ID: 1132746630

View in Genome Browser
Species Human (GRCh38)
Location 16:1438928-1438950
Sequence CCCACAGAGAATGAAGGCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 221}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132746630_1132746646 25 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746646 16:1438976-1438998 TGCGTCTGGGAAGGGGGGCAGGG 0: 1
1: 0
2: 0
3: 41
4: 376
1132746630_1132746643 19 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746643 16:1438970-1438992 CAGGTCTGCGTCTGGGAAGGGGG 0: 1
1: 0
2: 2
3: 17
4: 234
1132746630_1132746647 29 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746647 16:1438980-1439002 TCTGGGAAGGGGGGCAGGGCAGG 0: 1
1: 0
2: 7
3: 130
4: 1190
1132746630_1132746644 20 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746644 16:1438971-1438993 AGGTCTGCGTCTGGGAAGGGGGG 0: 1
1: 0
2: 2
3: 14
4: 263
1132746630_1132746638 11 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746638 16:1438962-1438984 GTCAGCTGCAGGTCTGCGTCTGG 0: 1
1: 0
2: 3
3: 13
4: 147
1132746630_1132746640 16 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746640 16:1438967-1438989 CTGCAGGTCTGCGTCTGGGAAGG 0: 1
1: 0
2: 2
3: 24
4: 254
1132746630_1132746642 18 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746642 16:1438969-1438991 GCAGGTCTGCGTCTGGGAAGGGG 0: 1
1: 0
2: 1
3: 13
4: 258
1132746630_1132746641 17 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746641 16:1438968-1438990 TGCAGGTCTGCGTCTGGGAAGGG 0: 1
1: 0
2: 2
3: 10
4: 194
1132746630_1132746639 12 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746639 16:1438963-1438985 TCAGCTGCAGGTCTGCGTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 161
1132746630_1132746645 24 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746645 16:1438975-1438997 CTGCGTCTGGGAAGGGGGGCAGG 0: 1
1: 0
2: 2
3: 48
4: 491
1132746630_1132746634 0 Left 1132746630 16:1438928-1438950 CCGAGGCCTTCATTCTCTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
Right 1132746634 16:1438951-1438973 GAGACCCCACTGTCAGCTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132746630 Original CRISPR CCCACAGAGAATGAAGGCCT CGG (reversed) Exonic
900865838 1:5268037-5268059 CCCAGAGAGCATGAAGGACTTGG - Intergenic
900944383 1:5821623-5821645 CCCACAGAGTAGGCAGGCTTAGG - Intergenic
902988173 1:20168381-20168403 CCCACAGGGAATGATGCCCCTGG - Intronic
903321973 1:22548654-22548676 CGCACAGAGAAAGGAGCCCTGGG + Intergenic
903342964 1:22666039-22666061 CCCAGAGAGTGGGAAGGCCTGGG - Intergenic
903424532 1:23244083-23244105 CCCACATATCATGAAGGGCTGGG + Intergenic
903780645 1:25818045-25818067 CCCATGGAAAATGATGGCCTGGG + Exonic
904583357 1:31564288-31564310 TCCACAAAGAAAGAAGCCCTTGG - Intergenic
