ID: 1132738151

View in Genome Browser
Species Human (GRCh38)
Location 16:1397539-1397561
Sequence CTGGGGCAGGGCATGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 743
Summary {0: 2, 1: 5, 2: 8, 3: 64, 4: 664}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132738135_1132738151 2 Left 1132738135 16:1397514-1397536 CCCACCCCGACCCCCGTGCTTCA 0: 4
1: 0
2: 3
3: 15
4: 217
Right 1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG 0: 2
1: 5
2: 8
3: 64
4: 664
1132738133_1132738151 4 Left 1132738133 16:1397512-1397534 CCCCCACCCCGACCCCCGTGCTT 0: 4
1: 0
2: 3
3: 61
4: 546
Right 1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG 0: 2
1: 5
2: 8
3: 64
4: 664
1132738138_1132738151 -3 Left 1132738138 16:1397519-1397541 CCCGACCCCCGTGCTTCACGCTG 0: 4
1: 2
2: 0
3: 13
4: 154
Right 1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG 0: 2
1: 5
2: 8
3: 64
4: 664
1132738136_1132738151 1 Left 1132738136 16:1397515-1397537 CCACCCCGACCCCCGTGCTTCAC 0: 4
1: 0
2: 0
3: 20
4: 247
Right 1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG 0: 2
1: 5
2: 8
3: 64
4: 664
1132738139_1132738151 -4 Left 1132738139 16:1397520-1397542 CCGACCCCCGTGCTTCACGCTGG 0: 6
1: 0
2: 0
3: 6
4: 105
Right 1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG 0: 2
1: 5
2: 8
3: 64
4: 664
1132738134_1132738151 3 Left 1132738134 16:1397513-1397535 CCCCACCCCGACCCCCGTGCTTC 0: 4
1: 0
2: 6
3: 45
4: 463
Right 1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG 0: 2
1: 5
2: 8
3: 64
4: 664
1132738145_1132738151 -10 Left 1132738145 16:1397526-1397548 CCCGTGCTTCACGCTGGGGCAGG 0: 6
1: 1
2: 1
3: 17
4: 162
Right 1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG 0: 2
1: 5
2: 8
3: 64
4: 664
1132738137_1132738151 -2 Left 1132738137 16:1397518-1397540 CCCCGACCCCCGTGCTTCACGCT 0: 4
1: 2
2: 1
3: 3
4: 79
Right 1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG 0: 2
1: 5
2: 8
3: 64
4: 664
1132738143_1132738151 -8 Left 1132738143 16:1397524-1397546 CCCCCGTGCTTCACGCTGGGGCA 0: 6
1: 0
2: 0
3: 6
4: 101
Right 1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG 0: 2
1: 5
2: 8
3: 64
4: 664
1132738144_1132738151 -9 Left 1132738144 16:1397525-1397547 CCCCGTGCTTCACGCTGGGGCAG 0: 6
1: 1
2: 1
3: 12
4: 100
Right 1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG 0: 2
1: 5
2: 8
3: 64
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132738151 Original CRISPR CTGGGGCAGGGCATGGACCT GGG Intronic
900092728 1:927460-927482 CTCACGCAGGGCAGGGACCTGGG - Intronic
900176799 1:1294673-1294695 CAGGGGCTGGGCAGGGGCCTCGG + Intronic
900215369 1:1478796-1478818 CTGGGGCAGGACTGGGAGCTGGG + Intronic
900222630 1:1517463-1517485 CTGGGGCAGGACTGGGAGCTGGG + Intronic
900651475 1:3732170-3732192 CTGGGACGGGCCTTGGACCTGGG - Intronic
900886310 1:5417978-5418000 CAGGGGAAGGACATGGACCAAGG - Intergenic
901013312 1:6213066-6213088 CTGGAGAAGGTCATGGAGCTGGG - Exonic
901241241 1:7694875-7694897 CTGAGCCAGGGCGGGGACCTGGG + Intronic
901490980 1:9596083-9596105 CCGGGGCAGGGCAGGGACACAGG - Intronic
901766307 1:11502167-11502189 CTGGGCCTGGGCCTGGGCCTGGG - Intronic
901816093 1:11794313-11794335 CAGGGGCAGGGGATGAACCAGGG + Intronic
901887127 1:12230699-12230721 CTGGGCCAGGGCGTGACCCTGGG - Intronic
901887150 1:12230784-12230806 CTGGGCCAGGGCGTGACCCTGGG - Intronic
902229554 1:15019226-15019248 CTGGGGCAGATGCTGGACCTGGG - Intronic
902448655 1:16483612-16483634 CTGGGGCAGGATAGGGGCCTAGG + Intergenic
902468037 1:16630268-16630290 CTGGGGCAGGATAGGGGCCTAGG + Intergenic
902506123 1:16939748-16939770 CTGGGGCAGGATAGGGGCCTAGG - Intronic
902786827 1:18738364-18738386 CTGGAGCAGGGCACCGAGCTTGG - Intronic
903262269 1:22137715-22137737 CTCGGGCAGAGCCTGGTCCTGGG + Intronic
903365365 1:22802502-22802524 CTGGGGAAGGGCATAGTCTTTGG - Intronic
903373445 1:22851404-22851426 CTGGAGGAGGGCAAGGACATGGG + Intronic
903663531 1:24993218-24993240 GTGGAGCAGGGCCTGGACTTAGG - Intergenic
903714305 1:25352400-25352422 CAGGGGAATGGCATGAACCTGGG + Intronic
903741548 1:25561491-25561513 CTGGGGGAGGGCAGGGAGCGGGG + Intronic
903818616 1:26083552-26083574 CTGGGGCAGGTTTGGGACCTGGG + Intergenic
903850071 1:26300712-26300734 CTGGGGCTGGGGCTGGGCCTCGG + Intronic
903915320 1:26759620-26759642 ATGGGGCAGGGGATGGAGTTAGG + Intronic
904112371 1:28136279-28136301 ATGGGGAAGACCATGGACCTTGG - Intergenic
904286942 1:29459025-29459047 CAGGGCCAGGACATGGACCTGGG - Intergenic
904567026 1:31434315-31434337 CAGGGGCAGGTCCTGGAGCTGGG - Exonic
904618456 1:31762356-31762378 CTGGGACAGAGCAAGCACCTGGG - Intronic
904916628 1:33975157-33975179 CTGGTGCTGGGCATGTACCCTGG - Intronic
905117741 1:35656974-35656996 CTAGGGCAATGCATGGAACTTGG - Intergenic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
905250160 1:36643297-36643319 CTGGGGCTGGGGATGGAACTGGG - Intergenic
905712753 1:40120424-40120446 CAGAGGCAGGGCTTGAACCTCGG - Intergenic
905991590 1:42341997-42342019 CTGGGGCATGACATGGTCCATGG - Intergenic
906067592 1:42993318-42993340 CTGGGGCATGGCATGGTGCGCGG - Intergenic
906198880 1:43946919-43946941 CCGGGACGGGGCAGGGACCTCGG - Exonic
906274446 1:44505892-44505914 CTGGGGCAGGGCATGGGGGGAGG - Intronic
906609266 1:47190667-47190689 CTGGGTCAGGGCCTGGGCATGGG - Intronic
907459072 1:54594466-54594488 CTCGGGCATGGCATGGTGCTGGG + Intronic
907673560 1:56498436-56498458 CTGGGGCTGGGGCTGGGCCTGGG - Intronic
908903437 1:68981966-68981988 CTGGAGAATGGCATGAACCTGGG - Intergenic
913672786 1:121113690-121113712 CTGGGTCAGGGCATTGAGATTGG - Intergenic
914024562 1:143901064-143901086 CTGGGTCAGGGCATTGAGATTGG - Intergenic
914663047 1:149809085-149809107 CTGGGTCAGGGCATTGAGATTGG - Intronic
915063384 1:153204977-153204999 CTGGGGGAGGGCAGGGAGGTGGG - Exonic
915138510 1:153751178-153751200 CTGTCGCAGGGCCTGGAGCTGGG - Exonic
915251391 1:154591473-154591495 CTGGGGTAAGGAATGGATCTTGG + Intronic
915535230 1:156531286-156531308 CAGGGGAAGGGCCTGGACATGGG + Intronic
915731644 1:158058406-158058428 CTGGGGCAGGGCAGGGAGGGAGG - Intronic
915926598 1:160025992-160026014 TTGGGGCAGGGCTTGGAGTTGGG + Intergenic
916038559 1:160942777-160942799 CAGGGGAATGGCATGAACCTGGG + Intergenic
916144791 1:161728503-161728525 CTGGGGCAGGGGGTGCACCTGGG - Intergenic
917494830 1:175530939-175530961 CTGGTGCCTGGCATGGGCCTGGG - Intronic
918071016 1:181133400-181133422 CTGGGGAAGGTCATGGACACTGG + Intergenic
918155777 1:181845128-181845150 CTGGGGGAGTACATGGTCCTGGG - Intergenic
920100950 1:203516760-203516782 CTGGGGCAGGGAATAGGTCTTGG - Intergenic
920188547 1:204177735-204177757 CTGGGGCAGGGCACCCACCCAGG - Intergenic
920310123 1:205043778-205043800 CTGGGGCAGGCCAGGGCCCAGGG - Intronic
920367934 1:205457661-205457683 GTGGGGCAGGACATGGGCCGTGG - Intergenic
921317143 1:213903203-213903225 CTGGGGCTGGGCAGGGGCCTGGG + Intergenic
