ID: 1132746304

View in Genome Browser
Species Human (GRCh38)
Location 16:1437746-1437768
Sequence TGGTGGGCTGAGAGCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 525}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132746296_1132746304 -5 Left 1132746296 16:1437728-1437750 CCTCTACCCTGGGGGCAGTGGTG 0: 1
1: 0
2: 3
3: 28
4: 303
Right 1132746304 16:1437746-1437768 TGGTGGGCTGAGAGCTGGAGGGG 0: 1
1: 0
2: 3
3: 51
4: 525
1132746292_1132746304 4 Left 1132746292 16:1437719-1437741 CCTGTCAGGCCTCTACCCTGGGG 0: 1
1: 0
2: 0
3: 21
4: 215
Right 1132746304 16:1437746-1437768 TGGTGGGCTGAGAGCTGGAGGGG 0: 1
1: 0
2: 3
3: 51
4: 525
1132746289_1132746304 8 Left 1132746289 16:1437715-1437737 CCGGCCTGTCAGGCCTCTACCCT 0: 1
1: 0
2: 0
3: 19
4: 274
Right 1132746304 16:1437746-1437768 TGGTGGGCTGAGAGCTGGAGGGG 0: 1
1: 0
2: 3
3: 51
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132746304 Original CRISPR TGGTGGGCTGAGAGCTGGAG GGG Intronic
900001189 1:15720-15742 CGGTGGACTCAGGGCTGGAGGGG + Intergenic
900020904 1:186241-186263 CGGTGGACTCAGGGCTGGAGGGG + Intergenic
900244163 1:1629991-1630013 GGGTGGGCTGTGATCTGGGGTGG - Intronic
900244181 1:1630038-1630060 AGGTGGGCTGTGAGCTGGGCCGG - Intronic
900291140 1:1924125-1924147 GGGTGGGCAGTGAGCTGGAGGGG - Intronic
900291146 1:1924145-1924167 GGGTGGGCGGTGAGCTGGGGGGG - Intronic
900514544 1:3074997-3075019 TGGTGGGCCCAGAGCAGGGGAGG + Intronic
900819606 1:4876476-4876498 TGGTGGGATGAGAGGTGGAGAGG - Intergenic
900866266 1:5270737-5270759 TGGTGGGGAGAGAACTGGGGTGG + Intergenic
900901057 1:5516164-5516186 TGGGGGACTGAGGCCTGGAGAGG - Intergenic
900902177 1:5524646-5524668 TGGTGGGCTGAGTGAGGGAGTGG + Intergenic
901178321 1:7321386-7321408 TGGAGGGCTGACAGAAGGAGAGG - Intronic
902655002 1:17860897-17860919 GGATGGGTGGAGAGCTGGAGAGG - Intergenic
903282015 1:22255410-22255432 TGGGGGGGTGAGAGCTGAAGTGG + Intergenic
903330049 1:22592679-22592701 AGGAGGCCTGAGGGCTGGAGGGG + Intronic
903812817 1:26044292-26044314 TGGCTGGCAGAGAGCTGGTGAGG - Exonic
904083080 1:27884287-27884309 TGGTCTGCTGAGAACGGGAGGGG + Intronic
904307694 1:29600697-29600719 GGATGGGCTGAGAGTAGGAGGGG + Intergenic
904764337 1:32831699-32831721 TGATGGGGGGAGAGGTGGAGAGG - Intronic
904869010 1:33604926-33604948 TGGTATGCTGAGAGCTAGAGAGG - Intronic
905086290 1:35380692-35380714 TGGTGGGATTAGGGTTGGAGTGG + Intronic
905312613 1:37060651-37060673 TGGAGAGATGAGGGCTGGAGGGG - Intergenic
905359716 1:37410977-37410999 GTGTGGGCTGACAGCTGGTGTGG - Intergenic
905646130 1:39626198-39626220 TGGTGTGCAGAGGGCAGGAGAGG + Exonic
905822815 1:41006977-41006999 CGCTGGGCTGAGAGGTGGACTGG + Intronic
906185114 1:43856691-43856713 TGGTGGGCAGAGAAAAGGAGAGG - Intronic
906535729 1:46550062-46550084 GGGTGGGCTGGGAGCCTGAGGGG + Intronic
907046054 1:51300797-51300819 TCATGGGCTGAGAGTAGGAGAGG - Intronic
907893189 1:58656167-58656189 TGTTGGGTTGAGAGCTGCAGAGG + Exonic
908250700 1:62263439-62263461 TGAAGGGCTCAGAGCTGGTGGGG + Intronic
908688568 1:66752287-66752309 GGGTTGGCGGCGAGCTGGAGGGG - Intergenic
910467829 1:87518995-87519017 TGGTGTGGTGGGTGCTGGAGAGG + Intergenic
912548876 1:110471421-110471443 TGGTGGGGACAGAGCTGGAAGGG + Intergenic
912701064 1:111878515-111878537 TGGTGGGGTGAGGTCTGGGGAGG + Intronic
913968529 1:143396318-143396340 TGGGGGGCTGAGGGCAGGTGGGG + Intergenic
914062907 1:144221914-144221936 TGGGGGGCTGAGGGCAGGTGGGG + Intergenic
914116243 1:144744440-144744462 TGGGGGGCTGAGGGCAGGTGGGG - Intergenic
914759374 1:150586149-150586171 TGGTGGGCAAAGAGGTGGGGAGG + Intergenic
915977902 1:160402470-160402492 TGGAGGGTTGAGACCTGGTGGGG + Intronic
915979034 1:160408728-160408750 TGGTGGGCTGAGGGGTGGGAAGG - Intronic
916530209 1:165649397-165649419 TGGTGGGGAGAGGGATGGAGAGG - Intronic
916746631 1:167689858-167689880 TGGTGGGATGAGGGAGGGAGGGG + Intronic
916951283 1:169782888-169782910 TGGTGAGCTGAGTGCTTAAGAGG - Intronic
917029051 1:170669634-170669656 TGGTAGGCTGATGGATGGAGCGG - Intronic
918131482 1:181633445-181633467 TGGTAGGCAGAGAGGTGGAGAGG + Intronic
920049667 1:203155830-203155852 TGCTGTGCTGGGAGCTGTAGGGG - Intronic
922458883 1:225799484-225799506 TGGTGGGCTGAGGCCGGGTGCGG - Intergenic
922880107 1:228974418-228974440 GGGTGGGGTGAGTGCTGGTGAGG + Intergenic
923619968 1:235570638-235570660 TGGGAGGCTGAGAGGGGGAGTGG - Intronic
924024441 1:239817818-239817840 GGGTGGGCTGAGAGGGTGAGAGG - Intronic
924633441 1:245763375-245763397 GGGTGGGCAGAGAGCTGTAGGGG + Intronic
924948408 1:248861423-248861445 TGGTGGGCTGGGGGATGGGGTGG - Intergenic
1063371918 10:5527658-5527680 TGGGGGGCTGTGAGCAGGAGGGG + Intergenic
1063648861 10:7913368-7913390 TGGGCGAATGAGAGCTGGAGTGG - Intronic
1063972742 10:11392894-11392916 TGGTGGGTAAAGAGCTGGAGGGG + Intergenic
1065916626 10:30358645-30358667 AAGTGGGCAGAGAGCTGGTGAGG - Intronic
1066382322 10:34912098-34912120 TGGTGATGGGAGAGCTGGAGAGG - Intergenic
1066669501 10:37821906-37821928 TTCTGGGCAGAGAACTGGAGAGG - Intronic
1067090635 10:43264421-43264443 TGGTGGGCTGACAGCCATAGAGG - Intronic
1067409634 10:46053141-46053163 TGGAGGGCTGAGAGGTGGGAAGG + Intergenic
1067686367 10:48468298-48468320 AGGTGTGATGAGGGCTGGAGAGG + Intronic
