ID: 1132745469

View in Genome Browser
Species Human (GRCh38)
Location 16:1434478-1434500
Sequence AGGGCCCTGCGGAGGCCAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 456}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132745469_1132745474 -9 Left 1132745469 16:1434478-1434500 CCTCCTGGCCTCCGCAGGGCCCT 0: 1
1: 0
2: 2
3: 40
4: 456
Right 1132745474 16:1434492-1434514 CAGGGCCCTGAGCTTTATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 177
1132745469_1132745479 27 Left 1132745469 16:1434478-1434500 CCTCCTGGCCTCCGCAGGGCCCT 0: 1
1: 0
2: 2
3: 40
4: 456
Right 1132745479 16:1434528-1434550 CAGCCACCTGTCCAGAGATGCGG 0: 1
1: 0
2: 2
3: 20
4: 294
1132745469_1132745473 -10 Left 1132745469 16:1434478-1434500 CCTCCTGGCCTCCGCAGGGCCCT 0: 1
1: 0
2: 2
3: 40
4: 456
Right 1132745473 16:1434491-1434513 GCAGGGCCCTGAGCTTTATGAGG 0: 1
1: 0
2: 0
3: 12
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132745469 Original CRISPR AGGGCCCTGCGGAGGCCAGG AGG (reversed) Exonic
900149240 1:1171016-1171038 AGGTTCCTGCGCAGGGCAGGTGG - Intergenic
900213122 1:1467232-1467254 AGGGCCCAGCAGAGGAAAGGGGG - Intronic
900368430 1:2320865-2320887 AGTGCCAGGCAGAGGCCAGGAGG + Intergenic
900423977 1:2567799-2567821 AGGAACCTGCGGGGGCGAGGTGG + Intergenic
900460334 1:2799611-2799633 AAGGGCCTTGGGAGGCCAGGAGG + Intronic
900591829 1:3463559-3463581 AAGGGCCTGGGGAAGCCAGGTGG + Exonic
900731468 1:4264098-4264120 AGGCTCCTGTGGAAGCCAGGAGG + Intergenic
901130688 1:6961299-6961321 AGGGCTTTGGGGAGGCCAGAGGG + Intronic
901193442 1:7426073-7426095 GGAGCCCTGCAGATGCCAGGAGG - Intronic
901794417 1:11672186-11672208 AGGGTGGTGGGGAGGCCAGGAGG - Intronic
902236261 1:15059458-15059480 AGGCCACCTCGGAGGCCAGGAGG + Intronic
902332179 1:15736068-15736090 AGGGCCAGAGGGAGGCCAGGAGG + Intergenic
903177621 1:21590229-21590251 AGGGCCTGGCGGAGCCCGGGTGG + Intergenic
903581902 1:24377339-24377361 AGGGCCCTGAAGATCCCAGGAGG - Intronic
903832698 1:26184197-26184219 GGGGCCCTGGGGAGGGCAAGGGG - Exonic
904006213 1:27364569-27364591 AGGTGACTGAGGAGGCCAGGGGG + Intronic
904501129 1:30913443-30913465 AGGTCCCTTCGGCGGGCAGGAGG - Intergenic
904706346 1:32394040-32394062 AGGGCCCTGCTGAGGGAAGAAGG + Intronic
905326151 1:37153343-37153365 GGGGCCCTGCAGAGGACATGGGG - Intergenic
906301005 1:44681594-44681616 AGGGCCCTGAGAAGGCGGGGTGG + Intronic
906530952 1:46523740-46523762 AGGGGCCTGCAGAGCCCAGGAGG + Intergenic
906641709 1:47444879-47444901 AGGCCGCTCCGGAGGCCTGGAGG + Intergenic
907249466 1:53128598-53128620 GGGCCCCTGCGGAGGCCCTGTGG + Intronic
911589418 1:99729522-99729544 AGGCCCCTGCTCAGGCTAGGTGG + Intronic
912518619 1:110230795-110230817 AGGGCCCTGGGCAGGCCCAGAGG - Intronic
912948669 1:114105575-114105597 CTGGCTCTGCGGAGGCCACGTGG - Intronic
915735286 1:158080730-158080752 AGGGGCCTGAGCAGACCAGGAGG + Intronic
915735484 1:158081985-158082007 AGGGGCCTGAGCAGACCAGGAGG + Intronic
916589950 1:166180771-166180793 AGGGCCCTGGGTGGGGCAGGTGG - Intergenic
918987929 1:191657862-191657884 AGAGCCCACCGGAGGCTAGGAGG - Intergenic
919923000 1:202177413-202177435 AGGGCCCTGCAGGGGTCAGCAGG + Intergenic
919926617 1:202194802-202194824 AGGCCCCTGGGGGAGCCAGGAGG - Intronic
920092827 1:203466192-203466214 AGGGGCCTGGAGAGGCCAAGAGG + Intergenic
920227836 1:204450898-204450920 TGGGCCCTGGGCTGGCCAGGAGG - Intronic
921067583 1:211633495-211633517 TGGGACCTGATGAGGCCAGGTGG - Intergenic
921850610 1:219928771-219928793 GGGGCGCTGCGGAGGAGAGGGGG + Intronic
922479181 1:225927037-225927059 AGGGCCCTGCAGTGCCCTGGTGG - Intergenic
922572742 1:226643482-226643504 AGGGCCAGGTGGAGGGCAGGCGG - Intronic
922975141 1:229778018-229778040 AGGCTCCTGAGGAGGCCTGGAGG + Intergenic
924385424 1:243495159-243495181 TGCGCCCTGGGGAGGACAGGTGG + Intronic
1063196906 10:3752211-3752233 AGGGTGTTGGGGAGGCCAGGAGG + Intergenic
1063959722 10:11297324-11297346 ACTGACCTGCAGAGGCCAGGCGG + Intronic
1064292899 10:14051796-14051818 AGGGCCCTGAGCAGGGCAGGAGG + Intronic
1066188838 10:33037088-33037110 AGGGGGCTGAGAAGGCCAGGGGG - Intergenic
1066422361 10:35274926-35274948 TGGCCCCTGCAGAAGCCAGGGGG - Intronic
1067037870 10:42932917-42932939 AGGGCCCTGCTGAGGAAAGCCGG + Intergenic
1067069843 10:43123617-43123639 AGGGCTCTGTGAGGGCCAGGTGG + Intronic
1067428123 10:46224525-46224547 ACGGCCCTGGGGAGTCCATGGGG - Intergenic
1068695837 10:59967369-59967391 AACTCCCTGCAGAGGCCAGGTGG + Intergenic
1069495582 10:68900904-68900926 AGGCCCATGCCGAGGCCAGTGGG - Intergenic