922507057 1:226132755-226132777 CTGGGGAAGGGCATGGCCCTGGG + Intergenic
923340153 1:233000127-233000149 GTGGGGCAGGGCATGGTGCCAGG - Intronic
923689329 1:236177238-236177260 CTGCAGCTGGGCATGGACCTGGG + Intronic
924637730 1:245804463-245804485 CAGGAGAATGGCATGGACCTGGG + Intronic
924709135 1:246519562-246519584 ATGGGGAAGGGCATGGTCCTTGG + Intergenic
924938411 1:248791765-248791787 GGGGTGCAGGGCATGGATCTTGG - Intergenic
1062874455 10:932540-932562 TTGGGGCAGGGCCGGGGCCTGGG - Intergenic
1062874494 10:932622-932644 TTGGGGCAGGGCCGGGGCCTGGG - Intergenic
1062976354 10:1686229-1686251 CAGGGGCAGGGGATGGGCCAAGG + Intronic
1063097877 10:2923946-2923968 CTGAGCCAGGGCATCAACCTGGG + Intergenic
1064806029 10:19134206-19134228 CTGGGGCACAGCATGGTGCTGGG - Intronic
1065551926 10:26876703-26876725 CTGAGGCAGGGCTTGAGCCTAGG - Intergenic
1065754646 10:28919970-28919992 CTGGGGCAGGGGATGGTTTTGGG + Intergenic
1066453645 10:35553729-35553751 CTCGGGGAGGGCATCGCCCTTGG + Intronic
1066962400 10:42234703-42234725 CTGGGGCAGGGCCGGGGCCAGGG + Intergenic
1067321374 10:45224229-45224251 ATGGGGCAGGGCAGGGGACTGGG + Intergenic
1068582672 10:58759864-58759886 CAGGGGAATGGCGTGGACCTGGG + Intronic
1068936219 10:62638064-62638086 CTGGGGTAGGGTATGGGACTTGG + Intronic
1069782128 10:70963416-70963438 GTGGGGCAGGGAGTGGCCCTGGG + Intergenic
1069826633 10:71258762-71258784 TTGGGGCAGGGTGGGGACCTTGG - Intronic
1069893503 10:71666424-71666446 CTGGGGGTGGCCATGCACCTGGG - Intronic
1070542295 10:77425005-77425027 CTGGGCCAGGGCAGGCACCTGGG + Intronic
1070595566 10:77830551-77830573 CTGGGGAAGGGCAGGGTCCTCGG - Intronic
1070650626 10:78233023-78233045 CTGGGGCTGGACATGGTCCTTGG + Intergenic
1072577478 10:96713409-96713431 CAGGAGAATGGCATGGACCTGGG + Intronic
1073361523 10:102903190-102903212 CAGGGGCATGGCATGGTCCAGGG + Intergenic
1074051218 10:109882795-109882817 TGGGGGCAGGGAATGCACCTTGG - Intronic
1074104360 10:110377241-110377263 CTGAAGTAGGGCATGGAACTGGG - Intergenic
1074712672 10:116190459-116190481 CTGGGGAAGGCCATGTACCCAGG - Intronic
1075033193 10:119040911-119040933 CAGGAGAAGGGCATGAACCTGGG + Intronic
1075073707 10:119336302-119336324 CTGGGCCAGAGCAGGGGCCTGGG - Intronic
1075589923 10:123684013-123684035 TTGGGGGAGGGGATGGAGCTGGG - Intronic
1075711655 10:124533982-124534004 CATGGGCAGGGCATCGACCAGGG - Intronic
1075719116 10:124574738-124574760 CTGGGGGAGGGCATGGTCGGAGG + Intronic
1076322204 10:129591546-129591568 CTGGGGCCTGGCCTGGATCTAGG - Intronic
1076623617 10:131808548-131808570 CTGAGGCTGGGCATAGATCTCGG - Intergenic
1077013140 11:388368-388390 CTGGGGGATGGCAGGGGCCTTGG + Intergenic
1077044637 11:539171-539193 CTGGGGAATGGCATGAACCCAGG - Intronic
1077048267 11:555570-555592 CTGGGGCGGGGCAGGGGCCGCGG + Intronic
1077060150 11:614327-614349 CTGGGGCAGGGAGGGGGCCTGGG + Exonic
1077103758 11:833196-833218 CTGGGGCAGGCGAGGGAGCTGGG - Intronic
1077201093 11:1308008-1308030 CTGCGCGAGGGCAGGGACCTTGG + Intronic
1077252564 11:1567056-1567078 TTGGGGCAGGGTTGGGACCTGGG + Intronic
1077344385 11:2039612-2039634 CTGGGGCTGGGAAGGGAGCTGGG - Intergenic
1077353455 11:2103690-2103712 CAGGGGCAGGGCCGGGAACTGGG + Intergenic
1077405116 11:2379263-2379285 CTGAGGGAGGGTGTGGACCTGGG + Intronic
1077443846 11:2581161-2581183 CCTGGGCAGGGCAGGGACCCTGG - Intronic
1078874025 11:15376076-15376098 ATGGGGCAGGGAATGGTCATGGG + Intergenic
1079202002 11:18384359-18384381 CTTGGGCAGGGGAGGGAGCTAGG + Intergenic
1081702718 11:45162126-45162148 CTGGGGAAGGGCAGGGCCCAGGG - Intronic
1082686372 11:56243606-56243628 CAGGGGAATGGCATGAACCTGGG + Intergenic
1083167818 11:60902278-60902300 GTGGTGCAGAGCATGGACCCTGG - Intronic
1083606632 11:63982778-63982800 CAGGGGCATGGCATGGGCCCTGG - Intronic
1083794109 11:65004724-65004746 GTGGTGCAGGGCATGGTGCTGGG - Intergenic
1083826089 11:65204952-65204974 GTGGGGAAGGGCATGGTCCCTGG - Intronic
1083954925 11:65977952-65977974 CCGGGGCATTGCATGGCCCTGGG - Intronic
1083954930 11:65977969-65977991 CTGGGGCATTGCATGGCCCGGGG - Intronic
1084021917 11:66422843-66422865 CAGGGCCAGGGCCAGGACCTGGG - Exonic
1084150812 11:67287140-67287162 CGGGGCTAGGGCAGGGACCTGGG - Intergenic
1084171648 11:67403978-67404000 CAGGGGCAGGGCTTGGGGCTGGG + Intronic
1084318628 11:68360640-68360662 CTGAGGCAGAGCATGGCCCAGGG + Intronic
1084473656 11:69376936-69376958 CTGTGGCAGGGCAGGTCCCTGGG + Intergenic
1084661790 11:70550406-70550428 CTGGGGCAGGGGATGCTCTTCGG + Intronic
1084697901 11:70767195-70767217 CTGGGGCTGGGCAGGACCCTGGG - Intronic
1084706271 11:70817609-70817631 CTTGGGTTGGACATGGACCTGGG + Intronic
1085511444 11:77090298-77090320 CTGTGGCAGAGCAGGAACCTGGG - Intronic
1087049821 11:93874881-93874903 CAGGGGAATGGCATGAACCTGGG - Intergenic
1087658415 11:100955434-100955456 CTGGGGTAGGGCTTGGGACTGGG + Intronic
1088400838 11:109421953-109421975 CTGGAGAAGGGCAGGGAACTGGG + Intergenic
1088442608 11:109888394-109888416 CTGGAGAATGGCATGAACCTGGG + Intergenic
1088543603 11:110937873-110937895 CTGGGGAAGGGGCTAGACCTTGG + Intergenic
1088755096 11:112879018-112879040 CTGCGGCAGGGCCCGGAACTAGG + Intergenic
1089136097 11:116250521-116250543 CTTGGGCTGGGCATTGGCCTCGG + Intergenic
1089619522 11:119714332-119714354 CTGTGGCATGTCATGGCCCTGGG - Intronic
1089654941 11:119940558-119940580 CTGAGGAGGGGCATGGAGCTGGG - Intergenic
1089685975 11:120147119-120147141 CTCAGGCAGGGCAGTGACCTAGG - Intronic
1090367518 11:126219742-126219764 CTGGGGAAGAGCAGGAACCTAGG - Intronic
1090425184 11:126602657-126602679 CTGGGGCAGGGCTTCAACCACGG - Intronic
1090780257 11:130001850-130001872 CTGGGGCAGGGCCGCGACCCCGG + Intronic
1090955117 11:131506653-131506675 ATGGGGCAGGGCACAGCCCTAGG + Intronic
1091062213 11:132474248-132474270 CTGGGCCAAGGAATTGACCTGGG - Intronic
1202827371 11_KI270721v1_random:94801-94823 CTGGGGCTGGGAAGGGAGCTGGG - Intergenic
1092033907 12:5313795-5313817 CTGAGGCAGGGCTTGAACCTGGG + Intergenic
1092260395 12:6950510-6950532 CTGGGGCAGGGCAGAGGCCTAGG + Intronic
1092596171 12:10006960-10006982 CAGGGGAATGGCATGAACCTGGG + Intronic
1092770381 12:11891248-11891270 CTGGCGGAGGGCATGAGCCTGGG + Exonic
1093329048 12:17812987-17813009 CTGGGGCAGGCCCAGAACCTAGG - Intergenic
1093967844 12:25345899-25345921 CTGCTGCAGAGCCTGGACCTAGG + Intergenic
1096113581 12:49042402-49042424 TTGGGGCAGGGCAGTGGCCTGGG - Intronic
1096473033 12:51890758-51890780 CTGGGCCTGGGCCTGGGCCTGGG - Exonic
1096971531 12:55670400-55670422 CTGGGGCAGGGACTGGGGCTGGG - Intergenic
1097244114 12:57596851-57596873 CTGGGGAAGGAAATGCACCTGGG + Intronic
1100269659 12:93012524-93012546 CAGGGGAATGGCATGAACCTGGG + Intergenic
1100825685 12:98472320-98472342 CTGGGGAAGGGGATGGGCCTGGG - Intergenic
1101447547 12:104748157-104748179 CTGGGGCTGGGGGTGGATCTAGG + Intronic
1101759761 12:107648935-107648957 TTGGGGGTGGGCATGGAACTGGG + Intronic
1101818371 12:108163274-108163296 CTGGAGAATGGCATGAACCTGGG + Intronic
