ID: 1132739567

View in Genome Browser
Species Human (GRCh38)
Location 16:1404783-1404805
Sequence CGTGTACCCCGTCACGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 13}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132739567_1132739577 30 Left 1132739567 16:1404783-1404805 CCATCCACGTGACGGGGTACACG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1132739577 16:1404836-1404858 TGGGCTTCTATCCACACAATGGG 0: 1
1: 0
2: 0
3: 14
4: 97
1132739567_1132739573 10 Left 1132739567 16:1404783-1404805 CCATCCACGTGACGGGGTACACG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1132739573 16:1404816-1404838 TCCACAAGACAGGGTAAACGTGG 0: 1
1: 0
2: 0
3: 3
4: 71
1132739567_1132739576 29 Left 1132739567 16:1404783-1404805 CCATCCACGTGACGGGGTACACG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1132739576 16:1404835-1404857 GTGGGCTTCTATCCACACAATGG 0: 1
1: 0
2: 0
3: 10
4: 101
1132739567_1132739571 1 Left 1132739567 16:1404783-1404805 CCATCCACGTGACGGGGTACACG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1132739571 16:1404807-1404829 AGGCTTCCGTCCACAAGACAGGG 0: 1
1: 0
2: 0
3: 12
4: 117
1132739567_1132739570 0 Left 1132739567 16:1404783-1404805 CCATCCACGTGACGGGGTACACG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1132739570 16:1404806-1404828 CAGGCTTCCGTCCACAAGACAGG 0: 1
1: 0
2: 0
3: 4
4: 91
1132739567_1132739575 11 Left 1132739567 16:1404783-1404805 CCATCCACGTGACGGGGTACACG 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1132739575 16:1404817-1404839 CCACAAGACAGGGTAAACGTGGG 0: 1
1: 0
2: 0
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132739567 Original CRISPR CGTGTACCCCGTCACGTGGA TGG (reversed) Intronic
904489599 1:30850243-30850265 CATGTGCCCCGTCACCTGCAGGG - Intergenic
918985350 1:191617858-191617880 CGTGTACCCAGTCACTGGGTGGG - Intergenic
1091584209 12:1806692-1806714 CATGCACCCAGTCACCTGGAGGG + Intronic
1121813403 14:96911205-96911227 CTTGTAACCAGTCACGTGGCAGG + Intronic
1132739567 16:1404783-1404805 CGTGTACCCCGTCACGTGGATGG - Intronic
1132739572 16:1404813-1404835 CGTTTACCCTGTCTTGTGGACGG - Intronic
1147734065 17:42623393-42623415 CCTGTACCCAGTCACTTGGGGGG + Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1163720601 19:18896432-18896454 CGTGCCCCCCGTCACGGGCACGG - Intronic
932712352 2:74076369-74076391 TGTGTACCCCATCAGGAGGAAGG + Intronic
933986527 2:87596347-87596369 CTTGGACCCAGGCACGTGGAGGG - Intergenic
936307311 2:111354454-111354476 CTTGGACCCAGGCACGTGGAGGG + Intergenic
953546260 3:43865652-43865674 CATGTACCCCATCACCAGGAAGG + Intergenic
1021839811 7:24713458-24713480 CCTGAACCCCGTCACAGGGAAGG + Intronic
1185752957 X:2628693-2628715 CCTGTACCCCATCAACTGGAAGG + Intergenic