ID: 1132745256

View in Genome Browser
Species Human (GRCh38)
Location 16:1433716-1433738
Sequence GATTCCAGGTGAGCAGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132745237_1132745256 22 Left 1132745237 16:1433671-1433693 CCACCCACCAGGGCCCCCAGGTG No data
Right 1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG No data
1132745245_1132745256 8 Left 1132745245 16:1433685-1433707 CCCCAGGTGAGGCTGAGGGCCCA No data
Right 1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG No data
1132745241_1132745256 15 Left 1132745241 16:1433678-1433700 CCAGGGCCCCCAGGTGAGGCTGA No data
Right 1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG No data
1132745238_1132745256 19 Left 1132745238 16:1433674-1433696 CCCACCAGGGCCCCCAGGTGAGG No data
Right 1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG No data
1132745247_1132745256 6 Left 1132745247 16:1433687-1433709 CCAGGTGAGGCTGAGGGCCCAGC No data
Right 1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG No data
1132745244_1132745256 9 Left 1132745244 16:1433684-1433706 CCCCCAGGTGAGGCTGAGGGCCC No data
Right 1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG No data
1132745240_1132745256 18 Left 1132745240 16:1433675-1433697 CCACCAGGGCCCCCAGGTGAGGC No data
Right 1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG No data
1132745246_1132745256 7 Left 1132745246 16:1433686-1433708 CCCAGGTGAGGCTGAGGGCCCAG No data
Right 1132745256 16:1433716-1433738 GATTCCAGGTGAGCAGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132745256 Original CRISPR GATTCCAGGTGAGCAGCAAG GGG Intergenic
No off target data available for this crispr