1069618943 10:69824481-69824503 TGGGAGGCTGGGAGCTGGGGAGG + Intronic
1069834490 10:71300265-71300287 AGGAGTGCTGAGGGCTGGAGTGG + Exonic
1069959876 10:72073341-72073363 TGGTGGGCAGAGGTCAGGAGTGG - Intronic
1071105388 10:82087828-82087850 TAATAGGCTGAGACCTGGAGTGG - Intronic
1071117707 10:82242592-82242614 TGTTTTGCTGAGACCTGGAGAGG + Intronic
1071571431 10:86699559-86699581 TGGTGGGTACAGAGCTGCAGGGG - Intronic
1075685763 10:124364247-124364269 GGGTTTGCTGAGAGGTGGAGTGG - Intergenic
1075937124 10:126351849-126351871 ATGAGGGCTGAGTGCTGGAGTGG - Intronic
1076162924 10:128259866-128259888 TGTGGGGCTGGGAGGTGGAGAGG - Intergenic
1076340719 10:129743100-129743122 TGGTGGGCTGTTGGGTGGAGCGG + Intronic
1076432242 10:130412479-130412501 TGCTGGGCTGTGTGCTGGGGAGG + Intergenic
1076478021 10:130766195-130766217 TGGTCGGCTGAGGGCTGGCAGGG + Intergenic
1076594012 10:131613850-131613872 CTGTGGGCAGAGTGCTGGAGAGG - Intergenic
1076701260 10:132274599-132274621 TGGTGGGCTGAGGGCAGGGGAGG - Intronic
1076712226 10:132343883-132343905 TGGTGGGCAGTGGGCTGGTGGGG - Intronic
1077133289 11:985751-985773 CGGTGAGCTCAGAGCAGGAGGGG - Intronic
1077192445 11:1261049-1261071 TGGTTGGCTGTCAGCAGGAGGGG + Intronic
1077223555 11:1427796-1427818 TGGGGGACTGGAAGCTGGAGCGG - Intronic
1078372357 11:10759430-10759452 TGGTGGGGTGAGAGCTTCACTGG + Intronic
1078934165 11:15937731-15937753 TAGAGGCCTGGGAGCTGGAGGGG - Intergenic
1080230680 11:30015908-30015930 TGGAGGGGTGAGAGGAGGAGGGG - Intronic
1081303226 11:41478882-41478904 TAGAGGGCTGAAATCTGGAGAGG + Intergenic
1081792113 11:45795528-45795550 AGGTGGGCTGAGAGTCGGGGAGG - Intergenic
1081857426 11:46312603-46312625 TCCTGGGCTGAGATCTAGAGGGG - Exonic
1082727803 11:56757797-56757819 GGCTGGGCAGAAAGCTGGAGAGG + Intergenic
1083571607 11:63764507-63764529 TGGGGGGCTGAGATCCTGAGAGG + Exonic
1084032230 11:66487772-66487794 GGGTTGGCTGGGAGCAGGAGTGG - Intronic
1084270407 11:68026518-68026540 TGTTGTACTGAGAGCTGGAGGGG - Intronic
1084561032 11:69905574-69905596 TGGTGGGATGGGGGCTGGATGGG - Intergenic
1085170065 11:74442167-74442189 TGGTGGGGTGGGAGGTGGGGTGG + Intergenic
1085238797 11:75034823-75034845 TGGTTGGCTGGGAGGTGGAGAGG - Intergenic
1085309725 11:75509071-75509093 TGGTGGGCATAGGGCTTGAGGGG - Intronic
1085691667 11:78669339-78669361 AGGTGATCTCAGAGCTGGAGTGG + Exonic
1087518950 11:99204781-99204803 TAGTGGCCTGAGAGCTGGCGTGG + Intronic
1088764527 11:112962746-112962768 TGGGGGGATGACAGCTGGAGGGG - Intronic
1088851399 11:113706274-113706296 TGCTGGCCTGAGAACAGGAGCGG - Exonic
1088979183 11:114846401-114846423 TGGTGGGGTTATAGCTAGAGAGG - Intergenic
1089080649 11:115773745-115773767 TAGTGGGCTGAGAGCTGAAGTGG + Intergenic
1089396753 11:118141126-118141148 TGGAAGGCTGAAAGCTGGTGGGG + Intronic
1089556997 11:119320413-119320435 TGGAGGGCGGAGAGCGGGGGAGG + Intronic
1091358488 11:134956457-134956479 TGGTCTGCTGAGACCTAGAGGGG - Intergenic
1091374278 12:15837-15859 CGGTGGACTCAGGGCTGGAGGGG + Intergenic
1091695225 12:2623835-2623857 TGGTGGGTGGAGAACTGAAGGGG - Intronic
1091800218 12:3320414-3320436 TGGGGGGCAGAGAGCGGGTGAGG - Intergenic
1094532768 12:31292567-31292589 TGGGGGGTTGAGAGCTGGTTAGG + Intronic
1095951588 12:47784619-47784641 TGCTGGGCTGAGCACTGGTGGGG - Intronic
1096650613 12:53060366-53060388 AGGTGGGCTGTGAGCAGGATGGG - Intronic
1096784440 12:54009135-54009157 TGGTGGGCTGGGGGCTGGGCAGG - Exonic
1097958558 12:65510883-65510905 TGCTGGGCTGAGGTCTGGGGAGG + Intergenic
1101506974 12:105355862-105355884 TGGGGGGAGGAGAGCTAGAGAGG + Intronic
1101991501 12:109489383-109489405 GTGTGAGCTGAGAGCTGCAGAGG + Intronic
1102685518 12:114721452-114721474 TGGAGTGCTGACAGGTGGAGAGG - Intergenic
1102700140 12:114832001-114832023 TGGTGGGCAGAGGAGTGGAGCGG + Intergenic
1103063538 12:117878035-117878057 TGAGGGGCTGAGATGTGGAGAGG + Intronic
1103256498 12:119545989-119546011 TGGGGGTCTGAGAGTTGGAGGGG - Intergenic
1103948800 12:124540884-124540906 TGGAGAGTGGAGAGCTGGAGGGG + Intronic
1103948810 12:124540909-124540931 TGGGGAGTGGAGAGCTGGAGGGG + Intronic
1103948827 12:124540957-124540979 TGGGGAGTAGAGAGCTGGAGGGG + Intronic
1103948988 12:124541447-124541469 TGGGGAGTGGAGAGCTGGAGGGG + Intronic
1103949072 12:124541696-124541718 TGGGGAGTGGAGAGCTGGAGGGG + Intronic
1103949144 12:124541878-124541900 TGGGGAGTGGAGAGCTGGAGGGG + Intronic
1104646947 12:130504369-130504391 TGATTTGCTGAGAGCTGAAGAGG - Intronic
1104676436 12:130715003-130715025 TGCTGGGCTCTGAGCAGGAGTGG - Intronic
1104722780 12:131054661-131054683 TGCTGCGCTGAGAACTCGAGGGG + Intronic
1104938118 12:132377789-132377811 TGGAGGGGGGAGAGATGGAGAGG + Intergenic
1104938197 12:132378292-132378314 TGGAGGGGGGAGAGATGGAGAGG + Intergenic
1106250451 13:27978397-27978419 TGGCGGGCAGCGAGCTGCAGCGG - Exonic
1106365365 13:29073995-29074017 TGGTGTTCTGAGAGCAGGAACGG - Intronic
1106776301 13:33013541-33013563 TGGTGAGCTGAGAGCTTGTGGGG + Intergenic
1107389146 13:39945319-39945341 TGGTGGGCAGAGAGGTGGGTGGG - Intergenic
1111017379 13:82398995-82399017 TGGTGGGATGAGGGCAGCAGTGG + Intergenic
1113079784 13:106506657-106506679 TGTTCGGCTGCAAGCTGGAGAGG - Intronic
1113086958 13:106578400-106578422 AGGTGGGCTGAGGGCTTGTGTGG - Intergenic
1113630675 13:111881348-111881370 TTGTGTGCTGAGAGCTGATGAGG + Intergenic
