ID: 1132746126

View in Genome Browser
Species Human (GRCh38)
Location 16:1437038-1437060
Sequence CCGACCACACAGGTGCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 47}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132746112_1132746126 19 Left 1132746112 16:1436996-1437018 CCAAGGCAGGGCCTGGGCAGCCG 0: 1
1: 0
2: 2
3: 57
4: 497
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47
1132746122_1132746126 -9 Left 1132746122 16:1437024-1437046 CCGTGGGGGCTGTTCCGACCACA 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47
1132746121_1132746126 -8 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47
1132746120_1132746126 -1 Left 1132746120 16:1437016-1437038 CCGAGGGCCCGTGGGGGCTGTTC 0: 1
1: 0
2: 1
3: 13
4: 162
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47
1132746115_1132746126 8 Left 1132746115 16:1437007-1437029 CCTGGGCAGCCGAGGGCCCGTGG 0: 1
1: 0
2: 7
3: 16
4: 280
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132746126 Original CRISPR CCGACCACACAGGTGCCCGA GGG Intronic
920087379 1:203427556-203427578 CGGACAACACAGGTCCCGGATGG - Intergenic
920631621 1:207658713-207658735 CCCGCCACACAGGAGCCAGAGGG + Intronic
1063098992 10:2933397-2933419 CCAAACACCCAGGTGCCTGATGG + Intergenic
1063386493 10:5619553-5619575 CCGACCACACAGGGGCAGGTGGG - Intergenic
1073962039 10:108943264-108943286 CCAACCCCACAGGTGACCTAGGG - Intergenic
1074901967 10:117824747-117824769 CCTGCCACAAAGGTGCCAGATGG + Intergenic
1077059526 11:611751-611773 CCGCCCACGCAGGGGGCCGAGGG + Exonic
1077340747 11:2025307-2025329 CCGAGCACACCTGTGCCCCAGGG - Intergenic
1077764631 11:5144683-5144705 CCGGCCGCACAGGAGCCCAAGGG - Intergenic
1202823732 11_KI270721v1_random:80496-80518 CCGAGCACACCTGTGCCCCAGGG - Intergenic
1096616749 12:52837466-52837488 CCCACCTGACACGTGCCCGAGGG + Intergenic
1120149145 14:81013751-81013773 CAGACCACACATGTGGCCCAAGG + Intronic
1120640033 14:86999601-86999623 CCCATCACACAGGTGCTCCAAGG + Intergenic
1122953665 14:105060140-105060162 CCCAGCACACAGGCACCCGAGGG - Intronic
1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG + Intronic
1139804084 16:69549233-69549255 CCTCCCACATAGGTGCCCTAAGG + Intergenic
1140027515 16:71304082-71304104 TCGACCACACTGCAGCCCGAAGG + Intergenic
1142194672 16:88733905-88733927 CAGGCCACGCAGGTGCCTGAAGG - Exonic
1143496474 17:7315427-7315449 CCGACCTCACAGGTGAAAGAAGG + Exonic
1152640782 17:81448360-81448382 CCGCCCACCCAGGGGCCCCAAGG + Intronic
1160277450 18:77451051-77451073 CTGACCATATAGGTGCCCAAGGG - Intergenic
1160434514 18:78836193-78836215 CCGAGTACAAAGGTGCCCGTAGG + Intergenic
1160523965 18:79524722-79524744 CCGGCCACCCAGGTTCCCGTCGG - Intronic
1160888395 19:1363391-1363413 CCATCCAGACAGGTGCCCAATGG - Intronic
1167035497 19:46992965-46992987 CTGTCCACATAGCTGCCCGAGGG + Intronic
927432049 2:23035034-23035056 CTGTCCACACAGGTGTCCGGTGG - Intergenic
948944904 2:241214619-241214641 CCGACCTCACAGGAGCCCCCAGG - Intronic
1174292699 20:49520104-49520126 CGGACCACACAGGTCCCTGTAGG - Intronic
1180084022 21:45499493-45499515 CAGCCCACACAGGTTCCTGAGGG - Intronic
1180170895 21:46057624-46057646 CCCACCACGCAGGTGCCCAGTGG + Intergenic
1185219325 22:49621686-49621708 CCGACCACACAGGTCAGCCACGG + Intronic
950407394 3:12813234-12813256 CCTGCCCCACAGGTGCCCCAAGG + Exonic
951545589 3:23821755-23821777 CCCACCACACACGCGCCCTACGG - Intronic
954295366 3:49671719-49671741 CCCTCCACAAAGGTGCCCAAGGG + Intergenic
960465972 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG + Intergenic
965887799 3:173470030-173470052 CAGACCACACAGATGTCTGAGGG - Intronic
970177437 4:13353608-13353630 CAGACCACACAGGTACAAGAAGG + Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
995240785 5:109883949-109883971 CCAACCACACAGGTGACCGTAGG - Exonic
1018044189 6:159951711-159951733 CCAACCACTCAGGTGCCCTGTGG + Intergenic
1019168165 6:170112749-170112771 CCTACACCACAGGTGCCCAATGG + Intergenic
1019539737 7:1546287-1546309 CCAGCCTCACAGGTGCCCGCTGG + Exonic
1037671055 8:21015753-21015775 AGGACCACACAGGTGACCAAGGG + Intergenic
1037983167 8:23269646-23269668 CAGAACCCACAGGTTCCCGAAGG + Intergenic
1053296903 9:36921926-36921948 CTGACCCCACAGGTGTCCGAGGG - Intronic
1060770382 9:126327495-126327517 CCTTCCAGACAGGTGCCTGAGGG - Intronic
1061431250 9:130532766-130532788 CGGATCACACAGGTCCCTGAGGG + Intergenic
1061861253 9:133469743-133469765 CCGACCAGGCACCTGCCCGATGG - Exonic
1062412856 9:136433582-136433604 CCGCCCACACAGGTGCTCTGGGG - Intronic
1062426586 9:136508838-136508860 CCGGCCACAGAGGTGCCCGAAGG - Intronic
1185802980 X:3030122-3030144 CCTACCACACAGGTTCACGGTGG + Intronic