153720-43153742 ATGGGGTGGGGGAGGTGTCAAGG + Intergenic
953495890 3:43386751-43386773 CTGGGACTGAGGAGCTGTCAGGG - Intronic
953607547 3:44421459-44421481 CTGGTGATGAGATGGTGACAGGG + Intergenic
953666412 3:44929250-44929272 CTGGGGATGGGGAGGACCCAGGG - Intronic
953780734 3:45867939-45867961 CTGGTGATGAGAAGGATTCAAGG + Intronic
953780741 3:45868055-45868077 CTGGTGATGAGAAGGATTCAAGG - Intronic
954003859 3:47577801-47577823 CTGGGGAAGATGAGGCGTCGTGG - Exonic
954378993 3:50209735-50209757 CTGGGCATCCGGAGGTGTCTAGG - Intronic
954901440 3:54023481-54023503 CTGGGGTTAAGATGGTGTCAAGG + Intergenic
955396813 3:58563462-58563484 CTGGGGAAGAGCAGGTGGAAAGG + Intergenic
955837151 3:63068628-63068650 CTGGGGATGGGGAAGTGAAAGGG + Intergenic
960123197 3:113968555-113968577 CTGGGGAGGCTGAGGTGTAAAGG - Intronic
960223665 3:115146656-115146678 CTGGGGGGCAGGAGGTGTCCTGG - Intronic
960458889 3:117908542-117908564 CTGGGGATGAGCAAATGTGAAGG + Intergenic
960854925 3:122092838-122092860 CTGTGGATGATGAGGAGTCAGGG + Intronic
962760093 3:138503698-138503720 CTGAGGAGGAGGAGGAGGCAAGG - Intronic
962978005 3:140463147-140463169 CAGGGGCTGAGGAGGAATCATGG - Intronic
964439204 3:156688266-156688288 CTGGGGATGCTGAGGTGGGAGGG + Intronic
964681570 3:159345792-159345814 CTGGGCCTGAGGATGTGTCTTGG + Intronic
966376889 3:179305352-179305374 CTGGGTATGAGGAGGGGTGGAGG - Intergenic
967429603 3:189366393-189366415 CTGGAAATGAGAATGTGTCAAGG - Intergenic
968441721 4:627757-627779 GTGGGGATGAGAAGTTGTCTTGG - Intronic
968483161 4:845720-845742 TGGGGGATGGGGGGGTGTCACGG + Intergenic
968705724 4:2076519-2076541 CTGGGAAGGATGGGGTGTCAGGG + Intronic
969447492 4:7253542-7253564 CCGGGGCGGAGGAGGTGTCCAGG + Intronic
969494877 4:7520764-7520786 CTGGGGGTGAGGTGGAGTTAAGG + Intronic
969574247 4:8027341-8027363 CTGGGGCTGTGGAAGAGTCAGGG + Intronic
970651908 4:18188029-18188051 CAGGCGATGACTAGGTGTCAGGG + Intergenic
970980601 4:22092195-22092217 CTGGGGATGGGGTGGTGTCAGGG - Intergenic
973788626 4:54358214-54358236 CTGGGAATGGGGACGTGTCATGG + Intergenic
974616812 4:64296770-64296792 CAGAGGATGAGGTGGGGTCATGG + Intronic
975811696 4:78176546-78176568 CTGGAAATGAGAAGGTGTCAGGG - Intronic
976892380 4:90065554-90065576 CTGGGAAAGAGGCTGTGTCATGG + Intergenic
981169730 4:141606990-141607012 CTGGGGATTAGAAGATGGCATGG + Intergenic
981169822 4:141608821-141608843 CTGGGGATTAGAAGATGGCATGG + Intergenic
984298535 4:177885470-177885492 CTGGGGGTGAGAGGGTGGCAGGG - Intronic
984877770 4:184384793-184384815 CTGGGGAGGAGGAGATCCCAGGG + Intergenic
986225229 5:5806130-5806152 CTGGGGATCAGAAGGCGGCAAGG - Intergenic
987034606 5:14007102-14007124 TTGGGGCTGAGGATATGTCAGGG - Intergenic
987915270 5:24204882-24204904 GTGAGGATGAGGAGATGTGATGG + Intergenic