1069661446 10:70126216-70126238 AGGGCTCAGCACAGGCCAGGAGG - Intronic
1069878204 10:71576044-71576066 AGGGCTCTGTGGAGGCCAGTCGG - Intronic
1070590020 10:77794814-77794836 AGGCCCCAGCGGAGCCCAGGGGG + Intronic
1070877245 10:79825979-79826001 ATGTCCCAGCGGAGGGCAGGGGG - Intergenic
1071643742 10:87342023-87342045 ATGTCCCAGCGGAGGGCAGGGGG - Intergenic
1072267661 10:93745914-93745936 TGGGGCCTGTGGAGGGCAGGCGG - Intergenic
1072427772 10:95344341-95344363 GAGGCCCTGAGAAGGCCAGGGGG + Intronic
1073207989 10:101778777-101778799 AGCGGCCTGCGGGGGCCCGGCGG - Intronic
1073323629 10:102630163-102630185 TGGGCCCTGCAGTGGCCAGCAGG + Exonic
1074143683 10:110698378-110698400 CGGCCCCTGGGGAGGCCAGAAGG + Intronic
1075711834 10:124534735-124534757 GGGGCCCTGCTGCGGCGAGGGGG + Intronic
1076186864 10:128457168-128457190 AAGGCCCTCAGGAGCCCAGGAGG - Intergenic
1076208204 10:128620119-128620141 AGGGCCCTGGGCACTCCAGGGGG - Intergenic
1076284404 10:129278820-129278842 AAGGCTCTGGGGAGGGCAGGAGG + Intergenic
1076404234 10:130201599-130201621 AGGGACCTGAGGAGGTGAGGAGG + Intergenic
1076474069 10:130740273-130740295 AAGGCCCTGTGGAGCCCAGCAGG + Intergenic
1076479967 10:130778448-130778470 AGGACTGTGGGGAGGCCAGGTGG + Intergenic
1077041970 11:528817-528839 AGGGCCCCGCGCAGGTCAGCTGG - Intergenic
1077094405 11:793185-793207 AGGGGCCTGGGGAGGGCAGTGGG + Intronic
1077183252 11:1225687-1225709 AGGGCCCTGTGGAGCCGAGCTGG + Exonic
1077328789 11:1974951-1974973 AGGGCTCTGAGGACTCCAGGAGG - Intronic
1077352275 11:2098553-2098575 AGGGCCCTGCTGGAGCCGGGGGG - Intergenic
1077444416 11:2583691-2583713 AGGGCCCCAGGGAGGGCAGGTGG - Intronic
1077573398 11:3357601-3357623 AGGGCCTCCTGGAGGCCAGGAGG + Intronic
1078057582 11:8019787-8019809 CGGTCCCTGCGGAGGGCCGGCGG - Intronic
1078085917 11:8232994-8233016 AGGACCCTGTGGAAGCCATGAGG + Intronic
1078334090 11:10450614-10450636 CGGGCCCCGCGGAGCCCAGGAGG + Intronic
1081605926 11:44526935-44526957 AGGGCCCTGGGGGCGACAGGTGG + Intergenic
1081752137 11:45518785-45518807 AGGGCCCTGCCTGGGCCAAGAGG - Intergenic
1083296418 11:61717883-61717905 TGGGCCCTGCAGAGGTGAGGTGG - Intronic
1083634440 11:64112719-64112741 AGGGCCCTGGGGATACTAGGGGG + Intronic
1083757773 11:64800821-64800843 AGGGCCCTGTGGAGGGCGCGAGG + Exonic
1084225278 11:67711521-67711543 AGGGGGCTGCGGAAGCCCGGAGG + Intergenic
1084263092 11:67991368-67991390 AGGGGGCTGCGGAAGCCCGGAGG + Exonic
1084496164 11:69504949-69504971 AGGGTCCAGCAGAGGCCAGAAGG + Intergenic
1084539005 11:69775094-69775116 AGGGCCGTGCGTCGGTCAGGCGG + Exonic
1084589752 11:70083897-70083919 AGAGACCTGCAGAGGCCAGAGGG + Intronic
1084684482 11:70685688-70685710 AGAGCCCTAGGGAGGACAGGGGG + Intronic
1084705880 11:70815726-70815748 GGGGCCCTGGGGAGGCTGGGAGG + Intronic
1084810299 11:71607753-71607775 AGGGGGCTGCGGAAGCCCGGAGG - Intergenic
1084962316 11:72723420-72723442 TGGGCCATGCCAAGGCCAGGAGG + Intronic
1085052121 11:73385206-73385228 AGGGCCCTGCCTAGGGGAGGGGG + Intronic
1085849162 11:80099663-80099685 AGGGAGCTGCGGGGGCCAGGAGG + Intergenic
1089071327 11:115701672-115701694 AGGGCACTGAGGAGGCCATATGG - Intergenic
1089466858 11:118691054-118691076 AGGGCCGTGCAGAGGCCCTGAGG - Intergenic
1089494111 11:118899879-118899901 AGGGCCCCAGGGAGGCCAGCTGG - Intronic
1089633273 11:119796565-119796587 AAGGCGCTGCAGAGGCCAGCAGG + Intergenic
1089857005 11:121554545-121554567 AGAGCCCTGGACAGGCCAGGTGG + Intronic
1202811768 11_KI270721v1_random:30130-30152 AGGGCTCTGAGGACTCCAGGAGG - Intergenic
1091398501 12:169053-169075 CAAGCCCTGCGGAGCCCAGGGGG + Exonic
1091399349 12:173004-173026 AGGCCGCTGCGAAGTCCAGGCGG + Intronic
1091603960 12:1934958-1934980 AGTGTCCTGCGGAGGGGAGGCGG - Intergenic
1091655778 12:2345929-2345951 AGGGTCCTGAGGAGGCGAGTGGG - Intronic
1091780044 12:3208014-3208036 AGGGCCGTGCTGAGGCCTGCAGG + Intronic
1092143699 12:6200695-6200717 AGCGCCCTGCGGCTGCCAGCTGG + Intronic
1094040979 12:26122134-26122156 GGGGCCCGGCGAAGGGCAGGTGG + Exonic
1094855890 12:34402673-34402695 TGGGCCCTGCGGATGCATGGTGG - Intergenic
1095953792 12:47795470-47795492 AGGGCAATGCGCAGGACAGGGGG + Intronic
1095983104 12:47983801-47983823 AGGGCCCAGGGGAGGTCAGCAGG + Intronic
1096232652 12:49904849-49904871 AGGGCCTTGCCAAGGCCACGCGG - Intergenic
1096490356 12:52009567-52009589 AGGGCTCAGGGGAGCCCAGGAGG - Intronic
1096506129 12:52094678-52094700 AGGGCGCTGCAGAGGCCAAGAGG - Intergenic
1096539233 12:52295529-52295551 AGGGCCCTGCAGAGGGCATGGGG - Intronic
1101816960 12:108152630-108152652 AGGGGCCTTTGGAGGCCAGGTGG + Intronic