1101873088 12:108581568-108581590 CTTGGGCAGGTCCTGGGCCTCGG - Intergenic
1102102913 12:110294554-110294576 CTGAGGCAGGGCTTGAACCTAGG + Intronic
1102247185 12:111362906-111362928 CAGGGGCAGGGCTGGGACCGGGG + Exonic
1102407657 12:112687655-112687677 CAGGAGCAGGGAATGGACATGGG - Intronic
1103241766 12:119419368-119419390 CTGGGGCAGGACATGTATGTAGG + Intronic
1103303039 12:119942678-119942700 CTCGGGAAGGGCATGGCCTTGGG - Intergenic
1103527592 12:121578596-121578618 GGGGGGCCGGGCATGGGCCTAGG - Intronic
1103894665 12:124265054-124265076 CTGGGGCTGGGCCTGCACCCAGG - Intronic
1104436153 12:128758354-128758376 CTGTGGCAGGCCAAGGACCCTGG + Intergenic
1104568645 12:129906153-129906175 CTGGGGCAGGGGCTGGAGTTAGG - Intergenic
1104657080 12:130581430-130581452 GTGGGGGTGAGCATGGACCTTGG - Intronic
1104902842 12:132198432-132198454 CTGGGGCTGGGGCTGGGCCTGGG + Intronic
1104934331 12:132356448-132356470 CTGGGGCCGGGCAGGGGTCTTGG - Intergenic
1105792329 13:23814347-23814369 CAGGAGAATGGCATGGACCTGGG - Intronic
1106125586 13:26897887-26897909 CTGGGGCTGGGGCTGGGCCTGGG + Intergenic
1106623086 13:31389996-31390018 CAGGAGCATGGCATGAACCTGGG - Intergenic
1107584503 13:41830148-41830170 CAGGAGAATGGCATGGACCTGGG + Intronic
1108102030 13:46966864-46966886 CTGGAGAATGGCATGAACCTGGG + Intergenic
1109074752 13:57821056-57821078 CTGTGGCAGGCCCTGGGCCTGGG - Intergenic
1109666187 13:65541229-65541251 CTGGAGAACGGCATGAACCTGGG + Intergenic
1111347443 13:86977440-86977462 CAGGGGAATGGCATGAACCTGGG - Intergenic
1111684429 13:91485041-91485063 CTGGGGTATGGCCTGGGCCTGGG - Intronic
1112434778 13:99384037-99384059 GAGGGGCCGGGCATGGGCCTGGG - Intronic
1113259622 13:108547177-108547199 CAGGAGCATGGCATGAACCTGGG + Intergenic
1113262772 13:108584044-108584066 CTGGAGAATGGCATGAACCTGGG - Intergenic
1113683283 13:112260234-112260256 CTGCAGCAGTGCAGGGACCTCGG + Intergenic
1114199919 14:20510520-20510542 CTGGGCCTGGGGATGGGCCTGGG + Exonic
1114670929 14:24410531-24410553 CCTGGGAAGGGCATGGACCTTGG - Intronic
1116938620 14:50768612-50768634 GTGGGGGAGGGCATGGCACTGGG + Intronic
1118178526 14:63467131-63467153 CAGGAGAATGGCATGGACCTGGG + Intronic
1118594816 14:67427338-67427360 CTCGGGCAGGGAAGGGCCCTTGG + Intergenic
1118748656 14:68791464-68791486 ATGGTGCAGGTCAGGGACCTAGG + Intronic
1118781698 14:69012932-69012954 CTGGGACAGGGCATGGACTTGGG - Intergenic
1119522171 14:75294380-75294402 CAGGGGCGGGGCAGGGACCGGGG - Intergenic
1119860377 14:77931742-77931764 CTGGGGCAGGCCAGGGGGCTAGG - Intronic
1121016278 14:90551244-90551266 CTGGTGCAGGGCCTGGCCCAGGG + Intronic
1121075590 14:91065568-91065590 CTGGGGTTGGGCCTGGACTTTGG + Intronic
1121221400 14:92288283-92288305 GTGGGGCAGGGGCTGGACCCAGG - Intergenic
1121338868 14:93093300-93093322 CTGGGGCAGGGCAGAGAGCTGGG - Intronic
1121416973 14:93786481-93786503 TTGGGGCAGCTCATGGACCTCGG + Intronic
1121494368 14:94381738-94381760 CTGGGGCTGGAGAGGGACCTGGG + Intronic
1122036595 14:98953672-98953694 TTGGGGCAGGGCTTGGACTGCGG - Intergenic
1122119511 14:99544565-99544587 CTGAGGCAGGGGATGGGGCTTGG + Intronic
1122302760 14:100740522-100740544 CTGGAGCCAGGCTTGGACCTGGG + Intergenic
1122408054 14:101512101-101512123 GTGGGGCATGGGGTGGACCTGGG - Intergenic
1122631304 14:103108967-103108989 CTGGGGAAGGGGATGAACCAGGG - Intronic
1122631617 14:103109844-103109866 AGGGGGCAGGGCGTGGGCCTGGG - Intronic
1122767252 14:104081148-104081170 CTGGGGCAGGCCTTGGTCCAGGG - Intergenic
1122882339 14:104695719-104695741 CTGGGGCAGACAATGGGCCTGGG - Intronic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1123171474 14:106377037-106377059 CTGGAGCAGGGCATGGCTTTGGG + Intergenic
1123195175 14:106609499-106609521 CTGGAGCAGGGCATGGCTTTGGG + Intergenic
1124597264 15:31101710-31101732 CTTGGCCAGGGCAGGGAGCTGGG + Intronic
1128417636 15:67461396-67461418 CTGGGGCAGGGCACGCAGCAGGG - Intronic
1128551704 15:68601763-68601785 CTGGGGCAGGGCCCAGGCCTGGG + Intronic
1128637051 15:69309318-69309340 CAGGCGCAGGGCATGGGCCACGG + Intronic
1128865852 15:71115083-71115105 CTGGGGCAGGGGACGGACGCGGG - Intronic
1129251646 15:74312515-74312537 CGGGGGCAGGGCAGGGAGCAGGG - Intronic
1129330078 15:74822649-74822671 ATGGAGCAGGGCACCGACCTTGG - Exonic
1129666376 15:77581862-77581884 CTGGGCCAGGGCCTGGGGCTGGG - Intergenic
1129882956 15:79019109-79019131 ATGGGGATGGGCATGGGCCTGGG - Intronic
1130217457 15:81985660-81985682 CTGGAGAATGGCATGAACCTGGG + Intergenic
1130292778 15:82618935-82618957 GTGGGGCAGGGGGTGGAGCTTGG + Intronic
1131004268 15:88963812-88963834 ATGGGTCAGGGAAGGGACCTAGG + Intergenic
1131217707 15:90553024-90553046 ATGAGGCAGGGCAGTGACCTTGG + Intronic
1131845778 15:96489230-96489252 CTGGGTAAGGGCATGGGCTTTGG + Intergenic
1132345657 15:101107247-101107269 CTGGAGGGGGGCATGGCCCTGGG - Intergenic
1132545029 16:528943-528965 CTGGGGCTGGGCAAGGATATAGG + Intronic
1132552375 16:558934-558956 CTGGGGCGGGGCAGGGGACTGGG - Intergenic
1132639889 16:972956-972978 CGGGGGCAGGGCTTGGGCCGGGG + Intronic
1132738067 16:1397278-1397300 CTGGGGCAGGGCGTGGACCTGGG + Intronic
1132738097 16:1397365-1397387 CTGGGGCAGGGCGTGGACCTGGG + Intronic
1132738124 16:1397452-1397474 CTGGGGCAGGGCGTGGACCTGGG + Intronic
1132738151 16:1397539-1397561 CTGGGGCAGGGCATGGACCTGGG + Intronic
1132738180 16:1397626-1397648 CTGGGGCAGGGCGTGGACCTGGG + Intronic
1132738209 16:1397713-1397735 CTGGGGCAGGGCATGGACCTGGG + Intronic
1132738238 16:1397800-1397822 CTGGGGCAGGGCGTGGACCTGGG + Intronic
1132792460 16:1699278-1699300 GTGGGGCAGGGCATGGTCCTTGG + Exonic
1132865737 16:2091893-2091915 CTCCGGCAGGGCATGGTCCTGGG - Exonic
1132959400 16:2613583-2613605 CGCGGGCAGGGCAGGGGCCTAGG - Intergenic
1132972461 16:2695558-2695580 CGCGGGCAGGGCAGGGGCCTAGG - Intronic
1133055828 16:3145057-3145079 TTGGGCCAAGGCATGGAGCTGGG - Intronic
1135416882 16:22275147-22275169 ATGGGGCGGGGCCTGGAGCTGGG + Intronic
1136186276 16:28590680-28590702 CCAGGGCAGGGCATGGAGCCTGG + Intronic
1136188647 16:28602393-28602415 CCAGGGCAGGGCATGGAGCCTGG + Intergenic
1136191117 16:28615387-28615409 CCAGGGCAGGGCATGGAGCCTGG + Intronic
1137582235 16:49640557-49640579 CTGGGGCTGAGCCTGGTCCTAGG + Intronic
1137717660 16:50608580-50608602 CAGGGCCAGGACATGGACCTAGG - Intronic
1137983724 16:53090830-53090852 CTGGGACAGGGCATGGGGGTTGG - Intronic
1138228915 16:55323957-55323979 CTGGCCCAGGGCCTTGACCTTGG - Exonic
1138545704 16:57718238-57718260 CCGGGGCAGAGAAGGGACCTGGG - Intronic
1138659775 16:58510167-58510189 CTGGAGCAGGGCAGAGCCCTAGG + Intronic
1138846128 16:60568595-60568617 CTGAGGCATGGCGTGAACCTGGG + Intergenic
1139778928 16:69334876-69334898 CTGGGCCAGTGCATGTACTTTGG - Exonic
1139917539 16:70437953-70437975 CTGGGGGCAGGCAGGGACCTGGG - Intronic
1140592675 16:76372230-76372252 CAGGAGAATGGCATGGACCTGGG - Intronic
1141349721 16:83283226-83283248 CTGGGGTAGGGCCTGGCCATTGG - Intronic