1114888569 14:26887339-26887361 TCGTAGGCTCACAGCTGGAGGGG - Intergenic
1114977551 14:28120970-28120992 TGGTGGGCATAGAGCTGGCCAGG + Intergenic
1116330298 14:43587387-43587409 TGGTGGGTTGAGTGGTGGGGAGG + Intergenic
1117549151 14:56817078-56817100 CCCTGGCCTGAGAGCTGGAGAGG - Intergenic
1118182602 14:63508143-63508165 TGAAGGCCTGAGAGCTGCAGGGG - Intronic
1118921546 14:70153784-70153806 TGATGAGATGAGAGCAGGAGGGG - Intronic
1119019087 14:71091087-71091109 TGGAGGGCTGAGGGGAGGAGAGG + Intronic
1119762403 14:77160898-77160920 TTGGGGGATGAGAGCTGGAGAGG + Intronic
1120906476 14:89625348-89625370 TGGTTGGCTGAGAGCCAGATTGG - Intergenic
1120962836 14:90140915-90140937 TGGGTGGCTGAGAGCTGTGGGGG - Intronic
1121507487 14:94487729-94487751 CGGTGGGGGGAGAGATGGAGTGG + Intronic
1121598540 14:95185393-95185415 TGGAAGGCTGGGAGCTGGAGTGG - Exonic
1121843721 14:97155429-97155451 TGGCCAGCTGAGAGCTGGGGAGG - Intergenic
1121931695 14:97978113-97978135 TTGTGGGGCGAGAGCCGGAGGGG - Exonic
1122277994 14:100605081-100605103 CTATGGGCTGAGAGATGGAGAGG + Intergenic
1122630314 14:103104601-103104623 TGGGCGGCTGAAAGCTGGAGGGG + Intronic
1122840334 14:104458987-104459009 TAGTGAGCTGAGAGCTGGCTAGG + Intergenic
1123438776 15:20274700-20274722 GGGTGGTTTCAGAGCTGGAGGGG - Intergenic
1123778753 15:23605159-23605181 TGGTGGGCCAAGACCTGCAGAGG - Intronic
1123986217 15:25648531-25648553 GGGTGGGTGGAGAGATGGAGAGG + Intergenic
1124067950 15:26363470-26363492 TGGCGGGATGGGAGGTGGAGGGG + Intergenic
1124886345 15:33690179-33690201 AGGTGGGCTGCAGGCTGGAGAGG - Intronic
1125479180 15:40069092-40069114 GAGGGGGCTGAGAGCAGGAGTGG - Intergenic
1125577101 15:40763644-40763666 GGGTGGGCTGGGGCCTGGAGAGG + Intergenic
1125883965 15:43214732-43214754 TGCAGGGGTGAGAACTGGAGAGG - Intronic
1127867090 15:63042178-63042200 TGGCTGGCTGAGAGCTGCCGGGG + Intergenic
1128145005 15:65328146-65328168 AGGTGGGCTGTGGGCAGGAGGGG + Exonic
1128665321 15:69533305-69533327 TGGTGGGCGGGGAGGTGGGGTGG + Intergenic
1128756688 15:70188099-70188121 TGGTAGGATGAGGGCTGGACCGG + Intergenic
1128768642 15:70266126-70266148 TGGGGGGATGAGAGCCGGTGAGG - Intergenic
1129669085 15:77597191-77597213 GGGTGGGGAGGGAGCTGGAGAGG + Intergenic
1129695300 15:77737595-77737617 TGGTGGGGACAGAACTGGAGAGG - Intronic
1129893627 15:79088628-79088650 TAGTGGGTTGAGGGATGGAGGGG + Intronic
1131014986 15:89050649-89050671 TGCTGGGATGGGAGGTGGAGAGG + Intergenic
1132155638 15:99493604-99493626 TGGTGGGCTGACGGCAGGTGAGG - Intergenic
1132400556 15:101502263-101502285 TGGTGGCCAGGGAGCTGGGGCGG - Intronic
1132452320 15:101975219-101975241 CGGTGGACTCAGGGCTGGAGGGG - Intergenic
1132454576 16:15404-15426 CGGTGGACTCAGGGCTGGAGGGG + Intronic
1132746304 16:1437746-1437768 TGGTGGGCTGAGAGCTGGAGGGG + Intronic
1132815213 16:1822588-1822610 TGGTGCCCTCAGAGCTGGAGGGG - Intronic
1134439617 16:14290992-14291014 AGGTGGGGTGAGAGATGGAGAGG + Intergenic
1135037407 16:19089659-19089681 CGGTGGGCTGAGAGTTGGGTAGG + Intergenic
1135591728 16:23710097-23710119 TGGAGCACTGAGAGGTGGAGAGG - Intronic
1136139789 16:28281376-28281398 TGGAGGCCTGGGTGCTGGAGGGG - Intergenic
1136226557 16:28864041-28864063 TGGAGGGCCGGGGGCTGGAGAGG + Intronic
1136846390 16:33579619-33579641 GGGTGGTTTCAGAGCTGGAGGGG + Intergenic
1137256428 16:46778653-46778675 CTGTCTGCTGAGAGCTGGAGAGG + Intronic
1137752579 16:50877801-50877823 TGGTGGTCTGGGCTCTGGAGGGG + Intergenic
1137765247 16:50973048-50973070 AGGGGGTCTGAGAGCTGGACAGG + Intergenic
1138147787 16:54627762-54627784 TGGTGGGCTCAGAACAGGAAGGG + Intergenic
1138195320 16:55047722-55047744 TGGTGGGCGGAGAGGGGTAGAGG - Intergenic
1138443196 16:57047271-57047293 TGGTGGCCTGGGCTCTGGAGGGG + Intronic
1138536729 16:57664163-57664185 TGGGGGGCTGAGGGAGGGAGGGG - Exonic
1138695008 16:58804799-58804821 TGGTGGGGTGGGAGCAGCAGAGG + Intergenic
1139117664 16:63976262-63976284 TGGAGGGAAGAGAGCTAGAGAGG + Intergenic
1139136077 16:64206219-64206241 TGGGGGGCGGAGTGGTGGAGGGG + Intergenic
1139447551 16:67007173-67007195 TGGTACGCTGAGAGCTGTACTGG + Intronic
1139597900 16:67968702-67968724 TCGGGGGCGGAGAGCGGGAGGGG + Intronic
1140034030 16:71359361-71359383 TGATTGGCTGGGAGCAGGAGTGG + Intronic
1140889136 16:79270256-79270278 TGCTGGCCTGAGGGCTGCAGGGG + Intergenic
1141461009 16:84178967-84178989 GGAGGGGCTGAGAGCTAGAGAGG + Exonic
1141539575 16:84709381-84709403 TCTTGGGCACAGAGCTGGAGGGG + Intronic
1141857164 16:86691287-86691309 TGGTGGGCTGGGATTTAGAGAGG - Intergenic
1142088155 16:88195475-88195497 AGGTGATCTGAGGGCTGGAGGGG + Intergenic
1142284899 16:89167687-89167709 TGGCGGGCTCAGGGCTGGCGGGG - Intergenic
1142309679 16:89305169-89305191 TGGAGGGCTGACTGCAGGAGGGG + Intronic
1142358634 16:89615816-89615838 TGGTGGGGTGTGAATTGGAGAGG + Intronic
1203108098 16_KI270728v1_random:1428274-1428296 GGGTGGTTTCAGAGCTGGAGGGG + Intergenic
1142616626 17:1140241-1140263 TGGAGGGCTGAGCGATGGACAGG + Intronic
1143115805 17:4581400-4581422 TGGGGTGCAGAGGGCTGGAGGGG + Intergenic
1143116193 17:4583039-4583061 TCTTGTGCTGAGACCTGGAGGGG + Intergenic
1143504645 17:7356885-7356907 TGATTGGTTGAGGGCTGGAGGGG - Exonic
1144190336 17:12839984-12840006 GGATGTGCTGAGAGCTGAAGGGG - Intronic