1101897326 12:108766616-108766638 AGGGCTCTGGGGAGCCAAGGAGG - Intergenic
1103615063 12:122146515-122146537 AGTCCCTTGCGGTGGCCAGGGGG - Exonic
1103941997 12:124506278-124506300 AGGGCCGTGGGGAGGGCCGGGGG - Intronic
1103994476 12:124820364-124820386 AGGGCACTGAGGAGTCCGGGAGG + Intronic
1104148022 12:126054287-126054309 AGGGGCCTAAGGTGGCCAGGTGG - Intergenic
1104722527 12:131052839-131052861 AGGACCCTGGAGAGGGCAGGTGG + Intronic
1104747518 12:131219597-131219619 AGGGCCCTGCCCAGGTCAGTGGG + Intergenic
1104785295 12:131444778-131444800 AGGGCCCTGCCCAGGTCAGCGGG - Intergenic
1104943068 12:132403909-132403931 AGGGGCCTGGGGAGGCGAGGGGG + Intergenic
1110436375 13:75481783-75481805 AGGGCACCGCGGAGGCCGGCCGG + Exonic
1112576717 13:100642783-100642805 TGGGCCCTGTGGACACCAGGTGG + Intronic
1113328084 13:109302153-109302175 AAGCCCCTGCTGAGGCCAGGGGG - Intergenic
1113607882 13:111623274-111623296 GTGGCACTGCGGAGGCGAGGCGG - Intronic
1113817968 13:113188480-113188502 GAGGCCCTGCAAAGGCCAGGTGG - Intronic
1114556493 14:23565315-23565337 AGGGACCTGTGGAGGTGAGGAGG - Intronic
1114648251 14:24267600-24267622 AGGGACGTGGGGAGGCCAGCGGG + Intronic
1117076150 14:52106739-52106761 AGGGCACTGTGGTGGGCAGGAGG + Intergenic
1117837785 14:59825574-59825596 AAGGCCCTGCTGTGGCCAGCTGG - Intronic
1121731313 14:96189169-96189191 AGGGCCCTTGGGCTGCCAGGAGG + Intergenic
1122023539 14:98858707-98858729 AAGGCCCTGGCGAGGACAGGGGG - Intergenic
1122226587 14:100284342-100284364 AGGACCCTTCCAAGGCCAGGAGG - Intergenic
1122620746 14:103056662-103056684 AGGGCCCGGCGGGGGGGAGGGGG + Intronic
1122799033 14:104220753-104220775 AGGACCCTGGGGAGGCCTCGGGG - Intergenic
1122804685 14:104250440-104250462 ATGGTCCTGCGGTGGCCTGGTGG + Intergenic
1122899571 14:104776804-104776826 AGGGCCCTGGGAGGGGCAGGGGG - Intronic
1122903687 14:104792404-104792426 ACGGCCTCGGGGAGGCCAGGAGG - Intronic
1122960515 14:105091865-105091887 AGGCCACAGGGGAGGCCAGGAGG + Intergenic
1123706641 15:22955553-22955575 AGGGCTCTGCTGGGGCCAGCAGG - Intronic
1123983481 15:25623915-25623937 AGGGTCCTGCTGAGGGCAGCAGG - Intergenic
1125510739 15:40291178-40291200 AGGCTCCTGGGGAGGCCACGTGG + Exonic
1125590764 15:40853387-40853409 ACACCCCTGGGGAGGCCAGGGGG - Intronic
1127849717 15:62902047-62902069 AGGGCCCTGAGGAGGGCAGTGGG + Intergenic
1128549608 15:68589943-68589965 GGGCCACTGTGGAGGCCAGGGGG - Intronic
1129251287 15:74310581-74310603 AGGGGCCTGAGGTGGTCAGGGGG + Intronic
1129520196 15:76181103-76181125 AGGTCCCTGGGGAGGGCAGCTGG + Intronic
1129677950 15:77642565-77642587 AGGGCCACACGAAGGCCAGGAGG + Intronic
1130533262 15:84764098-84764120 AGGGCCAAGCAGGGGCCAGGGGG - Intronic
1131058225 15:89389086-89389108 AGGTCCCTGAGGAGGACAGCTGG - Intergenic
1131434938 15:92414977-92414999 AGGGCTCTGGGGAGGAAAGGGGG - Intronic
1131931800 15:97450642-97450664 AGGGCAGAGCGAAGGCCAGGAGG + Intergenic
1132316210 15:100892225-100892247 AGGGCCCCTTGGAGGCCAGGCGG - Intronic
1132578021 16:672828-672850 GGGGCCCTGCAGGGGCCACGTGG + Intronic
1132745469 16:1434478-1434500 AGGGCCCTGCGGAGGCCAGGAGG - Exonic
1132768624 16:1548181-1548203 AGGGACTTGAGGTGGCCAGGGGG + Intronic
1132845605 16:1999579-1999601 AGGGGCCTTGGGAGCCCAGGGGG + Exonic
1133002878 16:2859982-2860004 AGGGCCCTGGGGAGCCCCAGAGG + Intergenic
1133008731 16:2898481-2898503 AGGTCCCTGCAGAGGGCAGAGGG + Intronic
1133232650 16:4373775-4373797 AGGGCCCTGCTGAGCCCAGGAGG + Intronic
1134197690 16:12171482-12171504 AGGGCTCTAGGGAGGGCAGGAGG + Intronic
1134615830 16:15650450-15650472 AGGGACCGGGGGAGTCCAGGCGG - Intronic
1134707184 16:16310786-16310808 GGGGCTCTGCGGACGCCAGCGGG + Intergenic
1134960357 16:18401339-18401361 GGGGCTCTGCGGACGCCAGCGGG - Intergenic
1138492533 16:57384662-57384684 AGGGGAGTGCAGAGGCCAGGTGG - Exonic
1139229896 16:65273538-65273560 TAGGCCCTGCTTAGGCCAGGTGG + Intergenic
1139471597 16:67180738-67180760 AGGGCCCAGCAGAGGCAATGTGG - Intronic
1139589951 16:67928054-67928076 AGGGCTCTGTGGAGGAAAGGGGG - Exonic
1139752166 16:69115538-69115560 AGTGCCCTCTGGAGCCCAGGAGG - Exonic
1139952700 16:70679872-70679894 AGTGCGCTGCGGAGGGCGGGCGG + Exonic
1140771457 16:78208103-78208125 AGAGCACTGCTGAGGCCAGATGG - Intronic
1141611811 16:85185849-85185871 AGGGCCCTGCGGGGGCTGGGAGG + Intergenic
1141633986 16:85304066-85304088 AGGGACCTCAGGAGGCCAAGGGG - Intergenic
1141677447 16:85525107-85525129 GGTTCCCTGTGGAGGCCAGGAGG - Intergenic
1142222105 16:88860615-88860637 ATGGCCCTGTGCAGCCCAGGAGG - Intronic