905395082 1:37661595-37661617 CCCAGAGAGACTGTAGGCCCCGG + Intergenic
907515013 1:54988339-54988361 CCCACTGGGAGTGAAGGCCAAGG - Intronic
909120744 1:71600485-71600507 CCCAAGGAGACTGAAGGACTAGG + Intronic
909982770 1:82123786-82123808 GCCAGAAAGAATAAAGGCCTGGG + Intergenic
915793729 1:158703720-158703742 CCTTCAGAGAATGGAGGCTTGGG - Intergenic
917119872 1:171636138-171636160 GCCACAGATGATGAAGGCATTGG + Exonic
918257662 1:182764226-182764248 CCAACAGTGAATGAGGGCCGTGG + Intergenic
919615758 1:199806536-199806558 CCCACAGATGAAGAAGGCATTGG - Intergenic
920254917 1:204648257-204648279 CCCACAGTGAGAGAGGGCCTGGG + Intronic
921924314 1:220698902-220698924 GCCACAGAGAATGACGGCTCAGG - Exonic
924492156 1:244548932-244548954 CCAGCAGAGCATGAAGTCCTGGG - Intronic
1063590909 10:7394646-7394668 TACATAGAAAATGAAGGCCTTGG - Intronic
1067438633 10:46295802-46295824 GTTACAGAGAATGCAGGCCTGGG - Intronic
1068201395 10:53788372-53788394 CCCACAGGAAATGAAGCCCCTGG - Intergenic
1069710313 10:70483632-70483654 CCCACAGAGAGGAAGGGCCTGGG - Intronic
1070562578 10:77578964-77578986 AGCACAGAGAAAGGAGGCCTGGG - Intronic
1071127909 10:82357106-82357128 TCAACAAAGAATGAAGGTCTGGG + Intronic
1071532494 10:86400687-86400709 CCCAGGGAGAATCAAGGCCAGGG + Intergenic
1071614849 10:87066027-87066049 CCCCAGGGGAATGAAGGCCTGGG - Intronic
1072444911 10:95490702-95490724 CCCAGGGAGAATAAAGTCCTGGG - Intronic
1073604708 10:104882581-104882603 CCCACAGAGAGAGAAAGCATTGG + Intronic
1073980294 10:109146396-109146418 TACAAAAAGAATGAAGGCCTTGG + Intergenic
1075171770 10:120122030-120122052 CCAACAGCCAATGAAGACCTTGG + Intergenic
1077380718 11:2235956-2235978 AACACAGAGAATCATGGCCTTGG + Intergenic
1078102341 11:8337388-8337410 CCCACAGGGAAGGAAGGAGTGGG - Intergenic
1082039279 11:47671621-47671643 CAGAAACAGAATGAAGGCCTGGG - Intronic
1087353773 11:97068244-97068266 ACAAGAGAGTATGAAGGCCTTGG - Intergenic
1088756456 11:112889465-112889487 TCCCCAGAGACTGAAGGCCAAGG + Intergenic
1088818266 11:113435775-113435797 CCCAGAGAGGAGGAAGGGCTGGG + Intronic
1090028265 11:123185700-123185722 CCCACTCAGAATGAAGTCCTGGG - Intronic
1091820327 12:3471178-3471200 CCCACCCAGAAGGAAGCCCTGGG - Intronic
1092083287 12:5735759-5735781 TCGAGACAGAATGAAGGCCTGGG + Intronic
1093396865 12:18693432-18693454 ACCACAGAGAATGACCCCCTTGG - Intronic
1096912172 12:54995547-54995569 CCCAGACAAAAGGAAGGCCTAGG - Intergenic
1101707968 12:107238204-107238226 CTCGCAGAGAAAGAAGACCTGGG + Intergenic
1102078977 12:110082735-110082757 CCGACAGAGAAGAAAAGCCTTGG - Intergenic
1102739945 12:115198271-115198293 CACACAGAGAATAAAGTCCAGGG + Intergenic
1103613978 12:122140822-122140844 CCCACAGAGAATGGATCACTGGG - Intronic
1103686826 12:122738796-122738818 ACCACAGATAAGGAAGGCCTAGG + Intergenic