1144459074 17:15443078-15443100 TGGTGGGATGAGAGATTGAGCGG - Intronic
1144714043 17:17422029-17422051 TGGTGGGCAGGGTCCTGGAGAGG - Intergenic
1144836010 17:18157079-18157101 GGGTGGGCTGGGGGCAGGAGGGG + Intronic
1144839109 17:18174789-18174811 TGCTGGGCCCAGACCTGGAGGGG - Intronic
1144993221 17:19248193-19248215 TGGTGGAATCAGGGCTGGAGAGG + Intronic
1145903348 17:28501919-28501941 TGGTGTGATGAGAGAAGGAGGGG + Intronic
1145933771 17:28703435-28703457 GGGTGGGCTCAGGGCTGCAGGGG - Exonic
1146119236 17:30176271-30176293 TGTTGGGAGGAGAGCTGTAGGGG - Intronic
1146124548 17:30221423-30221445 GGGTGGGCTGTGACCTGGGGTGG - Intronic
1146124560 17:30221456-30221478 GGGTGGGCTGTGACCTGGGGTGG - Intronic
1146124577 17:30221506-30221528 GGGTGGGCTGCGACCTGGGGTGG - Intronic
1146124597 17:30221556-30221578 GGGTGGGCTGTGACCCGGAGTGG - Intronic
1146346593 17:32064082-32064104 AGGTGGGAGGATAGCTGGAGTGG + Intergenic
1146405535 17:32533645-32533667 AGGAGGCCTGGGAGCTGGAGAGG - Intronic
1146895679 17:36540079-36540101 GCATGGGCAGAGAGCTGGAGAGG + Intronic
1147267537 17:39244018-39244040 TGTTGGGGCGAGAGCAGGAGGGG + Intergenic
1147638985 17:41982451-41982473 AGCTGGGCTGAGACCTGGTGAGG - Intronic
1148217179 17:45839676-45839698 TGGTGAGCTGAGGGCAGGGGTGG - Intergenic
1148493505 17:48037920-48037942 AGGTGGGGTGAGGGCGGGAGGGG - Intronic
1149552211 17:57548674-57548696 TGGGGGGCTGGGAGCGGGTGGGG + Intronic
1149570590 17:57669699-57669721 CGGAGGACTGAGAGCAGGAGAGG - Intronic
1150208543 17:63428153-63428175 AGGTGGGCTGCCAGCTTGAGTGG + Intergenic
1150433793 17:65139090-65139112 TGGAGGGGGGAGAGCTGGGGTGG - Intronic
1150675615 17:67244674-67244696 GGGTGGGGTGGGGGCTGGAGCGG - Intronic
1151303937 17:73250919-73250941 TGCTTGGCTGAGAGCTGGGAGGG - Intronic
1151362451 17:73596756-73596778 AGGGAGGATGAGAGCTGGAGAGG - Intronic
1151755290 17:76072238-76072260 TGGAGGGCTGGGGGCGGGAGAGG - Intronic
1152222731 17:79077910-79077932 TGCTGGGGTGGGGGCTGGAGGGG + Intronic
1152266647 17:79298781-79298803 GGGTGGTAGGAGAGCTGGAGTGG + Intronic
1152783834 17:82237994-82238016 TGTGGGACTCAGAGCTGGAGGGG + Intronic
1153774806 18:8443027-8443049 CGGTGGGCTGAGACCTCAAGTGG - Intergenic
1153775584 18:8450736-8450758 TGGAGGGCTGCTTGCTGGAGAGG - Intergenic
1154015334 18:10611354-10611376 GGGTGGGCTGGGAGGTGGTGGGG + Intergenic
1154190187 18:12224288-12224310 GGGTGGGCTGGGAGGTGGCGGGG - Intergenic
1155286460 18:24293721-24293743 TGGGGGGCTGAGGGGTGGAAGGG + Intronic
1155441334 18:25865590-25865612 TGGGGGGTCAAGAGCTGGAGAGG + Intergenic
1155980861 18:32177939-32177961 TGATGGGCTGAGAGGGAGAGAGG - Intronic
1156744160 18:40369165-40369187 TGTTGGACTGAAAGCTGGTGAGG - Intergenic
1157114723 18:44852185-44852207 TGGTGGGCTGAGGGCTGGGCGGG - Intronic
1157523865 18:48363952-48363974 TGGTGCCCTGAGGGGTGGAGTGG - Intronic
1157556032 18:48613428-48613450 TGCTGGGCTGAGAGCAGCAAGGG + Intronic
1157889046 18:51397102-51397124 TGGTGGGAGGAGAGCTGGGGTGG - Intergenic
1158106522 18:53890764-53890786 AAGTGGGCAGAGATCTGGAGTGG + Intergenic
1158242366 18:55391467-55391489 TGGAGGGCTGAGTCCTAGAGAGG - Intronic
1158450515 18:57559902-57559924 TGGTGGACAGAGATTTGGAGGGG - Intronic
1158602245 18:58864569-58864591 CGGTGGGCTGTGGGGTGGAGGGG + Intronic
1158931836 18:62330555-62330577 TATTGAGCTGTGAGCTGGAGAGG + Intronic
1160534443 18:79584725-79584747 AGGTGGCCTGAGGGCTAGAGAGG + Intergenic
1160673776 19:377913-377935 AGATGGGATGGGAGCTGGAGAGG - Intergenic
1160871742 19:1280900-1280922 TCCTGGGCTCAGAGCCGGAGAGG + Intergenic
1161155879 19:2731771-2731793 TGGGGAGGTGAGAGCTGGGGAGG - Intronic
1161210202 19:3062007-3062029 CGCCGGGCTGGGAGCTGGAGAGG + Intronic
1161269556 19:3382352-3382374 TGGTGGTCTGAGAGGGGAAGTGG + Intronic
1162118965 19:8450082-8450104 TGGTGGCCTTGGAGCTGGAATGG + Intronic
1162392005 19:10395547-10395569 TGGTAGGGTGAGAGGGGGAGTGG + Intronic
1162761916 19:12893522-12893544 TCCTGGCCCGAGAGCTGGAGCGG + Exonic
1163218383 19:15897308-15897330 GGGTGGGCTGGGATCTGGGGTGG - Intronic
1163507856 19:17719035-17719057 TGGTGGGGCAAGAGCTGGTGAGG - Intergenic
1163574035 19:18099975-18099997 TGGAGGGCTAGGAGCAGGAGTGG + Intronic
1164435904 19:28229101-28229123 TGGTCAGCTGAGACCTGGATAGG - Intergenic
1164761924 19:30734711-30734733 GGGTGGCCTGAGAGCTGAACTGG + Intergenic
1164971092 19:32533197-32533219 TGGAGAGCTGAGCCCTGGAGAGG + Intergenic
1165034741 19:33024543-33024565 GGGTGGTTTCAGAGCTGGAGGGG - Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1166194423 19:41196604-41196626 TGGTGGGCTGAAACAGGGAGAGG + Intronic
1166205157 19:41264703-41264725 AGGGGGGCTCCGAGCTGGAGGGG + Exonic
1166746365 19:45143685-45143707 AACTGTGCTGAGAGCTGGAGTGG - Intronic
1166824056 19:45598483-45598505 AGGAGGGGTGAGAGCTGGACCGG - Intronic
1166938703 19:46350281-46350303 TTGGGGGCTGAGGGATGGAGAGG + Intronic
1166972626 19:46579943-46579965 ACGGGGGCTGAGAGCAGGAGGGG - Intronic
1167420736 19:49401451-49401473 GGGTGGGCAGAGGTCTGGAGAGG + Intronic
1167460066 19:49620476-49620498 TGGTGAGCTGAGGCCTGGGGAGG + Exonic
1167492668 19:49801374-49801396 TGGGGGGCTGTGTGCAGGAGTGG - Exonic
1167566955 19:50262633-50262655 TGGAGGGCTGTGAGCAGGGGAGG + Intronic
1167611123 19:50508135-50508157 GGGAGAGCTGAGAGCAGGAGAGG - Intronic