1141427767 16:83954883-83954905 GAGGGGCAGGGCATGGCCCAGGG + Intronic
1141620886 16:85235978-85236000 CTGGGCCTGGGCCTGGGCCTGGG + Intergenic
1142162539 16:88565945-88565967 CAGAGGCAGGGCTTGGAGCTGGG + Intergenic
1142175221 16:88642158-88642180 CAGGGGCAGGGCAGGGCGCTGGG + Intergenic
1142194248 16:88732288-88732310 CTGGGGCAGGGCTTGGCCTTCGG - Intronic
1142291269 16:89194601-89194623 CTGGGGCAGGGCAGAGCCCCGGG + Intronic
1142381980 16:89738146-89738168 CAGGGGCAGGGCCTTGTCCTGGG - Exonic
1142477952 17:200756-200778 CTGGGCCAGGCCCTGGACCGGGG + Intergenic
1142509734 17:386012-386034 CGCGGGCAGGGCCTGGAGCTGGG - Intronic
1142702756 17:1674113-1674135 CTGGAGAAGGGCGTGAACCTGGG - Intronic
1142881527 17:2885727-2885749 CTGGGGCAGGGAGAGGATCTGGG + Intronic
1143002960 17:3806540-3806562 CTGAGGCAGGGTACTGACCTTGG + Intergenic
1143037061 17:4005394-4005416 ATGGGGCAGGTCCTGGAACTTGG - Exonic
1143176651 17:4959485-4959507 CTGGGGCAGGGCAGGGGGCAGGG - Exonic
1143499222 17:7329259-7329281 CTGGGGGAGGCCCTGGACCGGGG - Exonic
1144494115 17:15736242-15736264 GTGGTGCAGGGAAGGGACCTGGG + Intronic
1144633482 17:16888250-16888272 CTGGGGAATGGCATTCACCTGGG - Intergenic
1144662208 17:17078424-17078446 GTGGGGCAGGGGCTGGCCCTGGG + Intronic
1144728780 17:17514954-17514976 CTGGGGCAGGGCATGGAGCAGGG + Intronic
1144906145 17:18640434-18640456 GTGGTGCAGGGAAGGGACCTGGG - Intronic
1144965766 17:19076522-19076544 CTGGGGCAGAGCTGGGACCCAGG + Intergenic
1144982201 17:19175660-19175682 CTGGGGCAGAGCTGGGACCCAGG - Intergenic
1144986022 17:19202579-19202601 CTGGGGCAGAGCTGGGACCCAGG + Intergenic
1145004259 17:19328600-19328622 CTGGCACAGGGCATAGACCCTGG + Intronic
1145797540 17:27664526-27664548 CTGGCTCAGGGGATGGAACTGGG - Intergenic
1145798540 17:27669472-27669494 CTGGCCCAGGGCTTGGAACTTGG + Intergenic
1145943995 17:28759449-28759471 CTGGGGAGGGGCATGGGCCAGGG + Exonic
1146004913 17:29155017-29155039 TTGGGGCCGGGCATGAAACTGGG + Intronic
1146724839 17:35148434-35148456 CTGGGGCAGGGCAGGGCACAGGG + Intronic
1147362945 17:39943013-39943035 CTGGTGCAGGGAATGGAATTGGG + Intronic
1147711244 17:42467052-42467074 CTGGAGAATGGCATGGACCCGGG + Intronic
1147722600 17:42548124-42548146 CTGGGGCAGGAGATGGGACTTGG + Intergenic
1147864777 17:43545300-43545322 CTGGGGAAGCTCATGGACCCGGG - Exonic
1148650942 17:49249617-49249639 CTGCGGCAGGGCCTGGAGCCCGG - Intergenic
1148773588 17:50080599-50080621 CTGGGGAAAGGCATGGAGGTGGG - Intronic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1148898047 17:50851888-50851910 CTGGGGAAGGGCATTGCCCGGGG + Intergenic
1149237733 17:54612799-54612821 CTGGGGCAGGCCTGGAACCTGGG - Intergenic
1149281516 17:55110413-55110435 CTTGGGGAGGGGATGGGCCTTGG + Intronic
1150422026 17:65045419-65045441 CTGGGTCAGGGCTTGAACCTGGG + Intronic
1150534622 17:66022614-66022636 CAGGAGAAGGGCATGAACCTGGG + Intronic
1150620426 17:66803776-66803798 CTGGGGAGGGGCACGGCCCTGGG - Intronic
1151466452 17:74288893-74288915 CTGGGGCAGAGGACAGACCTTGG + Intronic
1151767588 17:76140234-76140256 CGGGGGCAGGGCGGGGGCCTTGG + Exonic
1151973460 17:77471032-77471054 CTGGGGCAGGGCCTGGAGACGGG + Intronic
1152039460 17:77893569-77893591 CTGGGGCAGGCCATGCACGGTGG - Intergenic
1152244076 17:79176204-79176226 CAGGGCGAGGGCATGGCCCTTGG + Intronic
1152345596 17:79748638-79748660 CTGGGGCGGGGCAGGGACCCGGG + Intergenic
1152945725 17:83196449-83196471 CTGGGGCCTGGCATGGCCCCTGG + Intergenic
1153238042 18:3007262-3007284 CAGGGGAATGGCATGAACCTGGG - Intronic
1153500816 18:5747861-5747883 TTGGTGCAGAGCATGGACTTTGG + Intergenic
1153671198 18:7414235-7414257 CTGGGGCAGGGAGTGGACTGGGG - Intergenic
1154415027 18:14171845-14171867 CTGGGACAGGACAAGGACCAGGG + Intergenic
1155090162 18:22500699-22500721 CTGGAGAATGGCATGAACCTGGG + Intergenic
1155464012 18:26115422-26115444 CAGGAGAAGGGCATGAACCTGGG + Intergenic
1156172499 18:34503378-34503400 CTGGAGAATGGCATGAACCTGGG - Intronic
1156218634 18:35028235-35028257 CAGGGGCAAGGCAGGAACCTAGG + Intronic
1156460678 18:37319797-37319819 CTGGGCCTGGGCCTGGGCCTGGG + Intronic
1157225061 18:45855248-45855270 CTGGGGCAGGGGCTGGAGCTGGG - Intronic
1157476768 18:48028860-48028882 TAGGGGCTGGGCATGCACCTTGG - Exonic
1157665328 18:49481422-49481444 CTGGGCCTGGGTCTGGACCTGGG - Exonic
1158478908 18:57803459-57803481 GTGGGGCAGGAGCTGGACCTGGG - Intergenic
1158542115 18:58366638-58366660 CAGGAGCAGGGCATGGTCCTAGG - Intronic
1159071422 18:63627193-63627215 CTGGGGAAGGTCTTGGTCCTGGG - Intergenic
1160299672 18:77668509-77668531 CTGGGGCATCGCAGTGACCTGGG - Intergenic
1160527839 18:79547778-79547800 CTCGGGCTGGGCATGGAGCGGGG + Intergenic
1160529277 18:79554080-79554102 CTCGGGCAGGCCAGGGGCCTCGG - Intergenic
1160577399 18:79864329-79864351 CTGGGGCTGGGCTGGGATCTGGG + Intronic
1160581005 18:79884542-79884564 CTGGGTCTGGGCCTGGGCCTGGG + Intronic
1160594448 18:79964367-79964389 CACGGGCAGTGCATGGGCCTCGG - Intergenic
1160707350 19:535781-535803 CTGGGGCAGGTCTTGGGGCTGGG + Intronic
1160779274 19:870748-870770 CTGGGGCAGGACATGGAGGGAGG + Intronic
1160849512 19:1183626-1183648 CGGGGGCAGGGCAGGGGCGTTGG + Intronic
1160855540 19:1215540-1215562 CTGGGGCTGGGCCTGGACAAGGG - Intronic
1161211613 19:3068983-3069005 CTGAGGCAGGGCTAGGACCAGGG + Intergenic
1161358635 19:3833908-3833930 CCGGGCCAGGGCCTGGTCCTGGG - Intronic
1161544793 19:4873863-4873885 CTGGGGTAGGTGCTGGACCTAGG + Intergenic
1161994368 19:7703508-7703530 CTTGGACAAGGCCTGGACCTGGG - Intergenic
1162522867 19:11192404-11192426 CGGGGGCTGGGGCTGGACCTTGG + Intronic
1162677212 19:12308107-12308129 CTGGGGCTGGGGCTGGAACTGGG + Intergenic
1162802325 19:13118382-13118404 CTGGGGCCGGGCCTGGGCCCGGG - Exonic
1163229680 19:15992799-15992821 CTAGGGTGGGGCATGGACTTCGG - Intergenic
1163241404 19:16066136-16066158 TTGGGGCAGGCCATGGGGCTGGG - Intergenic
1163560104 19:18014000-18014022 CTGGGGCAGGGCCCCGGCCTGGG + Exonic
1163602491 19:18257463-18257485 GTGGTGCAGGGCATGGGCCAGGG - Exonic
1163766854 19:19168189-19168211 CTGGGGAAGGGCAGGGCCCCTGG - Intronic
1164589014 19:29495996-29496018 CTGTCCCAGGGCATGGAACTAGG - Intergenic
1164621866 19:29700885-29700907 CTGGGGCAGGGCAGGGACTTGGG - Intronic
1164846861 19:31439732-31439754 CTGGGGAAGGGCAGGGCCCTTGG + Intergenic
1164869834 19:31633451-31633473 CGGGGGCAAGACAGGGACCTGGG + Intergenic
1165383776 19:35498637-35498659 CCGGGGCAGGGCCAGGATCTTGG - Intronic
1165475234 19:36026544-36026566 CTGGGAGGGGGCAAGGACCTGGG - Intronic
1165964084 19:39559853-39559875 CTGAGGCAGGAGATGAACCTGGG + Intergenic
1166040273 19:40198186-40198208 CTGGGACAGGGATTAGACCTGGG + Intronic
1166069987 19:40381364-40381386 CTGGGGCAAGGGGTGGAACTTGG - Intronic
1166333004 19:42089515-42089537 CTGGGGCAGGGCCTGTCCCTCGG - Intronic
1166402169 19:42490783-42490805 CAGGGGAATGGCATGAACCTGGG - Intergenic
1166617570 19:44264323-44264345 CTGGGGAAGGGCAGGGTCCTGGG - Exonic