989069034 5:37490891-37490913 GTGGGTATGAGGGGATGTCATGG + Intronic
989129762 5:38095342-38095364 CTGAGGTTTAGGAGGTGGCAGGG - Intergenic
989238971 5:39181722-39181744 ATGAGAATGAGTAGGTGTCAAGG - Intronic
990329990 5:54715796-54715818 CAGGGGATGAGGATCTTTCAGGG + Intergenic
990389673 5:55306426-55306448 CTCGGGATGAGCAGGTATCATGG - Intronic
990958455 5:61367097-61367119 CAGGGGATGGTGAGGTGTCTGGG - Intronic
992162648 5:74017651-74017673 CTGAAGATGAGGAGGGGACAAGG - Intergenic
993100018 5:83526487-83526509 CAGGAGATGAGGAGGTCCCAAGG - Intronic
996559420 5:124812927-124812949 CTGAGGCTGATGACGTGTCATGG + Intergenic
997304765 5:132829313-132829335 CTGGGGCTGAGGAATTGTCAAGG + Intronic
997427339 5:133812398-133812420 CTGGGGATGGAGAAGTGTCAGGG - Intergenic
997444898 5:133933774-133933796 GTGGGGATGAGGAGGAGGAAGGG - Intergenic
997449134 5:133968029-133968051 CAGGGGCTGAGGAGGTGGCCGGG - Intronic
997531592 5:134584769-134584791 CTGGGGCTGAGGGGGTATCTGGG + Intergenic
998399766 5:141842612-141842634 CGTGGGAAGAGGATGTGTCAGGG - Intergenic
999308895 5:150538752-150538774 CCAGGGATGAGGTGGTGACAAGG + Intronic
999309282 5:150541427-150541449 CTGGGGGTGGGGATGTGACAAGG + Intronic
999736318 5:154516016-154516038 CCTGGGATGCGGAGGTTTCAGGG - Intergenic
1000798454 5:165693672-165693694 CTGGGAAGCAGAAGGTGTCAGGG - Intergenic
1001023825 5:168206528-168206550 CTGGGGTGGAGGAGGGGGCATGG + Intronic
1001219298 5:169885406-169885428 CTGGGCATGAAGAGGAGTGAAGG + Intronic
1001452975 5:171840355-171840377 CTGGGGAAGAGCAGGTGCTAGGG + Intergenic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002632814 5:180591938-180591960 CTGGGGAGGTGGAGGCGCCAGGG + Intergenic
1003405077 6:5821312-5821334 CTGGGGATGGGGAGGAGGGAAGG - Intergenic
1003427872 6:6009210-6009232 CTGGGGATGTGGAGTAGGCAGGG + Intergenic
1003698927 6:8440745-8440767 CTGGGAAAGAAGAGGAGTCATGG - Intergenic
1003857347 6:10289999-10290021 CTGGGGATGGGGAGAAGTCCAGG - Intergenic
1004762454 6:18683271-18683293 CTGAGCATGAGGAGGTGGAATGG - Intergenic
1005492749 6:26361738-26361760 CAGGAGAAGAGGAGGTGACAAGG + Intergenic
1005496915 6:26395859-26395881 CAGGAGATTAGGAGGTGACAAGG + Intergenic
1005830639 6:29668570-29668592 CTCGGGAGGAGGAGCTGTGAAGG - Intronic
1005883031 6:30074768-30074790 CTGAGGGTGAGGAGGGGTCCTGG - Intronic
1006604964 6:35249596-35249618 ATGGGGCTGAGGAGGTGGCTGGG - Exonic
1006640621 6:35487916-35487938 CTGGGGAGGAGGAGCTGACAGGG - Intronic
1007825679 6:44598949-44598971 CTGGGGAGGAGGAGGCCTCTGGG + Intergenic
1008428927 6:51392054-51392076 CTTGAGATGAGGAGGTATCCAGG - Intergenic
1010891252 6:81313397-81313419 CTGGAGTTTAGGATGTGTCACGG - Intergenic
1011003400 6:82617028-82617050 CTGGTGATGGGGTGGTGGCAAGG - Intergenic
1012820124 6:104076442-104076464 CTGGGGAGGAGGGGGTGATATGG + Intergenic