1167735708 19:51293514-51293536 GGGAGGGCTGTGAGCAGGAGAGG + Intergenic
1167798104 19:51723988-51724010 CTGTGGCCAGAGAGCTGGAGGGG + Intronic
1202702317 1_KI270712v1_random:173786-173808 TGGGGGGCTGAGGGCAGGTGGGG + Intergenic
925176008 2:1784398-1784420 TGCTGGCCTGGGAGCTGGGGCGG - Intergenic
925200037 2:1959696-1959718 TGGTGCACTGAGAGCTGTAAAGG - Intronic
925411547 2:3642729-3642751 TGGTGGGAGGATGGCTGGAGCGG - Intronic
926423887 2:12724078-12724100 GGGTGGGATGAGAACTGGGGTGG + Intronic
927516152 2:23672710-23672732 GGGTGAGGTGAGAGCTGCAGAGG - Intronic
927561374 2:24076586-24076608 AGGAGGGCGGAGAGCTGGGGCGG + Intronic
927786395 2:25978069-25978091 TGGAAGCCTGAGGGCTGGAGAGG + Intronic
927936559 2:27079598-27079620 TGGAGGGAACAGAGCTGGAGTGG - Intronic
928102022 2:28444333-28444355 TGGTTGGCTGGAAGCGGGAGTGG - Intergenic
928414018 2:31076416-31076438 TGGTGGTCTCAGAGCGGGGGTGG - Intronic
929571408 2:43025410-43025432 TGGGAGGCAGAGAGCTGCAGTGG + Intergenic
931432683 2:62221094-62221116 TGGTGGGCTTAGAGAAGGATAGG - Intronic
931784439 2:65606892-65606914 TGGTGGGATAAGAGCTGGTGAGG + Intergenic
933995215 2:87663177-87663199 TGGTGGTCTGAGAGCTGATGTGG - Intergenic
934173230 2:89557225-89557247 TGGGGGGCTGAGGGCAGGTGGGG + Intergenic
934283545 2:91631582-91631604 TGGGGGGCTGAGGGCAGGTGGGG + Intergenic
934558648 2:95300842-95300864 TGCTGGGCAGAGAGCTGAGGTGG - Intronic
934606681 2:95700501-95700523 TAGTGGGCTGAGTGTGGGAGCGG + Intergenic
934646406 2:96061659-96061681 TGGTGGCCTGGGAGGTGAAGGGG + Intergenic
935638197 2:105266744-105266766 TTGGGAGCTGAGAGCCGGAGAGG + Exonic
936298645 2:111287736-111287758 TGGTGGTCTGAGAGCTGATGTGG + Intergenic
936568536 2:113597692-113597714 CGGTGGACTCAGGGCTGGAGGGG - Intergenic
937316648 2:120935941-120935963 TGGTCAGCCGAGAGCAGGAGGGG + Intronic
937774353 2:125758125-125758147 TCGTGGGATGAGAGCAGAAGTGG + Intergenic
937811063 2:126199647-126199669 AGATGGGCTGAGTGCTGGATAGG - Intergenic
937909955 2:127070701-127070723 TGGTGGGTGCAGAGCTGGGGAGG - Intronic
938129153 2:128695754-128695776 AGGTGGCCTGAGAGCTGGATGGG + Intergenic
938169726 2:129064416-129064438 GGGTGGGCAAGGAGCTGGAGGGG + Intergenic
938243409 2:129760225-129760247 TAGTGCTCTGAGGGCTGGAGAGG - Intergenic
938390204 2:130899018-130899040 TTGCTGGCTGTGAGCTGGAGGGG - Intronic
940000826 2:148964899-148964921 AGGAGGGCTGGGAGCTGGGGTGG + Intronic
942413649 2:175736561-175736583 TGGAGTGCTGAGACCTGGAGGGG - Intergenic
942437893 2:176001542-176001564 TGGTGGGCTGTGGGGTGGAGGGG - Intronic
942591604 2:177552644-177552666 TGCTGGGCGGAGAACTGCAGCGG - Exonic
942598729 2:177618582-177618604 TGCTGGGCCGAGAACTGCAGCGG - Exonic
943577009 2:189641704-189641726 TGGTGGGCTGTGAGAGGTAGAGG + Intergenic
944962336 2:204889183-204889205 TGATGTGCTCAGAGCTGGACTGG - Intronic
945886032 2:215376661-215376683 TGGTGGGCTGACATCTGCACAGG + Exonic
946075946 2:217073637-217073659 TGGTAGGCCAAGAGCTGGAAAGG + Intergenic
946186156 2:217981560-217981582 TTCTGGGCTGGGAGCTGGGGTGG - Intronic
946199639 2:218064363-218064385 TGGAGGGCAGGGAGTTGGAGAGG - Intronic
946389486 2:219406908-219406930 TGGTGGACTGGGATCTGGAGTGG + Intergenic
947826306 2:233108038-233108060 TGGTGGACTGAGAGGTGGGAGGG - Intronic
947983244 2:234427413-234427435 TGGCGGGGCCAGAGCTGGAGTGG + Intergenic
948178389 2:235961470-235961492 TGGTGGGATGTGAGCGGGACTGG + Intronic
948231781 2:236354492-236354514 TGGTGGGCAGTGGGCTGGGGAGG - Intronic
948460987 2:238129900-238129922 TGTTGGGCTGGGAGCCGTAGGGG + Intronic
948525074 2:238566481-238566503 TGGTGGGGGGAGAGTGGGAGGGG - Intergenic
948635049 2:239329473-239329495 GGGTGTGCAGAAAGCTGGAGAGG - Intronic
948635161 2:239329988-239330010 GGGTGTGCAGAAAGCTGGAGAGG + Intronic
948779241 2:240307767-240307789 TGGTGGGGTGTGTTCTGGAGTGG - Intergenic
948836772 2:240629641-240629663 TGCTGGGCTGGGGACTGGAGGGG + Intronic
948890757 2:240905953-240905975 TGGTGGACTGAGACCTGGAGAGG - Intergenic
1168749354 20:271161-271183 TGCTGGGAAGAGAGCAGGAGGGG + Exonic
1169860445 20:10145933-10145955 ACATGGGCTGAGAGCTGGAAAGG - Intergenic
1170614835 20:17940098-17940120 TGGTGTGCTGAGACCTGGAAAGG - Intergenic
1170999552 20:21397980-21398002 TGAGGGGCTGATAACTGGAGAGG - Exonic
1172061743 20:32191128-32191150 TGGCAGGCTAAGAGCTGGATTGG + Intergenic
1172388202 20:34548448-34548470 AGGTGGAGTTAGAGCTGGAGAGG + Intronic
1172590914 20:36117234-36117256 TGCCTGCCTGAGAGCTGGAGGGG + Intronic
1173125780 20:40334870-40334892 TCCTGGGCAGAGAGCTGAAGTGG - Intergenic
1173973149 20:47167957-47167979 AGCAGGGCTGCGAGCTGGAGAGG - Intronic
1174052395 20:47776039-47776061 TGGCCAGATGAGAGCTGGAGAGG - Intronic
1174080923 20:47970313-47970335 TGTTGGCCTGAGAGCTGGGAGGG - Intergenic
1174399523 20:50268445-50268467 AGGAGGGATGAGAGCTGGAAGGG - Intergenic
1175073989 20:56358747-56358769 TGGTGGGCGGAGAGGAGGCGGGG + Intergenic
1175250749 20:57609010-57609032 TGGGGGGCTTTGAGCAGGAGAGG - Intronic
1175264430 20:57694008-57694030 TGCAGGGCTGGGAGGTGGAGAGG - Intronic
1175290655 20:57873008-57873030 TGGTGCCCTGGCAGCTGGAGTGG + Intergenic
1175337621 20:58206444-58206466 AGGTGGGCGCAGTGCTGGAGTGG - Intergenic
1175673646 20:60928684-60928706 TGGTGGGATGGGGGCTGGAAAGG - Intergenic