1166643074 19:44511299-44511321 CTGGGCCAGGGCAAGGGCCTGGG - Intronic
1166940646 19:46362878-46362900 CAGGGGAATGGCATGAACCTGGG - Intronic
1167253440 19:48413940-48413962 CTGGGGCCTGGGCTGGACCTTGG - Intronic
1167297236 19:48658487-48658509 GTGGGGCAGGGCAGGGACTTTGG + Intergenic
1167433050 19:49464235-49464257 CTGGGGCAGGCGCTGGAGCTGGG + Exonic
1167691098 19:50983950-50983972 CTGGGGCCGGGCATGGGGCGGGG - Intronic
1167724548 19:51201330-51201352 CTGGGGCAGCTCCAGGACCTGGG - Intergenic
1168056160 19:53866454-53866476 GAGGGGCAGGGCGGGGACCTGGG - Intronic
1168110464 19:54189148-54189170 CTGGGCCTGGGCCTGGGCCTGGG - Intronic
1168110466 19:54189154-54189176 TTGGGGCTGGGCCTGGGCCTGGG - Intronic
925222067 2:2149938-2149960 CTGGGTCAGGGCATGGAGAGTGG - Intronic
925304154 2:2837158-2837180 CTGAGGGAGGGCATGAACCTGGG - Intergenic
925304314 2:2837857-2837879 CTGAGGGAGGGCGTGAACCTGGG - Intergenic
925304378 2:2838082-2838104 CTGAGGGAGGGCATGAGCCTGGG - Intergenic
926052467 2:9753796-9753818 CTGGGGCGGGGCAGCCACCTGGG - Intergenic
926172147 2:10559184-10559206 CTGGGGCTGGGCAGGGGCTTGGG - Intergenic
926690030 2:15726665-15726687 GTGAGGCAGCACATGGACCTTGG - Intronic
927077033 2:19589020-19589042 CTGGGGCAAGGCAGGGACCTGGG - Intergenic
927156870 2:20225538-20225560 CTGGGGCAGGGCGGGGACCCGGG + Intergenic
927757491 2:25720604-25720626 CTGGGGGAAGGCAAGGAACTGGG + Intergenic
928032895 2:27796765-27796787 CTGAGGCAGCGCCTGGAGCTGGG + Intronic
928299284 2:30111302-30111324 CTGGGTAAGGGCGGGGACCTGGG - Intergenic
929464682 2:42133910-42133932 CTGGGGCAGAGCCTGGGACTGGG - Intergenic
929545085 2:42850527-42850549 CTGGGCCAGGGGCTGGAGCTGGG - Intergenic
929823736 2:45293634-45293656 CAGGCACAGAGCATGGACCTAGG + Intergenic
930425561 2:51207893-51207915 CAGGAGAATGGCATGGACCTGGG + Intergenic
932431896 2:71681106-71681128 CAGGGGCTGGGCACTGACCTTGG - Exonic
932537426 2:72614340-72614362 CAGGGGCAGGGCAGGGAACCAGG + Intronic
932863386 2:75317155-75317177 CTGGGGCTTAGCAAGGACCTTGG + Intergenic
933723509 2:85413079-85413101 CTGGGGCTGGGGATGGAAATAGG - Intronic
934322840 2:91983459-91983481 CCGGGGCAGGGCAAGGGCCGGGG - Intergenic
934578037 2:95415274-95415296 CTGGGGCAGTGGCTGGACCAAGG - Exonic
934601401 2:95661428-95661450 CTGGGGCAGTGGCTGGACCAAGG + Intergenic
934662409 2:96150189-96150211 CTGGGCCTGGGCCTGGGCCTGGG + Intergenic
934666036 2:96171437-96171459 CAGGGGAATGGCATGAACCTGGG + Intergenic
934951209 2:98576818-98576840 CTCTGGCAGGGCATGGAGTTGGG + Intronic
935203969 2:100881882-100881904 CTGAAGCAGGCCCTGGACCTGGG - Intronic
936061062 2:109296054-109296076 CTGGGGCAGGGAAGGGATCCTGG - Intronic
936522847 2:113222435-113222457 CTGGGGCAGGGGATGGAGCTCGG + Intronic
936574423 2:113641548-113641570 CTGGGACAGTGCATGGGCCTGGG + Intronic
937120998 2:119439930-119439952 GTGGGGCAGGACAAGGGCCTGGG - Exonic
937148016 2:119663896-119663918 CTTGGCCAAGGCATGGACCCAGG + Intergenic
937446600 2:121963478-121963500 CTGGGCCAGGGCAATGCCCTGGG + Intergenic
937867822 2:126767213-126767235 CTGGGGTGGGGCACAGACCTAGG - Intergenic
937959637 2:127446415-127446437 CGGGGGAATGGCATGAACCTGGG - Intronic
938071683 2:128311722-128311744 CTGGGGCAGAGCAAGGACACTGG + Intronic
938555855 2:132423620-132423642 CTGGGGAAGGGGATGGAAGTGGG - Intronic
939629651 2:144516884-144516906 CTGGGGCAGGGCGGGGGCCCAGG - Intronic
939964128 2:148593906-148593928 CAGGGGAATGGCATGAACCTGGG - Intergenic
940358956 2:152776791-152776813 CTGGGGCATGTCCTGGACATTGG - Intergenic
941621196 2:167781648-167781670 CTCAGGCAGGGAATGGACCATGG + Intergenic
941700579 2:168600295-168600317 CTGGAGAATGGCATGAACCTGGG - Intronic
942480433 2:176381924-176381946 GTGGGGCAGGGGATGGAGATGGG + Intergenic
944690760 2:202156500-202156522 CTGGAGCAGGGTAGGGATCTTGG - Intronic
945972717 2:216245981-216246003 CAGGGGCAGGGAAGAGACCTTGG - Intergenic
946329277 2:219000605-219000627 CAGGGGCAGGGGAAGGTCCTTGG - Intergenic
946390854 2:219416295-219416317 CTGGGTCAAGGAATGGGCCTGGG - Intergenic
946655542 2:221941931-221941953 CTGGTGCAGGGGATGGACTCTGG + Intergenic
946774670 2:223125041-223125063 CTGGGGCAAGGGCAGGACCTTGG + Intronic
947528382 2:230893430-230893452 CTGGGGCTGGGGCTGGAGCTGGG - Intergenic
947874330 2:233458456-233458478 CTGGGGCAGTGCATGGAGCCTGG + Intronic
947930989 2:233964991-233965013 CTGGGCCTGGGTATGGCCCTGGG - Intronic
947966864 2:234289423-234289445 CAGGAGCAGGGCATGGACAGGGG - Intergenic
948125533 2:235562504-235562526 CTGGGGCTGGGGAGGCACCTTGG - Intronic
948640830 2:239375180-239375202 CTGGGGCAGGGCAGCCACGTAGG + Intronic
948650482 2:239440428-239440450 CTGGGGCTGGGCAAGGTCCCTGG - Intergenic
948810580 2:240474186-240474208 CAGGAGAATGGCATGGACCTGGG - Intergenic
948840086 2:240644584-240644606 GTGGGGCAGGGCATTGAGCCTGG - Intergenic
1168918185 20:1508725-1508747 CTGGGGCTGGGGAAGGGCCTAGG - Intergenic
1169119667 20:3087522-3087544 CAGGAGAATGGCATGGACCTGGG + Intergenic
1169136366 20:3200187-3200209 CTGGGCCAGGGCACAGACCCAGG + Intronic
1169210485 20:3763882-3763904 ATGAGGCAGGGCTTGGGCCTGGG - Intronic
1169349298 20:4855322-4855344 CAGCGGCAGGGCATGGTTCTTGG - Exonic
1169853414 20:10077872-10077894 ATGGGGCAGGGACTTGACCTTGG - Intergenic
1170645286 20:18192128-18192150 CAGGGGAATGGCATGAACCTGGG - Intergenic
1170996619 20:21366462-21366484 CAGGGGAATGGCATGAACCTGGG + Intronic
1171122225 20:22577594-22577616 CTGCGGAAAGGCGTGGACCTCGG - Intergenic
1171255935 20:23689090-23689112 CAGGGGCAGGGCATGGAGGTGGG - Intergenic
1171483388 20:25469513-25469535 CTGGGGGAGGGGATGGGCGTGGG - Intronic
1172180405 20:33000045-33000067 CTGGGACTGGGCAGGGCCCTGGG + Intronic
1172180647 20:33001359-33001381 CTGGGGGAGGCCCTGGAGCTGGG + Intronic
1172459151 20:35102488-35102510 CTGGGGCAGAGCTTGTACATAGG - Intergenic
1172887451 20:38240758-38240780 CTAGGGCAGGGCATGGGCTTGGG + Exonic
1173810642 20:45953103-45953125 CTGGCCAAGGGCATGGGCCTGGG + Intronic
1174342998 20:49909640-49909662 GTGGGTAAGGGCATGGACTTTGG - Intronic
1174867033 20:54147454-54147476 CTGGGGCAGGGCCTGAGCTTCGG - Intergenic
1175222206 20:57423724-57423746 CTGGGGCAGGTCTTTGCCCTGGG + Intergenic
1175321725 20:58092947-58092969 CTGGGGAAGGGCCTGCAGCTGGG + Intergenic
1175332511 20:58175214-58175236 CTGGGGCGGGGGATGGAGGTGGG - Intergenic
1175727801 20:61331614-61331636 CTGGGGCAGGAGGTGGGCCTGGG - Intronic
1175822674 20:61918730-61918752 CAGGGGCAGTGCAGGGACCGTGG + Intronic
1175851682 20:62097271-62097293 ATGGGGCATGGCAAGGACCGGGG + Intergenic
1175910488 20:62403019-62403041 CTGGGGAAAGGCCTGGGCCTGGG - Intronic
1175928026 20:62480453-62480475 CTGGGGGAGGCCATGTACCCAGG - Intergenic
1176256431 20:64155442-64155464 CTGGAGCAGGGCAAGGCGCTGGG + Intronic
1176866080 21:14055939-14055961 CAGGGGCAGGGCCAGGACCAGGG + Intergenic
1176866157 21:14056243-14056265 CTGGGACAGGACAAGGACCAGGG + Intergenic