1142259535 16:89036324-89036346 AGGGCCAGGTGGAGGCCAGATGG + Intergenic
1142355394 16:89599273-89599295 AGGGCCCTGTGCAGGTCAGGGGG + Intergenic
1142378958 16:89721227-89721249 AGGCGCCGGCGGAGGCCACGCGG - Intronic
1142605180 17:1077580-1077602 AGGGTCCTGAGAAGGTCAGGGGG + Intronic
1142689799 17:1598700-1598722 AGGGCCCTGGGGTGACCATGTGG + Intronic
1142742988 17:1941583-1941605 AGGGCCCCTCGGGGGCCAGGCGG + Intronic
1142992306 17:3739558-3739580 AGGGCCCTGCATAGGCCATTTGG - Intronic
1143164462 17:4891037-4891059 GGGGCCCTGGGGAGGCCTGGGGG - Exonic
1143252360 17:5533021-5533043 AGGGGCTAGGGGAGGCCAGGCGG - Intronic
1143321609 17:6072052-6072074 ATGGCCCTGCTGAGGCCTGGAGG - Intronic
1143779499 17:9221906-9221928 AGGGCCCCGCAGTGGCCAGCGGG + Intronic
1144584988 17:16482447-16482469 AGGGCCGTGGGAAGGCCAAGTGG + Intronic
1145090242 17:19980104-19980126 CAGGCCCGGCCGAGGCCAGGAGG - Intergenic
1146890995 17:36506484-36506506 GGGGCCCTGCTCTGGCCAGGGGG + Exonic
1146912890 17:36659550-36659572 AGGGGTCTGCCGAGGCCTGGGGG + Intergenic
1147605242 17:41770643-41770665 AGGGCCCTGAACATGCCAGGGGG - Intronic
1147632035 17:41938466-41938488 AGGGCCCTGCAGCGGCCACCGGG + Intronic
1148790167 17:50168357-50168379 GGGGGCCTGGGAAGGCCAGGTGG - Exonic
1148936343 17:51166760-51166782 CGGGGCCCGCGGAGGCCACGTGG - Exonic
1149436589 17:56638757-56638779 ATGGCTCTGTGGAGACCAGGCGG - Intergenic
1149512560 17:57256035-57256057 AGGGCACAGCGGAGGGCGGGCGG + Intronic
1149559979 17:57601608-57601630 AGGCCTCTGCGGATGCCTGGAGG - Intronic
1150323994 17:64241083-64241105 AGGGCCATGCTGAAGCCAGCTGG + Intronic
1151388412 17:73769692-73769714 AATGCCCTGCGGAGGCCATGGGG - Intergenic
1151568762 17:74915638-74915660 AGGGCCCTCCAGAGGCCCAGAGG - Intergenic
1151584598 17:75001493-75001515 AGGGCCCGGCTGAGGGCTGGGGG + Intronic
1151678178 17:75610515-75610537 GGGGCCCAGGGGAGGCCTGGAGG - Intergenic
1151785247 17:76272129-76272151 AGGGGCCCGAGGAGGCCCGGAGG - Intergenic
1151962653 17:77415180-77415202 AGGGCCAGGAGGTGGCCAGGTGG + Intronic
1152258120 17:79252106-79252128 AGAGCCATGGGGAGACCAGGAGG - Intronic
1152289351 17:79430009-79430031 AGGGGGCTGCCGAGGCGAGGTGG + Intronic
1152323601 17:79622980-79623002 AGGGCAGTGGGGAGGCCAGGAGG - Intergenic
1152337522 17:79706991-79707013 AGGGCCCTGGAGGAGCCAGGAGG - Intergenic
1152519378 17:80846338-80846360 AGGGCCGCGAGGATGCCAGGCGG - Intronic
1152538681 17:80964085-80964107 TGGGCCCTGCAGAGGACTGGTGG + Intronic
1152570435 17:81119191-81119213 AGGGCCAGGCGAGGGCCAGGCGG + Intronic
1152819899 17:82432202-82432224 AGGGACCTGTGAGGGCCAGGTGG - Intronic
1152855401 17:82662683-82662705 AGGGTCCTGCTGGGGCCTGGGGG + Intronic
1154300844 18:13191151-13191173 ATTGCCCTTGGGAGGCCAGGCGG + Intergenic
1155171198 18:23267815-23267837 AGGGGCCTGAGGAGGCCTTGTGG - Intronic
1156149565 18:34225131-34225153 CGGGCCCGGCGGCAGCCAGGTGG + Intergenic
1157177599 18:45465610-45465632 AGGGCCCTGAGGAAGGGAGGAGG - Intronic
1157592342 18:48843301-48843323 AGGGCCCTGGGGAGGGCAGATGG - Intronic
1160202610 18:76807961-76807983 AGGGTCCTGCGCATGCCGGGCGG - Intronic
1160769980 19:826478-826500 AGGGGCCGGGGGAGGGCAGGGGG - Intronic
1160806697 19:995129-995151 TGGGCCCTGGGGAAGCCAGCAGG - Intronic
1160878489 19:1308857-1308879 AAGCCCCAGGGGAGGCCAGGTGG - Intergenic
1161106844 19:2447990-2448012 AGGACCCAGCGGTGGTCAGGAGG - Intronic
1161237464 19:3205031-3205053 AGGGCCCTGAAGAGGCCCAGAGG - Intronic
1161301125 19:3543699-3543721 TGGGTCCTTGGGAGGCCAGGGGG + Intronic
1161620107 19:5293169-5293191 CGGGCCCTGTGGAGGCCTCGCGG - Intronic
1161740649 19:6019013-6019035 AGGGCCCTGCAGGCGGCAGGAGG - Intronic
1161773104 19:6241974-6241996 AGGGCCTTGCAGAGTTCAGGAGG - Intronic
1162130420 19:8522732-8522754 AGGGCCCCGGGGAGGCCTGTGGG + Exonic
1162936986 19:13986300-13986322 GGGGACCTGCTGAGACCAGGTGG + Intronic
1163184587 19:15628835-15628857 GGGGCCCAGGTGAGGCCAGGGGG + Exonic
1163575475 19:18108891-18108913 TGGGCCCTGCTGAAGCCAGAGGG + Intronic
1163647313 19:18496716-18496738 AGGTCCTTGCCAAGGCCAGGCGG + Intronic
1163691111 19:18739008-18739030 AGGGCCCTGCTGAGGGTGGGTGG - Intronic
1163782699 19:19258637-19258659 GGAGCCCTGCGGCGGCCTGGGGG - Exonic
1164532429 19:29058579-29058601 AGAGCCATGAGGAGGCCTGGAGG + Intergenic
1164995721 19:32719688-32719710 AGCGCCACGCGGTGGCCAGGAGG - Intergenic
1165064379 19:33220460-33220482 AAGGCCGAGGGGAGGCCAGGAGG - Intronic
1165112057 19:33508210-33508232 AGGGCCATGAGGAGGCGAGAGGG + Intronic
1165707306 19:37985818-37985840 AGGGCCCTGGGAAGGCTGGGAGG - Intronic