1176163179 20:63658865-63658887 AGGAGGGCAGAGGGCTGGAGAGG + Intronic
1176177180 20:63734254-63734276 TGGCGGGCTGAGTCCAGGAGGGG + Intronic
1177727554 21:24989164-24989186 TGGAGTGGGGAGAGCTGGAGTGG + Intergenic
1179485098 21:41705017-41705039 TGTTGGGCTGAGCGGTGCAGAGG + Intergenic
1180148985 21:45938049-45938071 GGGCGGGGTGAGAGCAGGAGGGG + Intronic
1180744756 22:18079775-18079797 TGCTGAGTTGGGAGCTGGAGAGG + Intronic
1180950904 22:19720066-19720088 TGAGGGGCTGAGGGTTGGAGAGG + Intronic
1181161715 22:20963705-20963727 TGGAGGGCTGGAAGCAGGAGGGG - Intergenic
1182894673 22:33849335-33849357 TGGGGTGCTGGGAGGTGGAGTGG - Intronic
1183061329 22:35338079-35338101 TGATGGGCTGGGAGCGGCAGAGG - Intronic
1183376816 22:37470067-37470089 GAGTGGGCTGAGAGCAGAAGTGG - Intronic
1183390117 22:37540940-37540962 TGGTGGGGTGAGAGGTGGGAAGG - Intergenic
1183782930 22:40010139-40010161 GGGTGGGCAGCCAGCTGGAGGGG + Intronic
1183986244 22:41572097-41572119 TGGTGGGCAGAGGGCTGGGTAGG - Exonic
1184744167 22:46446401-46446423 TGGTGGGGCGATTGCTGGAGAGG - Intronic
1184763220 22:46557405-46557427 ATGTGGCCTGAGAGCTGGGGAGG - Intergenic
1185001957 22:48251698-48251720 GGCAGGGCTGAGGGCTGGAGGGG - Intergenic
1185041055 22:48504614-48504636 GGGTGTGCTGAGGCCTGGAGAGG + Intronic
1185094076 22:48796492-48796514 TGCTGGGGAGGGAGCTGGAGTGG + Intronic
1203302149 22_KI270736v1_random:84597-84619 TGGTGGGCTGTGAAATGGAATGG + Intergenic
949558556 3:5181688-5181710 TGGTGGGTTCAGAACTGGAATGG + Intergenic
950116378 3:10452708-10452730 TGGAGGGGTGAGCGCTGGGGAGG + Intronic
950357979 3:12427821-12427843 GTGTGGGCTGAAAACTGGAGGGG - Intronic
950421133 3:12900659-12900681 CAGGGAGCTGAGAGCTGGAGTGG + Intronic
950500342 3:13359670-13359692 GGGTGAGCTGAGAGCTTGTGGGG - Intronic
950534089 3:13569411-13569433 TGGTGGGCAGGGAGGTGGCGGGG + Intronic
951580730 3:24160056-24160078 TGGTGGGCTGTGAGCTGAGTTGG + Intronic
951910721 3:27747758-27747780 TGGTGGTGTCAGAACTGGAGGGG + Intergenic
952865340 3:37851591-37851613 TGGTGGGCTCTGAGGTGTAGGGG + Intergenic
952926574 3:38325100-38325122 TGGTGGGGTGGAAACTGGAGAGG - Intergenic
953075777 3:39569176-39569198 AGGTGGCCTGAGCTCTGGAGTGG + Intergenic
953484437 3:43282241-43282263 TTGAGGGCTGAAAGCTGGAGTGG + Intergenic
953706509 3:45235065-45235087 TGGTGGGCAGAGAGATGGCTGGG - Intergenic
953928475 3:46994300-46994322 TGGTGGGCAGTGGGCTGCAGAGG - Intronic
954098941 3:48354769-48354791 TGGTGGGCTGACAGCAGAACTGG - Intergenic
954455689 3:50598568-50598590 TGGTGAAGTGGGAGCTGGAGGGG + Intergenic
954675217 3:52311856-52311878 TGGCGGGCCCAGAGCAGGAGGGG - Intergenic
954676699 3:52319804-52319826 TGAAGGGCTGAGGGATGGAGGGG + Intronic
955015366 3:55064429-55064451 TGCTGGGCTGAGTGCAGGAGGGG + Intronic
955060361 3:55487871-55487893 TGCTGTGCGGTGAGCTGGAGGGG + Intronic
955214917 3:56977342-56977364 TGGTGAGCTGAGAGTTAGTGAGG - Intronic
955400546 3:58588153-58588175 TTGTGGGCTGAGAACTGGATTGG - Intronic
955658672 3:61273001-61273023 TGGGGGGCTGAGAGGGGAAGAGG - Intergenic
956890465 3:73608106-73608128 TGGTGGTCAAAGAGCTGCAGTGG + Intronic
958459701 3:94379379-94379401 TGCAGGGCAGAGTGCTGGAGAGG + Intergenic
959879112 3:111422228-111422250 TTGTGGCCTGAGAGTTGGACAGG - Intronic
961013197 3:123449138-123449160 AGGTGGGATGGGAGGTGGAGAGG + Exonic
961384986 3:126518176-126518198 GGGTGGGGTGACAGGTGGAGCGG + Intergenic
961529776 3:127533415-127533437 AAGTGGGCAGAGGGCTGGAGGGG + Intergenic
963152619 3:142061687-142061709 TGAAGGGCTGAGAACTAGAGGGG - Intronic
965484199 3:169258531-169258553 TGAAGGGCTTAGAGCAGGAGTGG - Intronic
966008605 3:175048870-175048892 TGGTGGCCTGAAAGCTGCATAGG + Intronic
966387179 3:179411637-179411659 TAATGGGCTGAGAGATAGAGAGG + Intronic
967377186 3:188817660-188817682 TTGAGGGCTGAGGGATGGAGAGG + Intronic
967814510 3:193787701-193787723 TGGTGGGCAGAGCGCTGCATTGG + Intergenic
968074720 3:195810073-195810095 CGGTGGGATGAGCACTGGAGCGG + Intronic
969275954 4:6135893-6135915 TGGTGGGGGGAGAGGTGGGGGGG + Intronic
969277638 4:6147674-6147696 AGGTGGCCTGAGAGTTGGTGTGG - Intronic
969385633 4:6845094-6845116 TGCTGGGCTGGAAGCTGGAATGG - Intronic
969827086 4:9766087-9766109 TGGGGGGCTGAGGGCAGGTGGGG + Intergenic
970573990 4:17409669-17409691 TGGTGAGCAGAGGGATGGAGGGG - Intergenic
973910030 4:55571108-55571130 TGGTGGGCTCTGGGCTGTAGAGG - Intronic
974305422 4:60131837-60131859 TAGTGGGTTGAGAGATGGAGGGG + Intergenic
975655845 4:76640633-76640655 TGGTGAGCTCATAGCTGGAAAGG - Intronic
976416257 4:84779670-84779692 TGGTGGGGTGTGAGGTGGAGGGG + Intronic
977025167 4:91809598-91809620 TAGTGGGGAGAGAGCTAGAGTGG + Intergenic
980807999 4:137838106-137838128 TGGTGGGCTGAGTGGTTGAGTGG - Intergenic
982175490 4:152702014-152702036 TGGTGGGCTCCGAGCTGTAGTGG - Intronic
985138146 4:186810612-186810634 AGGTGGCCTGAGAGCTGGGCTGG - Intergenic
985643284 5:1073675-1073697 TCGTGGGCTCGGTGCTGGAGGGG - Exonic
985688520 5:1294625-1294647 TGGTGGCCCGAGTGCTGCAGAGG - Exonic
985748884 5:1663346-1663368 GGCGGGGCTGAGACCTGGAGGGG + Intergenic
985790714 5:1925666-1925688 TGGTGGGCTGAATGTTAGAGAGG + Intergenic
985792309 5:1936473-1936495 TGGTGGGGAGAGAGTTGGAATGG - Intergenic
985893868 5:2737947-2737969 AGGTGGGCTGTGGGCTGCAGGGG - Intergenic