1016330998 6:142951794-142951816 CTGGGGATGAGAAGGGTGCAGGG + Intergenic
1017036931 6:150275330-150275352 CTGGGGATGGGGTGGGGACAGGG - Intergenic
1017382744 6:153848930-153848952 CAGGGGAGGAGGATGGGTCAAGG - Intergenic
1017959673 6:159210737-159210759 CTGGGCATGAGCTGGGGTCAGGG + Intronic
1017993629 6:159511397-159511419 CTGGGGAGCTGGAGGTGTTACGG + Intergenic
1018181605 6:161228072-161228094 CAGGGGAGGAGGAAGAGTCAGGG - Intronic
1018986151 6:168638589-168638611 CTGGGGAGGAGGAGGAGGCTGGG + Intronic
1018987171 6:168646738-168646760 CTGGGGTTGAGAAGGGCTCAGGG + Intronic
1019756390 7:2773643-2773665 CTGGTGATGAGGTGGAGTAATGG + Intronic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1020711557 7:11612326-11612348 CAGGAGATGAAGAGGTCTCATGG + Intronic
1022419313 7:30205854-30205876 CTGGGGATGAGAAGGGGGCGAGG - Intergenic
1022882833 7:34606594-34606616 TTGGGACTGAGGAGGTGCCAAGG + Intergenic
1023253150 7:38286563-38286585 CTTGGTCTGAGCAGGTGTCAGGG + Intergenic
1023829366 7:44029834-44029856 ATGGGGAGGAGGAGGAGACACGG - Intergenic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1024080763 7:45853364-45853386 CAGTGGATGAGGAGGTGTAAGGG + Intergenic
1024142957 7:46480683-46480705 CTGCAGCTGAGGAGGTGTTAGGG - Intergenic
1024616936 7:51123820-51123842 ATGTGGGTGAGGAGGTGGCATGG - Intronic
1024667769 7:51563530-51563552 CTGGGGAAGGGGAGGTGCCTGGG - Intergenic
1025261448 7:57421734-57421756 CTGGGGAGGTGGAGGTGAGAGGG + Intergenic
1025738774 7:64178929-64178951 CTGGGGAGGTGGAGGTGAGAGGG + Intronic
1026771836 7:73207001-73207023 CGGGGAGTGAGGAGGGGTCAGGG + Intergenic
1026881465 7:73909165-73909187 GAGGGGAGGAGGAGGAGTCAGGG + Intergenic
1027012704 7:74760397-74760419 CGGGGAGTGAGGAGGGGTCAGGG + Intronic
1027075336 7:75185656-75185678 CGGGGAGTGAGGAGGGGTCAGGG - Intergenic
1027761585 7:82285533-82285555 GGGGTGATAAGGAGGTGTCAGGG + Intronic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028983718 7:96993852-96993874 CTGGGGATGAGGTGGAGAAAGGG - Intergenic
1029440049 7:100582460-100582482 CTGGGGAAAAGGAGGTGTCGGGG + Intronic
1029510661 7:100992825-100992847 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511150 7:100996074-100996096 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029511878 7:101000745-101000767 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029512370 7:101003994-101004016 CTGAGGTTGTGGAGCTGTCAGGG - Exonic
1029739672 7:102484092-102484114 ATGGGGAGGAGGAGGAGACACGG - Intronic
1029757673 7:102583271-102583293 ATGGGGAGGAGGAGGAGACACGG - Intronic
1029775609 7:102682332-102682354 ATGGGGAGGAGGAGGAGACACGG - Intergenic
1029866065 7:103630499-103630521 ATGGGAATGAGGAAGTGTCCTGG - Intronic
1030299024 7:107956730-107956752 CTGGAGCTGAGGGGGTGACAGGG + Intronic