1165832742 19:38737293-38737315 AGGGCCCTGGGGGGGCTGGGGGG - Exonic
1166301159 19:41912927-41912949 CCGGCCCTGCAGAGGCCGGGAGG + Intronic
1166359839 19:42248543-42248565 AGGGGCCTGGGGAGGCTGGGGGG - Exonic
1166455584 19:42937507-42937529 AGAGCCATGCGGAGAGCAGGAGG - Intronic
1166935327 19:46329190-46329212 AGCATCCTGCGGAGGGCAGGAGG - Exonic
1167075197 19:47244230-47244252 CGGGCCAGGCGGAGGCCGGGCGG + Intergenic
1167248918 19:48390716-48390738 AGGGCCCTGCTCAGGCGGGGCGG - Intronic
1167337393 19:48895434-48895456 AGGGCACTGTGGATGCCAGAGGG + Exonic
1167615414 19:50530253-50530275 AGGGCACTGGGGAGCCCCGGAGG - Intronic
1168101661 19:54144672-54144694 AGGGCCCTCTGGGTGCCAGGAGG - Intronic
1168124968 19:54278020-54278042 AGGGGCCTGGGGAGGCCACAGGG - Intronic
1168206464 19:54853766-54853788 GGGGCCCTGGGTGGGCCAGGAGG - Exonic
1168289787 19:55352013-55352035 ACGGCTCTGGGGAGGTCAGGAGG + Intronic
1168416997 19:56175586-56175608 AGGGAGCTGCGGAGGCTTGGAGG + Intergenic
1168694532 19:58396958-58396980 AGGACCCGGCGGAGGCCGAGAGG + Exonic
925034596 2:676209-676231 AGGGTCCCGGGGAGTCCAGGAGG - Intronic
925689303 2:6505121-6505143 TTGGCACTGTGGAGGCCAGGAGG - Intergenic
925994618 2:9281925-9281947 AGGGCACAGAGGAGTCCAGGTGG - Intronic
926538157 2:14140219-14140241 AAGGGCCTGCGGAGCCCAGCGGG - Intergenic
927467711 2:23349754-23349776 CGGGACCTGGAGAGGCCAGGTGG - Intergenic
927861000 2:26559786-26559808 AGGGCCCTCCTGAGGTCAGGAGG - Intergenic
928904724 2:36356651-36356673 AGGGGGCGGCGCAGGCCAGGTGG - Intronic
929452634 2:42047702-42047724 AGGGGGCGGCGGCGGCCAGGAGG - Intergenic
929551635 2:42896806-42896828 GGGGCCCTGCGCAGGCGTGGTGG - Intergenic
930668113 2:54119844-54119866 AGGAGCCTGAGGAGGCAAGGGGG - Intronic
931643425 2:64400976-64400998 AGGGCCCTGCCCAGATCAGGTGG - Intergenic
932434428 2:71694877-71694899 AATGCCCAGAGGAGGCCAGGTGG + Intergenic
935376111 2:102399487-102399509 AGGGGCCTGCGGAGGGGAAGCGG + Intergenic
935617645 2:105102587-105102609 AGGTCCCTGCGGAAACCAGCTGG + Intergenic
936091529 2:109504662-109504684 AGGGTCCAGCAGAGGCCAAGAGG + Intergenic
937103863 2:119292412-119292434 AGGGCTCTGCGTATGCCCGGAGG - Intergenic
937203115 2:120218501-120218523 AGGGCCCTGGCAGGGCCAGGTGG + Intergenic
937346169 2:121126955-121126977 AGCCCCCTGAAGAGGCCAGGGGG + Intergenic
937863830 2:126733185-126733207 AGGGGGCTGCAGAGGCCAGCAGG + Intergenic
937895803 2:126976196-126976218 AGTGACCTCAGGAGGCCAGGGGG - Intergenic
937907265 2:127058440-127058462 AGGGCCCTGCAGACACCTGGAGG + Intronic
938018251 2:127885591-127885613 ATGTCCCAGCGGAGGGCAGGGGG - Intronic
938063506 2:128269314-128269336 AGGGTCCTGCCAAGGCCTGGTGG + Intronic
938130789 2:128714383-128714405 AGGGCCCTGAGCGGGGCAGGAGG + Intergenic
938375320 2:130801454-130801476 AGGGGCTTACGGAGGTCAGGTGG + Intergenic
938500305 2:131828790-131828812 CGGGCCGTGCGGAGACCAGTTGG - Intergenic
942428505 2:175884357-175884379 AGGGGCCTGGGCTGGCCAGGTGG - Intergenic
942470540 2:176255213-176255235 AGGGCTCTGTGGAGGGCAGAGGG - Intergenic
944671701 2:201999564-201999586 GGGGGCCTGTGGAGGACAGGAGG - Intergenic
945080908 2:206085611-206085633 AGCGGCCTGCGCGGGCCAGGTGG - Intronic
946255491 2:218438748-218438770 TGGGCCCTGCAGTGGCCAGCTGG + Intronic
946909070 2:224442633-224442655 GGGGCCCCGCGAAGGCCCGGGGG - Intergenic
947187369 2:227467209-227467231 AGGGGGCGGCGGAGGGCAGGTGG + Intergenic
947448547 2:230183524-230183546 AGGGCTCTGGGGAGCCCAGTGGG + Intronic
948508580 2:238448120-238448142 TGGGTCCTGCTGAAGCCAGGAGG + Exonic
948567004 2:238893805-238893827 AGGCTGCCGCGGAGGCCAGGAGG - Intronic
948570973 2:238916921-238916943 AAGGCTTTGCTGAGGCCAGGGGG - Intergenic
948781804 2:240326060-240326082 AGGACCCTGGAGAGGCCAGACGG - Intergenic
948787868 2:240362492-240362514 AGTGCCCTGTGGAGGACAGGAGG + Intergenic
948787876 2:240362523-240362545 AGGTCCCTGTGGAGGACAGGAGG + Intergenic
948787883 2:240362554-240362576 AGGCCCCTGTGAAGGACAGGAGG + Intergenic
948844181 2:240675360-240675382 AGAGCCCTGTGGGGTCCAGGCGG - Intergenic
948849679 2:240699519-240699541 AGAGCCCTGTGGGGTCCAGGCGG + Intergenic
948921215 2:241066776-241066798 AGGGCCCAGGTGTGGCCAGGAGG - Intronic
1168753185 20:297930-297952 AGGGCGCTGCGGAGGCGGGCAGG + Exonic
1169673799 20:8132491-8132513 AGGGAGGTGCGGAGGCCGGGAGG + Intronic
1169758756 20:9068820-9068842 AGGGCCCGGCGGTGGGCGGGCGG + Intronic
1172010812 20:31844720-31844742 AGGGGGCTGCTGAGGCCAAGAGG + Exonic
1172023784 20:31934447-31934469 AGGGGCCTACGCAGGCCATGTGG + Intronic