985981181 5:3465275-3465297 TGCTGGGTTGAGAGTTGGAGGGG + Intergenic
986351288 5:6882119-6882141 TGGTATACTGGGAGCTGGAGAGG - Intergenic
988589691 5:32538140-32538162 TGGTGGGATGCCAACTGGAGAGG - Intronic
988786027 5:34566008-34566030 TGATGGGCTGAGGCCTGTAGGGG + Intergenic
989621532 5:43389109-43389131 TGGGGGGCTAAGGGATGGAGAGG + Intronic
993015003 5:82525463-82525485 TGGTGGGCAGACAGCTTGTGTGG - Intergenic
996597952 5:125226873-125226895 GTGTGAGCTGAGACCTGGAGGGG + Intergenic
996786931 5:127247915-127247937 TTTTTGGCTGAGAGCTGGTGTGG + Intergenic
997734366 5:136202658-136202680 AGGTGGGCTGGGGGCTGGAGGGG + Intergenic
997747855 5:136315389-136315411 TGGTGGGCTGGGGGCTGAGGTGG + Intronic
1000001461 5:157142724-157142746 TGCTGGGCTGGGAACTGGGGAGG - Intronic
1001567232 5:172707456-172707478 TGGGGCCCTGGGAGCTGGAGCGG - Intergenic
1001840888 5:174875810-174875832 GGGTGGGAGGAAAGCTGGAGTGG + Intergenic
1002656283 5:180750814-180750836 TGGTGGGATGAGGGCAGGCGTGG + Intergenic
1003122661 6:3330445-3330467 TGGTGGTCTGGGAGATGGTGAGG - Intronic
1004191435 6:13467399-13467421 TGTTGGCCAGAGAGCTGGACAGG - Intronic
1004495537 6:16159632-16159654 TGGTGTGCTGGGAGCTTGGGTGG - Intergenic
1004504926 6:16239579-16239601 GGCTTTGCTGAGAGCTGGAGAGG + Intronic
1004878117 6:19976701-19976723 GGGTGGGGGGAGAGCTTGAGGGG + Intergenic
1005081961 6:21965422-21965444 TGGTGGGGGGAGAGGAGGAGAGG - Intergenic
1005423774 6:25679520-25679542 TTGTGGGCTGAGGGCTGGCAGGG + Intronic
1006008953 6:31026334-31026356 TGGTGGTCTGAGAGCCTGTGGGG - Exonic
1007316593 6:40994150-40994172 AGGAAGGCTGAGAGCTAGAGGGG - Intergenic
1007358867 6:41341446-41341468 TGGAGGGCAGAGAGCCGAAGGGG + Intronic
1007374146 6:41444865-41444887 TGATGGGCTGAGAGCAGGGTTGG + Intergenic
1007745241 6:44039521-44039543 TGGAGGGGTGAGGGCTGGGGTGG - Intergenic
1007764023 6:44150522-44150544 AGATGGGGTGGGAGCTGGAGTGG - Intronic
1007766847 6:44165753-44165775 TAGTGGGCCCAGGGCTGGAGGGG + Intronic
1007807995 6:44465068-44465090 GGTTGGGCGGAGAGCTGGTGGGG + Intergenic
1007924641 6:45641420-45641442 TGGTGGTCCGGGAGCTGGATGGG + Intronic
1007998524 6:46334558-46334580 TGGTGGGGTGGGGGCAGGAGAGG + Intronic
1008391984 6:50962726-50962748 AGGTGGGAGGAGAGTTGGAGAGG + Intergenic
1013226748 6:108124512-108124534 TGGGGTGCAGAGAGGTGGAGGGG + Intronic
1013846076 6:114453243-114453265 TGGAGGCCTGAGAGCTTGAGAGG - Intergenic
1014035947 6:116766449-116766471 TTGTGGGCTAAGAGATGAAGAGG - Intergenic
1015181797 6:130368740-130368762 AGGTGGTCTGAGAGCAGCAGGGG + Intronic
1018105784 6:160484955-160484977 AGATGGACTGAGAGCAGGAGAGG - Intergenic
1018113365 6:160558566-160558588 GGATGGACTGAGAGCAGGAGAGG - Intronic
1018115454 6:160579407-160579429 GGATGGACTGAGAGCAGGAGAGG - Intronic
1018117511 6:160601809-160601831 GGATGGACTGAGAGCAGGAGAGG - Intronic
1018840705 6:167514352-167514374 TGGAGGGCTGGGAGCTGGCAGGG + Intergenic
1018840748 6:167514455-167514477 TGGAGGGCTGGGAGCTGGCAGGG + Intergenic
1019024237 6:168943745-168943767 CTGAGGGGTGAGAGCTGGAGTGG + Intergenic
1019312058 7:367690-367712 AGGTGGCCTTAGAGCTGGAGAGG - Intergenic
1019585610 7:1800924-1800946 TGGTGGGCAGTGACTTGGAGGGG - Intergenic
1019612280 7:1942565-1942587 TGGTGGGGTGGGTGCAGGAGTGG - Intronic
1020071831 7:5232290-5232312 CGCTGGGCGAAGAGCTGGAGGGG + Exonic
1020257498 7:6510293-6510315 TGCTGGGCTGGGGCCTGGAGGGG + Exonic
1020409088 7:7870726-7870748 TGGCATGCTGAGAGCTGGAAGGG - Intronic
1020790178 7:12617571-12617593 TGGTGGTCTGAGAGCTGCTCTGG - Intronic
1023273648 7:38494417-38494439 TGGTGAGGTAAGAGCTGGGGTGG - Exonic
1023768000 7:43529713-43529735 TGGTGGGCCTAGAGCCTGAGTGG - Intronic
1023834181 7:44058813-44058835 TACTGGGCCGACAGCTGGAGGGG + Intronic
1023965390 7:44961214-44961236 TGGGGGGCTGAGGGCTGAGGGGG + Intergenic
1023965435 7:44961335-44961357 TGGGGGGCTGAGGGCTGAGGGGG + Intergenic
1023968222 7:44974447-44974469 TGGGGAGCTGAGAGTTGGTGGGG + Intronic
1024000037 7:45183939-45183961 TGGTGGGAAGACAGCTGGAAAGG + Exonic
1024011409 7:45270067-45270089 GGCAGGGCTGAGAGCAGGAGTGG + Intergenic
1026666880 7:72348437-72348459 TGTGGGGCAGAGAACTGGAGAGG + Intronic
1028722948 7:94054458-94054480 TGGGGGGAAGAGAGCAGGAGGGG + Intergenic
1030148875 7:106382916-106382938 TGGTGGGATGAGAGTTAGGGAGG + Intergenic
1031294353 7:119983367-119983389 TGGTGTGGTGAGAGCAGGTGGGG - Intergenic
1031514308 7:122683138-122683160 TGGCGGGATGAGAGTTGGAAAGG + Intronic
1033367250 7:140681136-140681158 TGGTGAGCTCATGGCTGGAGCGG + Exonic
1034099073 7:148436189-148436211 TGGGGGACTGAGTGCAGGAGTGG - Intergenic
1034271040 7:149803544-149803566 TGGTGGGCGAAGAGCTGAAGTGG + Intergenic
1034393024 7:150800750-150800772 AAGTGGGTTGAGAGTTGGAGGGG - Exonic
1035076920 7:156185703-156185725 TGGTAGACTGAAAGCTGAAGTGG - Intergenic
1035203244 7:157279698-157279720 CGGAGGGCTGCGGGCTGGAGCGG - Intergenic
1035314923 7:157991678-157991700 TGTTGGGGTGAGAGCTGCACGGG + Intronic
1035953732 8:4052843-4052865 TTGTGGTATGAGAGATGGAGAGG - Intronic
1036679315 8:10859283-10859305 TGGGGAGGTGAGAGCTGGAAAGG + Intergenic
1037500433 8:19480386-19480408 TAGTTTGCTTAGAGCTGGAGTGG + Intronic
1037680626 8:21094558-21094580 TGGAGGGCTGAGCTCTGTAGGGG - Intergenic
