ID: 1132746126

View in Genome Browser
Species Human (GRCh38)
Location 16:1437038-1437060
Sequence CCGACCACACAGGTGCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 47}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132746121_1132746126 -8 Left 1132746121 16:1437023-1437045 CCCGTGGGGGCTGTTCCGACCAC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47
1132746112_1132746126 19 Left 1132746112 16:1436996-1437018 CCAAGGCAGGGCCTGGGCAGCCG 0: 1
1: 0
2: 2
3: 57
4: 497
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47
1132746115_1132746126 8 Left 1132746115 16:1437007-1437029 CCTGGGCAGCCGAGGGCCCGTGG 0: 1
1: 0
2: 7
3: 16
4: 280
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47
1132746120_1132746126 -1 Left 1132746120 16:1437016-1437038 CCGAGGGCCCGTGGGGGCTGTTC 0: 1
1: 0
2: 1
3: 13
4: 162
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47
1132746122_1132746126 -9 Left 1132746122 16:1437024-1437046 CCGTGGGGGCTGTTCCGACCACA 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1132746126 16:1437038-1437060 CCGACCACACAGGTGCCCGAGGG 0: 1
1: 0
2: 1
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132746126 Original CRISPR CCGACCACACAGGTGCCCGA GGG Intronic