ID: 1132746112

View in Genome Browser
Species Human (GRCh38)
Location 16:1436996-1437018
Sequence CGGCTGCCCAGGCCCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 497}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132746112_1132746126 19 Left 1132746112 16:1436996-1437018 CCAAGGCAGGGCCTGGGCAGCCG 0: 1
1: 0
2: 2
3: 57
4: 497
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47
1132746112_1132746130 27 Left 1132746112 16:1436996-1437018 CCAAGGCAGGGCCTGGGCAGCCG 0: 1
1: 0
2: 2
3: 57
4: 497
Right 1132746130 16:1437046-1437068 ACAGGTGCCCGAGGGAGGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 289
1132746112_1132746118 -10 Left 1132746112 16:1436996-1437018 CCAAGGCAGGGCCTGGGCAGCCG 0: 1
1: 0
2: 2
3: 57
4: 497
Right 1132746118 16:1437009-1437031 TGGGCAGCCGAGGGCCCGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 223
1132746112_1132746124 18 Left 1132746112 16:1436996-1437018 CCAAGGCAGGGCCTGGGCAGCCG 0: 1
1: 0
2: 2
3: 57
4: 497
Right 1132746124 16:1437037-1437059 TCCGACCACACAGGTGCCCGAGG 0: 1
1: 0
2: 0
3: 14
4: 209
1132746112_1132746119 -9 Left 1132746112 16:1436996-1437018 CCAAGGCAGGGCCTGGGCAGCCG 0: 1
1: 0
2: 2
3: 57
4: 497
Right 1132746119 16:1437010-1437032 GGGCAGCCGAGGGCCCGTGGGGG 0: 1
1: 0
2: 0
3: 31
4: 284
1132746112_1132746129 26 Left 1132746112 16:1436996-1437018 CCAAGGCAGGGCCTGGGCAGCCG 0: 1
1: 0
2: 2
3: 57
4: 497
Right 1132746129 16:1437045-1437067 CACAGGTGCCCGAGGGAGGCAGG 0: 1
1: 0
2: 5
3: 40
4: 341
1132746112_1132746127 22 Left 1132746112 16:1436996-1437018 CCAAGGCAGGGCCTGGGCAGCCG 0: 1
1: 0
2: 2
3: 57
4: 497
Right 1132746127 16:1437041-1437063 ACCACACAGGTGCCCGAGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 143
1132746112_1132746123 9 Left 1132746112 16:1436996-1437018 CCAAGGCAGGGCCTGGGCAGCCG 0: 1
1: 0
2: 2
3: 57
4: 497
Right 1132746123 16:1437028-1437050 GGGGGCTGTTCCGACCACACAGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132746112 Original CRISPR CGGCTGCCCAGGCCCTGCCT TGG (reversed) Intronic