1037803352 8:22046748-22046770 GGGTGGGCTGAGAGTAGGATGGG - Intronic
1037945789 8:22988601-22988623 TGGGGGGCTGAGGGCAAGAGAGG - Intronic
1038731577 8:30132625-30132647 TTCTGGGCTCTGAGCTGGAGGGG - Exonic
1038872769 8:31514280-31514302 TGGGGGGCTGGGGGCTGGGGAGG - Intergenic
1039422301 8:37453425-37453447 TGCAGGGCTGAAAGCAGGAGAGG + Intergenic
1039613376 8:38936659-38936681 TCTTGTGCTGAGAGCTGGGGTGG + Intronic
1039797295 8:40926187-40926209 TGGAGGCCTGAGAACTGGATTGG - Intergenic
1039911787 8:41832357-41832379 TGCTGGGCTGTGAGCTGCAAAGG - Intronic
1039966566 8:42288429-42288451 AGGTTGGGTGAGAGGTGGAGTGG + Intronic
1039971568 8:42325165-42325187 TCGTGGGCTGTGAGCTGAGGAGG + Intronic
1041698646 8:60763761-60763783 TGGTGGGCTCAGCTCAGGAGGGG - Intronic
1041700009 8:60778087-60778109 TGGTGGGGTGGGGGGTGGAGGGG + Intronic
1041960145 8:63605491-63605513 TGATGGGGTGGGAGCTGGAGTGG - Intergenic
1042193213 8:66208922-66208944 TAGTGGGCTGAGAGCTGAGATGG + Intergenic
1042952968 8:74220272-74220294 TGGTGGGGACAGAGCAGGAGAGG - Intergenic
1043732184 8:83696146-83696168 TGGTGGGTAGAAAGCGGGAGAGG - Intergenic
1045316985 8:101052077-101052099 GGAGGGGCTGTGAGCTGGAGTGG - Intergenic
1045367934 8:101493618-101493640 TGGAGGGCCGCGAGCTCGAGGGG - Intronic
1046103862 8:109644549-109644571 CGGCGGGATGAGAGCTGGAGGGG - Intronic
1046999430 8:120559044-120559066 TGAAGGGCTGAGAGTGGGAGAGG - Intronic
1047684910 8:127295160-127295182 TGGGAGGCAGAGAGGTGGAGGGG + Intergenic
1048172761 8:132123294-132123316 TGGAGGGCAGAGAGGTGGAGGGG + Exonic
1048199040 8:132356288-132356310 TGCTGGGAAGAGAGCTGGACTGG + Intronic
1048324901 8:133431348-133431370 ATTTGGGCTGAGATCTGGAGAGG - Intergenic
1048841488 8:138570451-138570473 TGAAGAGCAGAGAGCTGGAGAGG - Intergenic
1049014257 8:139908399-139908421 TGATAGGCTGAGGGTTGGAGAGG - Intronic
1049201525 8:141342848-141342870 TCTTGGGCTGAGTGCTGGGGAGG + Intergenic
1049306373 8:141906403-141906425 AGGTGGGAGGGGAGCTGGAGTGG + Intergenic
1049689162 8:143951213-143951235 AGGGGGGCTGAGGGCAGGAGGGG + Intronic
1049701959 8:144019336-144019358 CAGTGGACTGAGATCTGGAGAGG + Intronic
1049744487 8:144257459-144257481 AGGCGGCCTGAGAGCTGGACAGG - Intronic
1049744542 8:144257688-144257710 TGGTGTGCTGCGACGTGGAGTGG - Intronic
1049785546 8:144449002-144449024 TCGAGGGCTGAGAAATGGAGAGG - Intergenic
1049883994 9:15833-15855 CGGTGGACTCAGGGCTGGAGGGG + Intergenic
1053417591 9:37956451-37956473 AGGTGGGATGAGAGGAGGAGAGG - Intronic
1053509789 9:38677995-38678017 TCCTGGGCCAAGAGCTGGAGGGG + Intergenic
1055600121 9:77907841-77907863 TGGTGGAAAGACAGCTGGAGTGG + Intronic
1057307200 9:93919340-93919362 TGCTGGGCAGAGAGCTGGGGAGG - Intergenic
1057905494 9:98980050-98980072 TGGGAGGCTGAGAGGTGGAAGGG + Intronic
1059028946 9:110668467-110668489 GGGTGGGGTGAGAGATGGGGAGG + Intergenic
1060103028 9:120856815-120856837 TGATGGGCTGAAAGAAGGAGCGG + Exonic
1060932349 9:127497043-127497065 TGTTGGGCTGAGGCCTGGGGAGG + Intronic
1061257416 9:129460701-129460723 AGGTGGGCAGAAAGCGGGAGGGG - Intergenic
1061582366 9:131545835-131545857 TGGTGGGGCGGGTGCTGGAGGGG + Intergenic
1062081245 9:134624833-134624855 TGGTGGGCCCTGAGCTGCAGAGG - Intergenic
1062184368 9:135209659-135209681 TGGTGGGATAAGGGCAGGAGTGG - Intergenic
1062274198 9:135723060-135723082 TGTTGTGATGAGCGCTGGAGAGG - Intronic
1062452658 9:136622014-136622036 AGGTGGGCTCAGTGGTGGAGGGG + Intergenic
1062715994 9:138010330-138010352 GGGTGTGCTGGGAGCAGGAGGGG + Intronic
1187145457 X:16632852-16632874 TGGAGGGCTGAGAGATGAAGTGG - Intronic
1187425630 X:19175229-19175251 TGGTGGAGAGAGATCTGGAGAGG - Intergenic
1187604716 X:20870758-20870780 TGGTAGGCTGAGAGCTATTGTGG + Intergenic
1187709282 X:22037715-22037737 TGGTGGGCGGAGAGTTTGTGGGG + Intronic
1187891987 X:23945180-23945202 TGGGGGGATGAGAGGTGGCGGGG - Intergenic
1189292459 X:39895871-39895893 GTGAGGACTGAGAGCTGGAGAGG + Intergenic
1189307091 X:39995019-39995041 TGGTGTGCTGGGAGCTGGCCTGG + Intergenic
1189349724 X:40267380-40267402 TGGGGGGCTGTGCGCGGGAGAGG + Intergenic
1189380559 X:40499766-40499788 CGGTGGGCAGAGATGTGGAGGGG - Intergenic
1189389663 X:40565105-40565127 TGGGTGGCTGAGGGCAGGAGTGG - Intergenic
1189435311 X:40987661-40987683 TGGAGGGCTTTGAGCTGTAGTGG - Intergenic
1192851617 X:74962318-74962340 TTGCGGGGTGAGGGCTGGAGGGG + Intergenic
1192889480 X:75373972-75373994 TGGAGGGGTGAGTGCTGGAGGGG - Intronic
1194966668 X:100296492-100296514 TGGTGGGCAGAGAGCTCTTGAGG + Exonic
1195923144 X:110002537-110002559 TGGTGGGGCGAGAGCTGAACTGG + Intergenic
1196035038 X:111134886-111134908 TGGTGCTCTGAGAGTGGGAGAGG + Intronic
1198228697 X:134669791-134669813 TGGTGGGCTTGGCGGTGGAGGGG + Intronic
1198536808 X:137594648-137594670 TAGTGGTCTCAGAGCTGGAAAGG + Intergenic
1200064891 X:153499631-153499653 TGAGGGGCTGGGGGCTGGAGTGG - Intronic
1200165491 X:154032429-154032451 TGGTGGGCTGATGGCTGCACGGG + Exonic
1200215427 X:154366105-154366127 TGGTGGGCTGGTAGCTGCAGCGG + Exonic
1201136175 Y:10991794-10991816 TGGTGGGCTGTGGAGTGGAGAGG - Intergenic
1202266111 Y:23021006-23021028 TGGTGGGCAGAGAGCCAGAAAGG - Intergenic
1202419104 Y:24654749-24654771 TGGTGGGCAGAGAGCCAGAAAGG - Intergenic
1202451682 Y:25015335-25015357 TGGTGGGCAGAGAGCCAGAAAGG + Intergenic