1030815053 7:114025236-114025258 CTGGGGATGAAGAGGGGCTAGGG - Intronic
1031868153 7:127062470-127062492 CTGGGGTTCAGCTGGTGTCAGGG + Intronic
1033260645 7:139841065-139841087 CTGGGGATGATGAGGTGCCCAGG - Intronic
1033343008 7:140506516-140506538 CTGGGGGTTAGCAGGTGTCTTGG + Intergenic
1033719894 7:144048338-144048360 CTGGCCTTGAAGAGGTGTCATGG - Intergenic
1033803508 7:144928138-144928160 CCCGGGAGGCGGAGGTGTCAGGG + Intergenic
1033817963 7:145098295-145098317 CTGTGAATGAGTAGGTTTCAAGG - Intergenic
1034870341 7:154677837-154677859 CTGAGGCTGAGGAGGTGGCCTGG - Intronic
1035282774 7:157787857-157787879 CTGGGGGTGCAGAGGTGTGAGGG - Intronic
1035916689 8:3632339-3632361 GTGGGGATGGGGGGGTGTCAGGG - Intronic
1036022544 8:4862127-4862149 CTGGGGACAAGGAGGCATCAGGG + Intronic
1036407601 8:8468940-8468962 TTGGGGAGTAGGAGGTGTCTTGG - Intergenic
1037274840 8:17166738-17166760 CTGGGGAGGAAAGGGTGTCAAGG + Intronic
1037342499 8:17861424-17861446 CTGGGGAGGTGGAGGTTGCAGGG - Intergenic
1037514095 8:19612426-19612448 GCGGGGATGGGGAGGTGTCTGGG - Intronic
1037961155 8:23099315-23099337 CTGGGGATGAGGAGGTAGGGAGG - Intronic
1037970525 8:23168542-23168564 CTGGGGATGAGGGGGTGGGGAGG + Intergenic
1038209098 8:25498721-25498743 CAGGGGATGAGGCGGGGTTATGG - Intronic
1038376263 8:27043046-27043068 CTGGGGATGAGGGGAAGGCAGGG - Intergenic
1038692313 8:29774399-29774421 CTGGGCAGGAGGAGGGGCCACGG + Intergenic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1040581314 8:48700843-48700865 CTAGGGTTGGGGATGTGTCATGG + Intergenic
1040590699 8:48789749-48789771 CTCTGGATGGGGTGGTGTCAGGG + Intergenic
1042335197 8:67622560-67622582 CTGGGAATGAGGAGAAGACAGGG + Intronic
1044620733 8:94188448-94188470 CAGGGGACGGGGAGGGGTCACGG + Intronic
1047089540 8:121558474-121558496 TAGGGGAGGAGGAGGTGTCAGGG - Intergenic
1047435836 8:124834906-124834928 AGGGGGCTGGGGAGGTGTCAGGG - Intergenic
1048001949 8:130385932-130385954 CTGGGAATGATCAGGTGACATGG + Intronic
1048510330 8:135056091-135056113 CAGGGGATGAAGACGTGTAATGG + Intergenic
1049365590 8:142235345-142235367 GTGGGGACGAGGAGGCCTCATGG - Intronic
1049439203 8:142601505-142601527 CTGGGAATGAGGAGGAGGCCGGG + Intergenic
1049660584 8:143818076-143818098 CTGGGGAAGAGGCGGTGAGATGG + Intronic
1049745687 8:144262320-144262342 GTGGGGACGAGGAGGGCTCAGGG + Intronic
1052829420 9:33202846-33202868 GCGGGGTTGAGGAGGTGCCAAGG - Intergenic
1052829519 9:33203392-33203414 CTGGAGATGGGGAGCTGCCAAGG - Intergenic
1053135355 9:35647227-35647249 CTGGGGATGCGGAGGAGGGAGGG - Intergenic
1056967702 9:91178668-91178690 CTGGGGATGAGGGAGGCTCACGG - Intergenic
1057054232 9:91949230-91949252 GTGGGGGAGAGGAGGTTTCAGGG + Intronic
1057551096 9:96051239-96051261 GAGGGGATTAGGAGGTGACAGGG + Intergenic
1058762556 9:108149271-108149293 CTGGGGAGGAGGAGGAGACTTGG - Intergenic