1177958377 21:27629511-27629533 CTGGAGAATGGCATGAACCTGGG + Intergenic
1178080473 21:29058682-29058704 CAGGAGCATGGCATGAACCTGGG - Intronic
1179000369 21:37452195-37452217 CTGAGGGAGGGCATGGAGCCTGG + Intronic
1180793860 22:18592344-18592366 CTGGGGCAGGGCCTGGGTCTAGG - Intergenic
1180843157 22:18968554-18968576 CTGGGGCATGGGATGGGCATGGG - Intergenic
1180927630 22:19567139-19567161 GTGGGGCAGAGCTGGGACCTAGG - Intergenic
1180951565 22:19722830-19722852 CTGGGGCAGGGAACAGACCCAGG - Exonic
1181014604 22:20061894-20061916 CTGGGCCTGGGCCTGGGCCTGGG - Intronic
1181058315 22:20270180-20270202 CTGGGGCATGGGATGGGCATGGG + Intronic
1181227880 22:21402976-21402998 CTGGGGCAGGGCCTGGGTCTAGG + Intergenic
1181250773 22:21531863-21531885 CTGGGGCAGGACCTGGGTCTAGG - Intergenic
1181406231 22:22686829-22686851 CTGGAGCAGGGCCTGGAGCAGGG - Intergenic
1181514855 22:23404633-23404655 CTGGGGCATGGGATGGGCATGGG + Intergenic
1181671254 22:24426554-24426576 ATGGGGAAGGGAATGGAGCTGGG + Intronic
1181770462 22:25121367-25121389 CAGGAGAAGGGCATGAACCTGGG + Intronic
1182120637 22:27784179-27784201 CAGGAGCAGGGGATGCACCTAGG + Intronic
1182422747 22:30256516-30256538 CTGGGGCAGGGTGGGGACCTGGG - Intergenic
1182466051 22:30516983-30517005 CAGGGGCAGGGCTTGGACACTGG - Intergenic
1182785885 22:32907322-32907344 CTGGGCCAGAACATGGACCCAGG + Intronic
1182834728 22:33332796-33332818 CTGGGGCTGGGGCTGGAGCTGGG - Intronic
1183304827 22:37076960-37076982 CTGGGGAAGTGCCTGGCCCTTGG - Intronic
1183371577 22:37435544-37435566 CTGGAGCAGGGCCTGGAGATGGG + Intergenic
1183630271 22:39028363-39028385 CTGGGGCGGTGGATGGAGCTGGG - Intronic
1183891966 22:40936986-40937008 CAGGGGAATGGCATGAACCTGGG - Intergenic
1184046618 22:41976431-41976453 CTGGAGCAGGGCCTGGAACCCGG + Intronic
1184089047 22:42282936-42282958 CTGGGCCAGGGCCTCGGCCTGGG + Intronic
1184200181 22:42963188-42963210 GTGGGCCGGGGCAGGGACCTTGG - Intronic
1184245599 22:43234453-43234475 ATGGGGCAGGGGATGGGGCTGGG - Intronic
1184594788 22:45507156-45507178 CTGGGGCTGGGCCTAGAGCTGGG + Intronic
1184695651 22:46137491-46137513 CTGGGGTAGGGCCTGGCTCTTGG - Intergenic
1184698379 22:46151727-46151749 CTGGGTCAGGGCAAGGACACGGG + Intronic
1184715944 22:46281905-46281927 CTAGGGCAAGGTATGGGCCTGGG - Intronic
1185045281 22:48525555-48525577 CTGAGGCAGAGGGTGGACCTGGG - Intronic
1185061036 22:48607128-48607150 CGGAGGCAGTGCATGGATCTGGG + Intronic
1185258308 22:49848688-49848710 CTGGGGCTGGACGTTGACCTAGG + Intergenic
1185322742 22:50209410-50209432 CTGGGGCAGGACACAGCCCTAGG - Intronic
1185365973 22:50436896-50436918 CCTGGGCTGGGCATGGTCCTGGG + Intronic
1185388736 22:50548007-50548029 CTGGGGCAGGGGATGCGGCTGGG - Intergenic
1185388757 22:50548055-50548077 CTGGGGCAGGGGATGCGGCTGGG - Exonic
949852135 3:8430082-8430104 CTGGGGCTGGGCCTAGAGCTTGG - Intergenic
950044643 3:9941695-9941717 CAGGAGAAGGGCATGAACCTGGG + Intronic
950111374 3:10420910-10420932 CTGGGGCATGGCCCGGACCTTGG + Intronic
950158809 3:10743648-10743670 CTGAGGCTGGGCAGGGCCCTAGG + Intergenic
950413855 3:12856876-12856898 CTGGGGCAGGGCCAGGTGCTGGG - Intronic
950712359 3:14821352-14821374 CTGGGGAAGGAGATGGACCGTGG - Exonic
952291846 3:32024581-32024603 CTGAGGCAGGACTTGAACCTGGG - Intronic
952315115 3:32225752-32225774 CTGGGGTAGGGCTTGGACTTTGG + Intergenic
952732105 3:36649468-36649490 CTGAAGCCAGGCATGGACCTTGG - Intergenic
952822329 3:37496012-37496034 CTGGGGAAGGGCATGGGACATGG + Intronic
953660907 3:44890949-44890971 CTGGGGCAGGGCGAGGCACTGGG - Intronic
953741731 3:45544513-45544535 CTAGGGCAGAGCGTGGCCCTGGG - Intronic
954132774 3:48568750-48568772 CTGGGCCTGGGCCTGGGCCTGGG + Intronic
954193615 3:48982829-48982851 CTGGGGCAGGGCCTGTACACGGG - Intronic
954610329 3:51941689-51941711 CTGGGGAAGGGCCGGGACCCAGG + Intronic
955192893 3:56778355-56778377 CTGGGGTAGGGCATGGGCTCTGG - Intronic
955772188 3:62396345-62396367 TTGGGAAAGGGCATGGACATAGG + Intergenic
956434951 3:69225600-69225622 CTGGAGAATGGCATGAACCTGGG + Intronic
956633394 3:71338518-71338540 CAGGAGAATGGCATGGACCTGGG - Intronic
956736965 3:72245537-72245559 CTGGGGCAAGGGATGGCTCTGGG - Intergenic
961269773 3:125680229-125680251 CTGGGGCTGGGTATCAACCTGGG - Intergenic
963068362 3:141281647-141281669 CTGGGGCAGGGAGGGGACATGGG + Intronic
963832320 3:150021513-150021535 CAGGAGAAGGGCATGAACCTGGG + Intronic
964312070 3:155404432-155404454 CTAGGGCAGGGCACAGGCCTGGG - Intronic
965928291 3:174009918-174009940 AGGGGACAGGGCATGGATCTGGG + Intronic
967224204 3:187275356-187275378 CTGAGTCAGGGCAAGGTCCTGGG - Intronic
967646007 3:191924899-191924921 CAGGAGCATGGCATGAACCTGGG - Intergenic
967871650 3:194234789-194234811 GTGGGGCAGGGCATGGAGAGTGG - Intergenic
968180399 3:196591050-196591072 GTGGGGGAGGGCATGGAACAGGG + Intergenic
968487208 4:868455-868477 CTGGGGCAGGGCAAGCGTCTTGG - Intronic
968595486 4:1480154-1480176 CTTTGGGAGGGCATGGACCATGG - Intergenic
968619918 4:1599375-1599397 CGGGGGCAGGGCATGGCACCTGG + Intergenic
968699645 4:2048419-2048441 CTGTGGCTGGGCAGGGACCCTGG + Intergenic
968859354 4:3153995-3154017 CTGTTGGAGGGCATGGGCCTGGG + Intronic
968951933 4:3699897-3699919 CTGGGGCCAGGCAGGAACCTTGG + Intergenic
969240196 4:5892498-5892520 CGGGGCCCGGGCATGGCCCTCGG + Intronic
969525101 4:7700282-7700304 CTGTGGCAGGGCCTGAAACTGGG + Intronic
969530003 4:7725347-7725369 GTGGGGCAGAGCATGGCCCCAGG + Intronic
969628281 4:8319808-8319830 CTGGGGCAGGCCATGGTGCCAGG - Intergenic
970747847 4:19320902-19320924 CAGGGGAATGGCATGAACCTGGG - Intergenic
970790220 4:19849495-19849517 CTGGGGCAGGGCATGTTTTTAGG - Intergenic
971239522 4:24875235-24875257 CAGGAGAAGGGCATGAACCTGGG + Intronic
975347717 4:73312525-73312547 CAGGGGGATGGCATGGACCCAGG + Intergenic
978110336 4:104956195-104956217 CTGGGGCAGGGAGTGGGGCTGGG - Intergenic
979037508 4:115742933-115742955 CTGACGCAGGGCATAAACCTGGG + Intergenic
979713757 4:123811997-123812019 ATGGGGCAGGGCATGGTACAGGG - Intergenic
982077575 4:151753088-151753110 CTGGGGCAGGGAAAAGAACTGGG + Intronic
982353535 4:154442878-154442900 CATGAGGAGGGCATGGACCTTGG - Intronic
983484716 4:168319821-168319843 GTGGAGCAGTGCCTGGACCTTGG - Intergenic
985660097 5:1152680-1152702 CTGAGGCAGTGCATGGTCCGGGG - Intergenic
985973596 5:3396983-3397005 CATATGCAGGGCATGGACCTAGG + Intergenic
986253354 5:6081409-6081431 CTGGGGGAGGAGATGAACCTAGG - Intergenic
986333872 5:6738340-6738362 CTGGGGCAGGGCTTTGTCCTAGG - Intronic
987294381 5:16537136-16537158 TTGGTGCAGGGCCTGGCCCTTGG - Intronic
987294878 5:16541020-16541042 CTGGGGCAGTGCAGCGACCAAGG - Intronic
987342800 5:16953431-16953453 CTGGGGCAGTGTCTGGAACTAGG - Intergenic
987502457 5:18731478-18731500 CTGGAGAATGGCATGAACCTGGG - Intergenic
989321866 5:40144353-40144375 CAGGGGAATGGCATGAACCTGGG - Intergenic
990459812 5:56020716-56020738 CAGGAGAAGGGCATGAACCTGGG - Intergenic
990471894 5:56123173-56123195 CTTGTGCAGGGCCTGAACCTTGG + Intronic
