ID: 1132746121

View in Genome Browser
Species Human (GRCh38)
Location 16:1437023-1437045
Sequence GTGGTCGGAACAGCCCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132746121_1132746134 10 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746134 16:1437056-1437078 GAGGGAGGCAGGGCAGGCCCCGG 0: 1
1: 0
2: 27
3: 208
4: 1545
1132746121_1132746129 -1 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746129 16:1437045-1437067 CACAGGTGCCCGAGGGAGGCAGG 0: 1
1: 0
2: 5
3: 40
4: 341
1132746121_1132746126 -8 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47
1132746121_1132746135 13 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746135 16:1437059-1437081 GGAGGCAGGGCAGGCCCCGGTGG 0: 1
1: 1
2: 6
3: 117
4: 980
1132746121_1132746131 4 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746131 16:1437050-1437072 GTGCCCGAGGGAGGCAGGGCAGG 0: 1
1: 0
2: 5
3: 57
4: 826
1132746121_1132746127 -5 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746127 16:1437041-1437063 ACCACACAGGTGCCCGAGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 143
1132746121_1132746124 -9 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746124 16:1437037-1437059 TCCGACCACACAGGTGCCCGAGG 0: 1
1: 0
2: 0
3: 14
4: 209
1132746121_1132746130 0 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746130 16:1437046-1437068 ACAGGTGCCCGAGGGAGGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 289
1132746121_1132746136 14 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746136 16:1437060-1437082 GAGGCAGGGCAGGCCCCGGTGGG 0: 1
1: 0
2: 1
3: 46
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132746121 Original CRISPR GTGGTCGGAACAGCCCCCAC GGG (reversed) Intronic