1172174395 20:32963386-32963408 GGGGCCCTGCCCAGGCCACGCGG + Intergenic
1172888246 20:38246121-38246143 AGGGTCCTGTGGGGGACAGGAGG + Exonic
1174447574 20:50601102-50601124 ATGGGCCTGCCGGGGCCAGGTGG + Intronic
1175847266 20:62065453-62065475 CGGGCCCTGCGGGGACAAGGGGG + Exonic
1175937940 20:62523532-62523554 AGGGCTCTGGGGAGGGCCGGGGG - Intergenic
1176194696 20:63831614-63831636 AGGGCGCAGCGGGGGCCAGGGGG - Intergenic
1178484208 21:33006963-33006985 ATGGCCCTGCAGAGTCCCGGTGG - Intergenic
1178486990 21:33025649-33025671 AGGGACCCGAGGAGGCGAGGGGG - Intergenic
1178638078 21:34322656-34322678 AGGGCCCAGGGGAGCCCTGGAGG - Intergenic
1179116155 21:38494369-38494391 AGGGCCATGGGGAAGCCAGACGG - Intronic
1179198043 21:39183826-39183848 TGAGCCCTGCGGGCGCCAGGAGG + Exonic
1179525967 21:41976033-41976055 AGGGCCCTCCTGAGGCAATGGGG + Intergenic
1179610534 21:42547429-42547451 AGGCCCCTGGGGAAACCAGGAGG - Intronic
1179906911 21:44427308-44427330 AGGGCCTGCCCGAGGCCAGGGGG - Intronic
1179932272 21:44578778-44578800 AAGGCCCTGCTGAGACCTGGGGG - Intronic
1179980315 21:44892067-44892089 GGACCCCTGCAGAGGCCAGGAGG - Intronic
1180144879 21:45913491-45913513 AGGGCCCTGCGCATCCCAGGAGG + Intronic
1181032981 22:20157201-20157223 AGTGCCCAGAGCAGGCCAGGTGG + Intergenic
1181038971 22:20183016-20183038 TGGGGCCAGGGGAGGCCAGGAGG - Intergenic
1181198180 22:21202728-21202750 AGGGGCCTGCGCCGGCCAGCAGG + Intergenic
1181694941 22:24588367-24588389 AAGGCCCTGAGGTGGGCAGGAGG - Intronic
1183094368 22:35543240-35543262 AGGGCCATTCTGAGGACAGGTGG - Intronic
1183862354 22:40679328-40679350 AGGGCCCTGGGGAAGCTGGGAGG - Exonic
1183977825 22:41523458-41523480 AGGGCCCTGCAGAGGCACTGGGG + Intronic
1184113578 22:42409355-42409377 AACGCCCTGCAGAGGGCAGGCGG + Intronic
1184247146 22:43241503-43241525 AGGGCCCTGGAGCTGCCAGGTGG - Intronic
1184288693 22:43486723-43486745 GGGGCCCTGGGGAGGCTGGGAGG + Intronic
1184375443 22:44109182-44109204 ACGGCCCGGTGGGGGCCAGGGGG - Intronic
1184649351 22:45912574-45912596 AGGGGCCTGTGGGGTCCAGGGGG + Intergenic
1184663684 22:45976816-45976838 AGGGCCGGGCAGGGGCCAGGGGG + Exonic
1184688979 22:46108919-46108941 AGGGCCCAGAGGAGGGCAGCAGG - Intronic
1184778318 22:46634138-46634160 TGGGCCCTGCCGAGGGCTGGGGG + Intronic
1184928744 22:47663825-47663847 AGGGCACTGGGGAGCCAAGGAGG + Intergenic
1185045338 22:48525765-48525787 AGGCCCCTGCAGAGGCACGGTGG + Intronic
1185255306 22:49828088-49828110 AGGTCCCTGAGGGGGTCAGGAGG + Intergenic
1185266544 22:49907039-49907061 AAGGTCCTGTGGAGGGCAGGGGG - Intronic
1185363082 22:50420794-50420816 AGGGCCAGGGTGAGGCCAGGAGG - Intronic
1203228627 22_KI270731v1_random:92109-92131 AGGGGCCTGCGCCGGCCAGCAGG - Intergenic
953263639 3:41364368-41364390 AGGGCCTGGTGGAGGGCAGGTGG - Intronic
953911220 3:46893991-46894013 GAGGTCCTGCAGAGGCCAGGTGG + Exonic
953989785 3:47475537-47475559 AGGGGCCCGCGGAGGTCTGGTGG + Intronic
954246932 3:49339682-49339704 CGGGCCCGGCGGGGGCCAGGAGG - Intronic
954899616 3:54007517-54007539 AGGGACCTGGGTGGGCCAGGAGG + Intergenic
955195417 3:56801399-56801421 AGAGCCCTGCAAAGGCAAGGAGG + Intronic
955427294 3:58805365-58805387 AGGCCCCTCCTGAGGCCTGGCGG + Intronic
960672816 3:120168707-120168729 AGGGCGCTGCAGTGGCCAGCAGG - Intronic
960976455 3:123179516-123179538 TGAGCTCTGCGGAGGCCAGTAGG + Intronic
961002409 3:123383051-123383073 GGGGCCCTGGGGTGGCCATGGGG - Intronic
961325433 3:126106609-126106631 GGTTCCCTTCGGAGGCCAGGTGG - Intronic
961568507 3:127781890-127781912 AGGGCCCTGCAGAGACAAGAAGG + Exonic
961749146 3:129085479-129085501 ATGACCCTGCAGAGGGCAGGAGG - Intergenic
961795174 3:129403885-129403907 AGGGCCCTGCAGAGAACAGGGGG - Intronic
962198247 3:133381004-133381026 AGGTCCCGGCGGGGACCAGGCGG - Exonic
963035227 3:141019868-141019890 AGGGGCCTGGGGAGGGTAGGAGG + Intergenic
966881512 3:184353648-184353670 AGTCCCCTGGTGAGGCCAGGAGG - Exonic
968270627 3:197400616-197400638 AGGGCCCGGTGCTGGCCAGGGGG - Intergenic
968555902 4:1246358-1246380 AGGGCCCAGGGGTGGCCAGGAGG - Intronic
968616340 4:1579286-1579308 AGGGCCCAGCCGAGGCCACCAGG - Intergenic
968644793 4:1735084-1735106 AGCACCCTGCGGTGCCCAGGAGG + Intronic
968661799 4:1801747-1801769 AGGGCCCTGGGGCGGCGCGGGGG + Intronic
968757783 4:2425869-2425891 AGGGCCCTGGGGAGGGCTTGCGG - Intronic
968880102 4:3294197-3294219 AGGGCCCTTCTGAGGCCACAGGG + Intronic
968900329 4:3428221-3428243 AGGGCACTGCGCAGGGCAGGCGG - Intronic
969021616 4:4143278-4143300 AGGGGGCTGCGGAAGCCCGGAGG + Intergenic
970163736 4:13214793-13214815 AGGGACCTGCAGAAGCCAAGGGG - Intergenic