991581716 5:68162429-68162451 CTGGAGAATGGCATGAACCTGGG + Intergenic
992212747 5:74496750-74496772 CTGAGGCAGGGCATGGGGGTGGG - Intergenic
993020812 5:82588238-82588260 TTGTGGTAAGGCATGGACCTAGG + Intergenic
993898855 5:93571044-93571066 GTGGGGCCGGGCCTGGACTTCGG + Intergenic
995164389 5:109022192-109022214 CTTGGGCAGGGCATGGAAGTGGG - Intronic
995869045 5:116725044-116725066 CTGGGGAGGGGCAAGGTCCTTGG + Intergenic
996731792 5:126724248-126724270 TTGGGACGGGGCATGGACTTTGG - Intergenic
997353402 5:133247019-133247041 CTAGGGAAGGGCATGAGCCTGGG - Intronic
997460286 5:134047239-134047261 CTGGGGGAGGGCAGGAACCCTGG + Intergenic
998415017 5:141939920-141939942 CTGGGCCAGGGTGAGGACCTGGG + Exonic
998839031 5:146233631-146233653 CCGGGCCTGGGCCTGGACCTGGG - Exonic
998856600 5:146400400-146400422 CTGGGGCAGTGCATGGCATTTGG + Intergenic
998862615 5:146459077-146459099 CTGGGCCTGGGCCTGGGCCTGGG - Exonic
998862618 5:146459083-146459105 CTGGGCCTGGGCCTGGGCCTGGG - Exonic
1000160929 5:158597237-158597259 CTGGGGCTGGGGCTGGAGCTAGG - Intergenic
1001094079 5:168762724-168762746 CTGGGGCTGTGCGTGGAACTCGG - Intronic
1001148478 5:169205192-169205214 CTTGGACAGGGCATGGCGCTGGG + Intronic
1001934713 5:175695860-175695882 CTGGCTCAGGCCTTGGACCTGGG - Intergenic
1002086207 5:176777146-176777168 ATGGGGCAGGGCCTGGCCCCAGG - Intergenic
1002189652 5:177472048-177472070 CTGGGGCAGGGCTGGGACAATGG + Intronic
1002235385 5:177799490-177799512 CTGGGGCCTGGTATGTACCTGGG - Intergenic
1002278740 5:178118956-178118978 CTGGAGAATGGCATGAACCTGGG - Intronic
1002298977 5:178247038-178247060 CTGGGGCAGGGCATGCAGGCAGG + Intronic
1002434632 5:179223013-179223035 CTGGTGGAGGGCATGGGCCCAGG - Intronic
1002465356 5:179405652-179405674 CTGTGGCAGGGCAGGGACAGGGG + Intergenic
1002571162 5:180140082-180140104 CTGGGGCCTGGCCTGGACCCAGG + Intronic
1003746961 6:9012944-9012966 CTGGAGAATGGCATGAACCTGGG + Intergenic
1005452920 6:25991868-25991890 CTGGGGGCGGGCATGGACCTGGG - Intergenic
1005810270 6:29509884-29509906 GTGGCACAGGGCATGGTCCTGGG + Intergenic
1005840599 6:29742520-29742542 CAAGTGCAGGTCATGGACCTGGG - Intergenic
1005840870 6:29743886-29743908 CTGGAACAGGGGATGGACATTGG - Intergenic
1006084417 6:31586321-31586343 CTGGGAATGGGCAGGGACCTTGG + Intronic
1006131254 6:31870744-31870766 CTGGGGCCGGGCATGGCCCAGGG + Intronic
1007174098 6:39884621-39884643 CTGGGGCTGGGCCTGGGCCTGGG + Intronic
1007174100 6:39884627-39884649 CTGGGCCTGGGCCTGGGCCTGGG + Intronic
1007222657 6:40291419-40291441 CCAGGGCAGAGCATGCACCTTGG + Intergenic
1007559323 6:42793234-42793256 CAGGAGAATGGCATGGACCTGGG - Intronic
1007709306 6:43811678-43811700 AGAGGGCAGTGCATGGACCTTGG + Intergenic
1008284646 6:49633290-49633312 CTGGCACTGGGCATGGAACTAGG + Intronic
1009386387 6:63087267-63087289 CAGGGGAATGGCATGAACCTAGG + Intergenic
1009849688 6:69180083-69180105 GTGTGGCAAGGCATGGAGCTGGG + Intronic
1011678745 6:89762273-89762295 ATGGGGGAGGGCATGGGGCTGGG - Intronic
1011714254 6:90088006-90088028 TGGGGGCAGGGCATGGAGGTGGG - Intronic
1011817872 6:91213822-91213844 TTGGGGGAGGGCATGAATCTTGG - Intergenic
1016760005 6:147726533-147726555 CGGGGCCTGGGCCTGGACCTGGG - Intronic
1017966477 6:159271138-159271160 CTGGGGAAGGGCCAGGACCTCGG - Intronic
1018358025 6:163038159-163038181 CTGGGGCAGGATTTGGACTTAGG + Intronic
1018849037 6:167574702-167574724 CTGGGCCAGGGAGTGGACATTGG - Intergenic
1018855391 6:167670691-167670713 CTGGGGAAGGGCCTGTCCCTGGG - Intergenic
1018950419 6:168375086-168375108 CTGGGACAGGGAGTGGGCCTTGG + Intergenic
1019047535 6:169160371-169160393 CAGGTGCAGGGCCTGGAACTCGG - Intergenic
1019303691 7:322374-322396 CGGGGGCGGGGCCTGGGCCTCGG - Intergenic
1019392299 7:795160-795182 CTGGGGCAGGGCCTAAACCCAGG + Intergenic
1019578062 7:1746980-1747002 CTTGCGCAGGGCATGGCCCGCGG - Exonic
1019581675 7:1767015-1767037 CTGGGGCCTGGCATGTAACTGGG + Intergenic
1019641359 7:2105468-2105490 CTGGGGCAAGGCAGGGAGCGTGG + Intronic
1019919574 7:4154914-4154936 CTGTGGCAGAGCATGGATTTTGG - Intronic
1019939189 7:4275826-4275848 CTGGAGAATGGCATGAACCTGGG + Intergenic
1020061528 7:5156065-5156087 GGGGGGCAGGGCATGAAGCTTGG - Intergenic
1020142515 7:5620479-5620501 CAGAGGCAGGGCCTGAACCTCGG - Intronic
1020166629 7:5812595-5812617 GGGGGGCAGGGCATGAAGCTTGG + Intergenic
1020195479 7:6034824-6034846 CTGGAGCAGGGAATGAACTTCGG + Intronic
1022530918 7:31066338-31066360 CTGGGGTGGGACAGGGACCTCGG + Intronic
1023801523 7:43839044-43839066 CTGGGGCAGCGCGGGGCCCTCGG + Intergenic
1023964867 7:44958132-44958154 CAGGGGAATGGCATGAACCTGGG + Intergenic
1024134852 7:46396118-46396140 CTGGGGCACGGCATGCATATAGG + Intergenic
1024222436 7:47299028-47299050 CTGGGGCAGGGCACAGGCCCTGG + Intronic
1025186774 7:56866705-56866727 CTGGAGAATGGCATGAACCTGGG - Intergenic
1025840005 7:65137294-65137316 CTGGGTAAGGGCATGGGCTTTGG + Intergenic
1025883059 7:65558670-65558692 CTGGGTAAGGGCATGGGCTTTGG - Intergenic
1025890385 7:65643935-65643957 CTGGGTAAGGGCATGGGCTTTGG + Intergenic
1025988742 7:66478623-66478645 CTGGGCCTGGGCTTGGGCCTGGG - Intergenic
1026847018 7:73704107-73704129 CTGGGGCGGGGCCTGGAGCCTGG - Intronic
1027188579 7:75985522-75985544 CCGGGGCTGGGCAAGGGCCTCGG + Intronic
1027858570 7:83545310-83545332 CTGGGGGAAGGCATGGCCCCAGG - Intronic
1029029134 7:97450186-97450208 CTGGAGAATGGCATGAACCTGGG + Intergenic
1029254064 7:99257181-99257203 CTGCGGCAGGGCATGGACGCTGG - Intergenic
1029448796 7:100629223-100629245 CAGGGCCAGGGCCTGGGCCTGGG - Intronic
1029491780 7:100874765-100874787 CTCGGGCAGGGCGTGGGCTTGGG - Intergenic
1029552270 7:101243693-101243715 GGGGGGAAGGGCATGGGCCTAGG + Intronic
1029606554 7:101602671-101602693 CTGGTGCAGGGCCTGGCCCAGGG - Intergenic
1029653737 7:101911167-101911189 CTGGGCCTGGGCCTGGGCCTTGG + Intronic
1031180748 7:118411997-118412019 CTGGGTCTGGGCCTGGGCCTGGG + Intergenic
1031852099 7:126878070-126878092 CTGGGTAAGGGCATGGGCTTTGG - Intronic
1032421462 7:131783121-131783143 AGGGGGCAGGGCATGGGGCTTGG + Intergenic
1032497004 7:132369973-132369995 CAGGAGCATGGCATGAACCTGGG + Intronic
1032504062 7:132422729-132422751 CTGGAACAGGGCCTGGGCCTTGG - Intronic
1032516598 7:132510693-132510715 CTTGGGGAGGGCATGGAATTTGG + Intronic
1033047360 7:137974771-137974793 CTGGGGCAGGCCAGGCACCTAGG - Intronic
1033290193 7:140076968-140076990 GTGGGGTAGGGGAGGGACCTTGG - Intergenic
1034086892 7:148329866-148329888 CTGGGGCAGGCCCTGGCCCGGGG - Intronic
1034175338 7:149095263-149095285 CAGGAGAATGGCATGGACCTGGG - Intergenic
1034421635 7:150993852-150993874 CTGGGGCTGGGGCTGGGCCTTGG + Exonic
1034657115 7:152738713-152738735 CTGAGGCAGGAGATGAACCTGGG - Intergenic
1036773123 8:11592456-11592478 CTGGGGCATGGAAAGGACCCAGG - Intergenic
1037425552 8:18751055-18751077 CTTGGGCAGTTGATGGACCTGGG + Intronic
1037624596 8:20595948-20595970 CTGGGGAAGGCCCTGGAGCTGGG - Intergenic