1059282340 9:113145676-113145698 CTGGTGGTGGGGAGGGGTCAGGG - Intergenic
1059449420 9:114361048-114361070 CTGAGGCTGGGGAGGTGGCAGGG - Intronic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1059544663 9:115164291-115164313 TTGGGGATGTGGAGGTTTGAGGG - Intronic
1060183843 9:121551982-121552004 CTGGGTAGGTGGAGGTGGCAGGG + Intergenic
1060723951 9:125995319-125995341 CGGGGGAGGGGGAGGTGCCAGGG + Intergenic
1061042258 9:128146958-128146980 TTGGGGGTGAGGCAGTGTCATGG - Intergenic
1061132094 9:128713973-128713995 CAGGGGCAGAGGAGGTGCCATGG + Intronic
1061146687 9:128803799-128803821 CTGGGGGTGGAGAGGGGTCAAGG + Intronic
1061303239 9:129718327-129718349 GTGGGGATGAGGAGCTGGCCGGG - Intronic
1061397172 9:130349514-130349536 CTGGGGGTGAGAAGGCGTGAGGG - Intronic
1061715337 9:132515134-132515156 CTGGGGATGGGGTGGTGGCAAGG - Intronic
1061859524 9:133460727-133460749 CTGAGGGTCAGGTGGTGTCAGGG + Intronic
1062008272 9:134252649-134252671 CCTGGCAGGAGGAGGTGTCACGG + Intergenic
1062205860 9:135336734-135336756 CTGGGGAGAAGGAGCCGTCAGGG + Intergenic
1062483146 9:136761802-136761824 GTGGGGCTCCGGAGGTGTCAGGG + Exonic
1062540430 9:137039582-137039604 CAGGGGACCAGGAGGTGTCCTGG + Exonic
1062566700 9:137166855-137166877 CTGGGGAAGAGGGGGTGTCCAGG + Intronic
1062569939 9:137180385-137180407 CTGAGGAGGAGCCGGTGTCACGG + Intronic
1062685474 9:137810346-137810368 CTGGTGATGACGAAGGGTCAGGG + Intronic
1186410831 X:9342997-9343019 CTGGGGGTGAGGAAGTGCCTGGG + Intergenic
1186906006 X:14111211-14111233 ATGAGGCTGAGGAGGTGACAAGG - Intergenic
1187421594 X:19139052-19139074 CTGGGGATGAAGAGGTAACCAGG + Intergenic
1188010394 X:25049146-25049168 CTGGGGGTGAGGAGTGGACAAGG + Intergenic
1188691253 X:33131726-33131748 CTGGGGATGTGGTGGTGTGAGGG - Intronic
1189243152 X:39541181-39541203 GTGGGGATGAGGGGGAGTAAAGG - Intergenic
1189862300 X:45286111-45286133 CTGGGGATAAGGAGATTACAGGG - Intergenic
1191861273 X:65668025-65668047 CAGGGGTTGAGGGGGTGTCCAGG + Intronic
1192176886 X:68891960-68891982 AAGGGGAGGAGGAGGTGTGATGG + Intergenic
1193709908 X:84867449-84867471 TTGGAGAAAAGGAGGTGTCAAGG - Intergenic
1194125422 X:90010647-90010669 CTGGGGAAGAGGGGGTGGAAGGG - Intergenic
1195197808 X:102516608-102516630 ATGGGGATGGGAAGGCGTCAGGG - Intronic
1195783087 X:108485603-108485625 CTGGGGATTAGGACATGTAATGG + Intronic
1198018489 X:132635378-132635400 CTGGGGGTGTGGAAGTGGCATGG - Intronic
1198235619 X:134733749-134733771 CTGGGGATGAGGATGAGGCCTGG + Intronic
1198987792 X:142476225-142476247 CTGGGGATGAGAGGATGTTAAGG - Intergenic
1199827511 X:151515325-151515347 ATGGGGAAGAGGAGGGGACAAGG - Intergenic
1201459139 Y:14202970-14202992 GTGGAGATGAGGAAGTGTCTTGG + Intergenic
1202085769 Y:21135199-21135221 CTGGGGATAAGTGGGTGACAGGG - Intergenic