973719706 4:53711111-53711133 AGGGCCTTGCTGAAGCCATGGGG + Intronic
977519856 4:98068137-98068159 AAGGCCCTGTGGTGGCAAGGGGG - Intronic
984337761 4:178415100-178415122 TGGGAGCTGAGGAGGCCAGGAGG - Intergenic
985517219 5:353241-353263 ACGGCCCGGCTGATGCCAGGAGG + Intronic
985913258 5:2898907-2898929 AGGGCCCTGCTCAGGACAGATGG + Intergenic
986465049 5:8012485-8012507 ATGGCCAGGGGGAGGCCAGGGGG + Intergenic
987079383 5:14412627-14412649 AGAGCCCTGAGCTGGCCAGGAGG - Intronic
988736398 5:34026242-34026264 CAGGCTCTGAGGAGGCCAGGTGG + Intronic
988993447 5:36692998-36693020 AGGCCTCTGCGGAGGCGAGCAGG - Intergenic
995767868 5:115638490-115638512 AGGTCCCTGCAGTGACCAGGTGG + Intergenic
997381889 5:133444316-133444338 TGGGCCCTGGAGAAGCCAGGTGG - Intronic
998797480 5:145835309-145835331 AGGGCTCCGCAGAGGCCCGGAGG + Intronic
998931578 5:147187337-147187359 AGGACCAAGCGTAGGCCAGGAGG + Intergenic
999958636 5:156729783-156729805 AGGGCCTTGCTGAGGAGAGGGGG - Intronic
1000866428 5:166519897-166519919 AGGGGCCTGAGGAGGCCAGGCGG - Intergenic
1001073538 5:168607006-168607028 ATGTCCCTGGGAAGGCCAGGAGG - Intergenic
1002405081 5:179024068-179024090 AGGGCCTGGCGGAGGCCGGGAGG + Intronic
1002432922 5:179213511-179213533 AGGGCCCAGCAGAGGCGAGCTGG + Intronic
1002616728 5:180460848-180460870 AGGGCCCTGGGGAAGACATGTGG + Intergenic
1002782709 6:379606-379628 AGGGCCAAGGGGAGGTCAGGAGG - Intergenic
1003015538 6:2464563-2464585 AAGGCCCTGCAGAGCACAGGCGG + Intergenic
1004413114 6:15400177-15400199 AGGGGCCTGCGCAGGGCAGGGGG + Intronic
1006015846 6:31079851-31079873 AGGGCCCATCAGTGGCCAGGTGG - Intergenic
1006025133 6:31141937-31141959 GGGCTCCTGTGGAGGCCAGGAGG - Intergenic
1006297914 6:33178255-33178277 GGGGCTCTGGGGAAGCCAGGAGG - Intronic
1006981865 6:38153833-38153855 AGGCCCCTGCGGAGGCAGCGTGG + Exonic
1007075685 6:39064771-39064793 CAGGCCCTGCAGAGGCAAGGCGG - Intronic
1007173296 6:39879346-39879368 AGGCCCATGCCGAGGCAAGGTGG - Exonic
1007383279 6:41504114-41504136 AGGGCAGTGCGGCGGCCCGGCGG - Intergenic
1007844499 6:44742209-44742231 AGGGCACTGCACATGCCAGGGGG + Intergenic
1011054774 6:83193447-83193469 AGGCCCCCGCGGTGGCCCGGGGG + Intronic
1011193806 6:84763017-84763039 TTGGCCCTGCGGAGGCCCAGCGG - Intronic
1016703018 6:147075455-147075477 AGGGCTCTGGGGAGGAGAGGTGG - Intergenic
1016863839 6:148747312-148747334 AGGGCCGCGCGGAGGGCAGCCGG - Exonic
1017710214 6:157160759-157160781 AGGGCCCTGGGGCATCCAGGAGG - Intronic
1017726660 6:157281042-157281064 AGGTCACTGTGGAGGCCTGGAGG + Intergenic
1017906519 6:158760522-158760544 AGGGCCTTGCAGGGGCCAGGGGG + Intronic
1017950082 6:159129016-159129038 ATGGGCCTGGGGAGGGCAGGGGG - Intergenic
1018052795 6:160026107-160026129 AGCGCCCTGAGGATGCAAGGAGG - Intronic
1018698472 6:166408649-166408671 ATGGGCATGCTGAGGCCAGGTGG + Intergenic
1018907324 6:168083094-168083116 ACAGCCCTGCGGAAGCCACGGGG + Intergenic
1019083460 6:169452636-169452658 AGGGCAAGGCGGAGCCCAGGAGG + Intergenic
1019303805 7:322796-322818 GGGGCCTTGCTGGGGCCAGGAGG + Intergenic
1019451451 7:1100739-1100761 AAGCCCCTGTGGAGGCCGGGAGG - Intronic
1019572493 7:1719539-1719561 AGGGCACTGCGGGGGCTGGGAGG - Intronic
1019578108 7:1747193-1747215 GGGGCCCTGCAGAGGCGAGGGGG + Exonic
1020037636 7:4974351-4974373 AGCCCCCTGCGGTGGCGAGGCGG + Intergenic
1020309031 7:6855308-6855330 AGGGGGCTGCGGAAGCCCGGAGG + Intergenic
1020482756 7:8682180-8682202 AGGGTCCTGAGGAGCACAGGTGG + Intronic
1022098746 7:27156886-27156908 TGGGGTCTGCGGACGCCAGGCGG + Intronic
1022638154 7:32156539-32156561 AAGGCCCAGCAGAGGCGAGGTGG - Intronic
1022954990 7:35372587-35372609 AGGGCCCTTGGTAGTCCAGGAGG + Intergenic
1023860658 7:44216134-44216156 GGGGCCCAGCGGGGGCCACGAGG + Intergenic
1024155201 7:46614971-46614993 ATGGCCCTCAGGAGGCAAGGGGG - Intergenic
1024579867 7:50793073-50793095 CGGGCCCCGCGGAGGCGCGGCGG - Intronic
1026841398 7:73671476-73671498 AGGGCCTGCCTGAGGCCAGGGGG - Exonic
1026902017 7:74042738-74042760 AGGGCCCCACGGAAGCCAGAGGG - Intronic
1026928091 7:74207622-74207644 AGACCCCTGCAGAGGCCACGAGG + Intronic
1026935769 7:74254446-74254468 CGCGCCCGGCGGAAGCCAGGGGG - Intronic
1027218886 7:76201807-76201829 AGCGCCCTCCGCAGGCCTGGAGG - Intergenic
1029157243 7:98526062-98526084 AGGGCCCGGTGTAGGCAAGGGGG - Intergenic
1029625629 7:101718669-101718691 AGGGCCCTGGGGAGGCCTGAGGG + Intergenic
1031895927 7:127347828-127347850 AGGTCCCGCCGGCGGCCAGGCGG + Intronic
1033273901 7:139956827-139956849 AGGGCCCTGCAGAGGCAGAGAGG - Intronic