1037671323 8:21017620-21017642 CTGGGGCAGGCTGTGGACTTTGG - Intergenic
1037837356 8:22221989-22222011 CTGGGGGAGGGCTGGGAGCTGGG - Intronic
1038518389 8:28206680-28206702 CTGGGCCTGGGCCTGGGCCTGGG - Intergenic
1039839860 8:41285755-41285777 CTGGGGTGAGGCAGGGACCTAGG + Intronic
1040049604 8:43000053-43000075 CAGGGGAATGGCATGAACCTGGG + Intronic
1040866641 8:52054647-52054669 CAGGGGCAGGGCTGGGACCGAGG + Intergenic
1040991322 8:53353213-53353235 CTGAGGCAGGTCCTGGCCCTAGG + Intergenic
1041005966 8:53497273-53497295 ATGAGACAGGGCATGGGCCTGGG + Intergenic
1041023264 8:53658957-53658979 CTGGGGTGGGGCATGGGCCCTGG - Intergenic
1041917731 8:63153032-63153054 CTGGCGCCGGTCATGGACTTGGG - Intergenic
1043889920 8:85643668-85643690 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043891458 8:85655576-85655598 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043892531 8:85662413-85662435 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043893026 8:85714922-85714944 CTGAGGCCGGGCATGGAGCTGGG - Intergenic
1043895713 8:85736376-85736398 CTGAGGCCGGGCATGGAGCTGGG - Intergenic
1043896966 8:85745432-85745454 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043899290 8:85763799-85763821 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043900900 8:85775993-85776015 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043902864 8:85791268-85791290 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043904474 8:85803461-85803483 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043906086 8:85815652-85815674 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1043907694 8:85827842-85827864 CTGAGGCCGGGCATGGAGCTGGG + Intergenic
1044239791 8:89875469-89875491 CTGTGGCAGTGCAAGAACCTTGG + Intergenic
1046752588 8:117941035-117941057 ATGGGGCAGGGCAGGAAGCTGGG - Intronic
1047633541 8:126734447-126734469 CTGAGGCAGGGCTTGAACCTGGG - Intergenic
1047918630 8:129609731-129609753 CTGGGGCAGAGCGTGGAAGTAGG - Intergenic
1048199463 8:132359834-132359856 ATGTGGCAGTGCATGGGCCTGGG - Intronic
1048494136 8:134921261-134921283 CTGGGTCAGGGCTGGAACCTGGG + Intergenic
1049146660 8:141005615-141005637 CAGGGGCAGGGGATGCCCCTAGG + Intergenic
1049571602 8:143372530-143372552 CTGGGGGAGGCCAGGGTCCTGGG + Intronic
1049615085 8:143572499-143572521 CTGAGGCAGAGCCTGGACGTGGG - Exonic
1049627451 8:143631901-143631923 CGGAGGCAGGGCTTGGACATGGG - Intergenic
1049709818 8:144058441-144058463 CTGGGCCTGGGCCTGGGCCTTGG - Intronic
1049799837 8:144512644-144512666 GTGGGCCAGGGCCTGGAGCTGGG + Exonic
1049800545 8:144515638-144515660 CTAGGGTAGGGCCTGGACCAGGG + Intronic
1050140279 9:2510394-2510416 CTGGTGCCGGTCATGGACTTGGG + Intergenic
1050596719 9:7211570-7211592 CTGGGCCTGGGCCTGGGCCTGGG - Intergenic
1052306027 9:27010580-27010602 CAGGAGCATGGCATGAACCTGGG - Intronic
1052803012 9:32987604-32987626 CTGGGACAGGGCTGGAACCTGGG - Exonic
1053124078 9:35565314-35565336 CTGGGGCAGGGGAGGGTCCTGGG + Intergenic
1053167755 9:35856556-35856578 CTGGGGCAGAGGATGGACTTTGG + Intergenic
1053541276 9:38976457-38976479 CAGGAGCATGGCATGAACCTGGG - Intergenic
1053805698 9:41799502-41799524 CAGGAGCATGGCATGAACCTGGG - Intergenic
1054172634 9:61855669-61855691 CTGGGGCTGGGGATGGGGCTGGG + Intergenic
1054447485 9:65384680-65384702 CTGGGGCTGGGGATGGGGCTGGG + Intergenic
1054624862 9:67387451-67387473 CAGGAGCATGGCATGAACCTGGG + Intergenic
1054664906 9:67725132-67725154 CTGGGGCTGGGGATGGGGCTGGG - Intergenic
1055693901 9:78862206-78862228 CAAGGGCAGGGCCTAGACCTAGG - Intergenic
1056088864 9:83184965-83184987 CTGGGGCAGAGCCTGGGTCTGGG - Intergenic
1056329711 9:85511315-85511337 CTGGGGCTGGGCCAGGGCCTGGG - Intergenic
1057181164 9:93031305-93031327 CTGGAGCTGAGCAGGGACCTGGG - Intronic
1057515153 9:95714361-95714383 CTGGGGAAGGGCATGAACCAGGG + Intergenic
1060072157 9:120559392-120559414 CAGGAGAAGGGCATGAACCTGGG + Intronic
1060084655 9:120686180-120686202 CTGGAGAATGGCATGAACCTGGG - Intronic
1060156131 9:121321035-121321057 CTGGGGCAGGGCATGGTATGAGG + Intronic
1060827144 9:126693824-126693846 CCGGGGCAGGGCCTGGGCCAGGG + Exonic
1060827183 9:126693918-126693940 CTGGGCCAGGGCTGGGACCGGGG + Intronic
1061038278 9:128125482-128125504 TGGGGGCAGGGCCTGGGCCTGGG - Intronic
1061057651 9:128232908-128232930 CTGGGGCAGGGCCAGGCCCATGG - Intronic
1061188304 9:129067996-129068018 CTGGGGCAGGGCAGGAACCGGGG - Intronic
1061393955 9:130333164-130333186 CTGGGGCATGCCGGGGACCTGGG + Intronic
1061785779 9:133027386-133027408 CCGGGTCAGGGCATGGTCATAGG - Intergenic
1062013241 9:134277976-134277998 CTGTGGCAGGGCAGGGGACTTGG + Intergenic
1062029770 9:134356951-134356973 CTGGGCATGGGCATGGGCCTTGG - Intronic
1062129847 9:134886340-134886362 CTGGGGCAGGGCCTGGAAGGAGG - Intronic
1062159484 9:135072032-135072054 CTGGAGAATGGCATGAACCTGGG + Intergenic
1062355719 9:136161086-136161108 CTGGGCCAGGCCAGGGTCCTGGG + Intergenic
1062426171 9:136507234-136507256 CAGGGGCAGGGCAGGCACCCCGG - Intronic
1062540821 9:137040942-137040964 CGGGGGCAGGGGCTGGAGCTGGG - Exonic
1062600909 9:137318258-137318280 GTGGGGCTGGGCAGGGACCCTGG - Intronic
1062629065 9:137455533-137455555 TTTGGGCAGGCCAGGGACCTGGG - Intronic
1185601844 X:1345580-1345602 CAGGAGAATGGCATGGACCTGGG - Intronic
1185952211 X:4449855-4449877 CAGGGGGAGGGCAGGCACCTTGG - Intergenic
1186640302 X:11448660-11448682 CTGGGGGTGGGCCTGGACATTGG + Intronic
1187905074 X:24058227-24058249 TTGGGGCAGGGCTGGGACCAGGG + Intronic
1188557725 X:31430893-31430915 CTGGAGAATGGCATGAACCTGGG - Intronic
1190325946 X:49206885-49206907 TTGGGTCTGGGCCTGGACCTGGG + Intronic
1191063044 X:56319119-56319141 CTGGAGCTGGGCCTGGCCCTTGG - Intergenic
1191146674 X:57173037-57173059 GTGGGGAAGGGCATGGTCCCTGG - Intergenic
1192024416 X:67433531-67433553 CTTAGTGAGGGCATGGACCTTGG - Intergenic
1192177785 X:68896536-68896558 CAGGAGAATGGCATGGACCTGGG + Intergenic
1192395048 X:70772018-70772040 CTGAGGCAGGCCATGAACTTGGG - Intronic
1194284707 X:91995940-91995962 CAGGAGAATGGCATGGACCTGGG - Intronic
1195095118 X:101494099-101494121 CTGGGGCTGGGGCTGGGCCTGGG + Exonic
1195317450 X:103692957-103692979 TTGGGGCAGGAGATGGAACTTGG + Intergenic
1195942361 X:110176693-110176715 TTGGGGCAGGGCAGTGCCCTGGG + Exonic
1198156021 X:133961615-133961637 CTTGGGCTGGGCATAGTCCTTGG - Intronic
1199017619 X:142837271-142837293 CAGGAGAAGGGCATGAACCTGGG - Intergenic
1199827830 X:151516903-151516925 CTGTGGCTAGGCAGGGACCTTGG + Intergenic
1200138154 X:153884945-153884967 CAGGGGCAGGGTATCTACCTGGG + Intronic
1200247414 X:154533533-154533555 CTGCGACAGGGCATGCTCCTGGG + Intronic
1200602272 Y:5220510-5220532 CAGGAGAATGGCATGGACCTGGG - Intronic
1200690462 Y:6303544-6303566 GTAGGGGAGGGCATGGTCCTTGG - Intergenic
1200874025 Y:8134003-8134025 CAGGAGAAGGGCATGAACCTGGG + Intergenic
1201044812 Y:9871172-9871194 GTAGGGGAGGGCATGGTCCTTGG + Intergenic