1104842031 12:131830000-131830022 CCCACTGAGAATCACGCCCTGGG + Intronic
1110858560 13:80323268-80323290 TCCACAGAGAATGTATGCATGGG - Intergenic
1111345446 13:86947160-86947182 CCCACTGAGATTGAATTCCTTGG - Intergenic
1112322640 13:98421349-98421371 CCAAGAGAAAATGAAGGGCTGGG - Intronic
1114613724 14:24057691-24057713 ACCACAGAGAATGAAGAGCCAGG + Intronic
1114718267 14:24851799-24851821 CCTACAGAGATTGAAGGCAGAGG - Intronic
1114733323 14:25017798-25017820 CCCACTGTGAACCAAGGCCTGGG - Intronic
1120179334 14:81327571-81327593 ACCACTGAGAATCAATGCCTTGG + Intronic
1120192060 14:81448602-81448624 CTCTCAGAGAATGAAGGGATTGG + Intergenic
1120229038 14:81822888-81822910 CCCACAAAGAATGATGGGCTGGG - Intergenic
1202898324 14_GL000194v1_random:22449-22471 GCCACAGAGAAGCAGGGCCTGGG - Intergenic
1202898787 14_GL000194v1_random:24267-24289 GCCACGGAGAAGGGAGGCCTGGG - Intergenic
1124718856 15:32094341-32094363 CCCACTGAAAATTAAGGCTTAGG - Intronic
1125827415 15:42688175-42688197 CCCACAGAGAATGAAAGCATTGG + Exonic
1127367623 15:58306279-58306301 CCCAGAGAGAAGGAAGAACTGGG - Intronic
1127416557 15:58763357-58763379 CCCAAAGAGAATGAAGGAAAGGG + Intergenic
1128579248 15:68797412-68797434 GCCACAGAGAATGAAGACCAAGG + Intronic
1130038053 15:80379423-80379445 CCCACAGAGGAGAAAGGCGTTGG - Exonic
1131217465 15:90550801-90550823 CTCACTGAGGATGCAGGCCTGGG + Intronic
1132311386 15:100860539-100860561 CCCAAAGAGCATGAAGAGCTGGG - Intergenic
1132746630 16:1438928-1438950 CCCACAGAGAATGAAGGCCTCGG - Exonic
1135345595 16:21686136-21686158 CACACAGATAATGGAGGCCCTGG + Intronic
1137774742 16:51045463-51045485 CCCACACAGGAAGATGGCCTCGG - Intergenic
1138211523 16:55167032-55167054 CCCACAGGGAATCAGGGACTAGG + Intergenic
1141744033 16:85913957-85913979 CCCACAGGGGATGTAGGGCTAGG - Intronic
1143981071 17:10870356-10870378 CTCACAGTAAATGAAGGCATTGG + Intergenic
1145029838 17:19495961-19495983 ACCACAGAGAATGAAGAACTAGG + Intronic
1148636766 17:49154767-49154789 CCCACACAGAAGGAAGGGCAAGG + Intronic
1149543893 17:57488997-57489019 CGGACTGAGAGTGAAGGCCTCGG - Intronic
1149723354 17:58867499-58867521 CCCTCTAAGATTGAAGGCCTTGG - Intronic
1149994901 17:61401179-61401201 GCCACCGAGAATCCAGGCCTCGG + Intronic
1150113611 17:62524420-62524442 CCCACAGGGAATGAAGCATTAGG + Intronic
1151485061 17:74393891-74393913 CCCAGAGAGACTGAAGAACTGGG + Intergenic
1151555572 17:74844869-74844891 CACACAGAGACAAAAGGCCTAGG + Intronic
1158960533 18:62584307-62584329 CCTGCAGAGAATGCGGGCCTTGG + Intronic
1159942642 18:74420212-74420234 GGCATAGAGAATGAAGGGCTGGG - Intergenic
1160378125 18:78429464-78429486 CACACTGAGGCTGAAGGCCTGGG - Intergenic
1161359763 19:3841301-3841323 CCCACAGAAGAGGAAGGCCACGG - Intronic
1162967484 19:14162847-14162869 CCCACACACCATGAAGGCGTTGG + Exonic
1163734785 19:18972999-18973021 GTCAGAGAGAATGAAGCCCTCGG - Intergenic