1034098863 7:148434970-148434992 AAGGAGCTGCTGAGGCCAGGTGG - Intergenic
1034174513 7:149090449-149090471 CGGGCCCTGCGGTGAGCAGGTGG - Intronic
1034479343 7:151307741-151307763 AGGGCCCTGAGCAGCCCTGGGGG + Intergenic
1034622820 7:152469514-152469536 AGATCCCTGCAGTGGCCAGGTGG - Intergenic
1035085206 7:156252298-156252320 AGGGCCCTGCAGCCACCAGGTGG - Intergenic
1035300793 7:157896148-157896170 GGTGCCCAGCGGAGGACAGGAGG + Intronic
1035300829 7:157896310-157896332 AGTGCCCAGCAGAGGACAGGAGG + Intronic
1035395065 7:158529386-158529408 AAGGCCCAGGGGAGGCCAGCAGG + Intronic
1035422542 7:158741617-158741639 TGTGGCCTGGGGAGGCCAGGAGG + Exonic
1035730970 8:1853311-1853333 TGGTCCCTGTGGAGCCCAGGAGG - Intronic
1035745518 8:1959895-1959917 AGGGCTCTGCAGAGGAGAGGGGG - Intergenic
1035812339 8:2503327-2503349 AGGGGGCTGCAGAGGGCAGGTGG + Intergenic
1036690854 8:10943913-10943935 ATGGCCCTGCTAAAGCCAGGCGG + Intronic
1036789687 8:11709342-11709364 AGTTCCCTGCGGAGGCCCGAGGG - Intronic
1038259300 8:25979248-25979270 AGGGGTATGTGGAGGCCAGGTGG + Intronic
1038421534 8:27437041-27437063 GAGGCCATGGGGAGGCCAGGAGG + Intronic
1038673502 8:29601578-29601600 AGGGCCCTGGGGAGAGCAAGAGG + Intergenic
1040415276 8:47189396-47189418 GGGGCTCTGCACAGGCCAGGAGG + Intergenic
1042020695 8:64369847-64369869 AGGTCCCTGAAGAGGCGAGGCGG - Intergenic
1042554686 8:70023965-70023987 AGGTCCATGAGGAGGACAGGAGG + Intergenic
1046108282 8:109691842-109691864 GAGCCCCGGCGGAGGCCAGGAGG + Intergenic
1048225241 8:132578893-132578915 AAGGCCCTGAGCATGCCAGGTGG + Intronic
1048244217 8:132775676-132775698 GCGGCCCGGCGGGGGCCAGGCGG - Intronic
1048971103 8:139645380-139645402 TGGGCCATGCTGAGGGCAGGTGG - Intronic
1049219044 8:141420537-141420559 AGGGCCCTGAAGAGGGGAGGCGG - Intronic
1049247476 8:141570459-141570481 CCGGCCCTGCGGGGGTCAGGGGG + Intergenic
1049358593 8:142201037-142201059 AGAAGCCTGCAGAGGCCAGGAGG + Intergenic
1049409454 8:142465973-142465995 AGAGCCCTGTGGAGGCCCCGTGG + Intronic
1049610430 8:143552653-143552675 AGAGCCCTGCTAAGGCCAGGGGG - Intergenic
1049632238 8:143665039-143665061 CGGGCGCTGTGGAGGGCAGGAGG - Intergenic
1050343346 9:4662588-4662610 AGGGGCCCGCCGCGGCCAGGGGG - Exonic
1050677404 9:8071520-8071542 AGGGCTGTGCGGAAACCAGGGGG - Intergenic
1051010439 9:12406523-12406545 AGGGGCTTGCAAAGGCCAGGAGG - Intergenic
1051364363 9:16310597-16310619 AGGGCCCAGGGGAGTCCTGGAGG - Intergenic
1051594851 9:18814720-18814742 AGGGCCTGGTGGAGGGCAGGAGG + Intronic
1053050432 9:34957664-34957686 GGGACCCTCCGGAGGCCAGTGGG + Intronic
1053169012 9:35865094-35865116 AGGGCCCTGCTGAGGTGAAGTGG + Intergenic
1055558812 9:77502503-77502525 AGGTCTCAGTGGAGGCCAGGGGG - Intronic
1055762699 9:79626140-79626162 AGGGGAGTGGGGAGGCCAGGTGG - Intronic
1056935740 9:90913806-90913828 TGGGACCCGGGGAGGCCAGGAGG + Intergenic
1057096490 9:92315018-92315040 CGGCCTCTGCGGAGGCCAGTGGG + Exonic
1057230307 9:93317717-93317739 GGGGCCCTGGGCAGGCCAGGTGG + Intronic
1058818006 9:108703411-108703433 AGGGCCGAGCAGAGGCCAGCTGG + Intergenic
1059175967 9:112170477-112170499 AGGGCCCAGGGGAGTCCAGAGGG - Intronic
1059461401 9:114432935-114432957 AGGGCCCTGGGGAAGGTAGGTGG - Intronic
1059528390 9:115014160-115014182 AGTGCCCTCCCGAAGCCAGGTGG + Intergenic
1060101295 9:120843111-120843133 AGGGAAATGCGGAGGCCAGTAGG + Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060594794 9:124841464-124841486 GGGGCCCTGCAGAGGTCAGGGGG + Intergenic
1060817708 9:126644078-126644100 AAGGCCATCTGGAGGCCAGGTGG + Intronic
1061380809 9:130255968-130255990 GGGGACCTGGGGAGGCCAGCTGG - Intergenic
1061502932 9:131013997-131014019 TGGGCCCTGAGCAGGGCAGGAGG + Intronic
1061576453 9:131510125-131510147 AGGCACCTGCAGAGGCCAAGAGG - Intronic
1061791450 9:133061334-133061356 AGGGCCCAGCCGAGGCCCTGGGG - Intergenic
1062053417 9:134458611-134458633 AGGTCCCCCCAGAGGCCAGGAGG - Intergenic
1062103633 9:134740961-134740983 AGGGCCCTGGGGAGGCCGGTGGG - Intronic
1062424662 9:136500506-136500528 GCGGCCCTGAGGAGGGCAGGTGG + Intronic
1062591992 9:137278439-137278461 GGGGCCCTGCGGAGGGGCGGAGG + Intronic
1187253638 X:17622038-17622060 AAGGCCCTGAGGAGGCTGGGTGG + Intronic
1187468097 X:19543787-19543809 AGTGTCCTGAGGAGGCCAGGAGG + Intronic
1190713971 X:53088616-53088638 AGGATACTGCGTAGGCCAGGCGG - Intergenic
1192194601 X:69019728-69019750 AGGTCCCTGCAGAGCCCAGAAGG - Intergenic
1197642103 X:128978142-128978164 AGGTCCCTGGGGAGGCCTCGGGG + Intergenic
1198215502 X:134550825-134550847 ATAGCCCTGGGCAGGCCAGGAGG + Intergenic