1165168661 19:33875158-33875180 CCGGCAGAGAAAGAAGGCCGAGG - Intergenic
1165908485 19:39208629-39208651 CCCACAGAGACCCAGGGCCTGGG + Intergenic
1166251765 19:41576297-41576319 CCCACAGAGAATGCATCCCCTGG + Exonic
1166281411 19:41796700-41796722 CCCACAGAGAATGCATCCCCTGG + Exonic
1166282307 19:41802373-41802395 CCCTCAGAGAAGCTAGGCCTCGG + Intronic
1167249585 19:48392993-48393015 CCCACAGATGATGGAGGCCAGGG + Intergenic
925489471 2:4375776-4375798 TGCACAGAGCATGAGGGCCTGGG + Intergenic
925676848 2:6371597-6371619 CCTGGAGAGGATGAAGGCCTGGG + Intergenic
927462190 2:23308964-23308986 CCCAGAGGAAATGCAGGCCTGGG - Intergenic
927658398 2:24971541-24971563 CCAAAAGAGTAAGAAGGCCTGGG - Intronic
933489754 2:82970540-82970562 GCCACAGAGACTGCAGTCCTTGG - Intergenic
933626855 2:84610926-84610948 CCCCCAGAGAATGAATTGCTTGG + Intronic
934661854 2:96147296-96147318 CCCACAGAGCTGGAAGGCTTTGG - Intergenic
935548137 2:104422709-104422731 CCCACAGGAAATGAAGGCATAGG + Intergenic
936281913 2:111148768-111148790 CCCACAAAGACTGAGGGCCTAGG - Intronic
937891017 2:126938826-126938848 ACCACTCAGAATGAAGTCCTGGG - Intergenic
939468703 2:142591721-142591743 TCCACAGAGTATGAATGCCAGGG - Intergenic
940593572 2:155761863-155761885 CCCACTAAGAAAGAGGGCCTAGG + Intergenic
942149078 2:173056922-173056944 CCCCCAGAGAATAAGGGCGTGGG + Intergenic
942324961 2:174768772-174768794 CTCACAGAGAATGAAAGTCGAGG - Intergenic
943661479 2:190563870-190563892 CCCACAGAGTAGGGAGGCCTTGG - Intergenic
946359138 2:219208522-219208544 CACACAGAGAGTGAAGTCCAAGG + Intronic
946403988 2:219483323-219483345 CCCACTGAGGATGAGGCCCTGGG + Exonic
947272953 2:228358826-228358848 CCCACAGATAATACAGGCCATGG + Intergenic
947383909 2:229571502-229571524 CACACAGAGAGAGAAGGCGTGGG - Intronic
1170692986 20:18631694-18631716 CCCAGAGAGAATGACGTCCTGGG - Intronic
1173448265 20:43139335-43139357 GCCACAGAGAGTGAAGGCACAGG - Intronic
1176063034 20:63180459-63180481 CCCACAGAGACTGACTGTCTAGG - Intergenic
1176285013 21:5014764-5014786 GCCACACGGAATGAAAGCCTGGG - Intergenic
1176618011 21:9038442-9038464 GCCACAGAGAAGCAGGGCCTGGG - Intergenic
1176707031 21:10124836-10124858 GCCACGGAGAAGGGAGGCCTGGG + Intergenic
1178019370 21:28392060-28392082 GCCAAAGAGAATTAAGGACTGGG - Intergenic
1179872168 21:44248711-44248733 GCCACACGGAATGAAAGCCTGGG + Intronic
1179929377 21:44557363-44557385 CCCACAGAGACTTCAGGCATTGG + Intronic
1180083344 21:45496722-45496744 CCCACGGAAGGTGAAGGCCTGGG + Intronic
1183260953 22:36795527-36795549 CCGACAGAGGAGGAAGGCCTGGG - Intergenic
1183339738 22:37273603-37273625 CCCACAGACACTGAAGGAGTGGG + Intergenic
1183628722 22:39020644-39020666 GCCACCGAGGGTGAAGGCCTGGG + Intronic
1183806414 22:40215327-40215349 CACACAGAGAATGGGGGCTTGGG - Intronic
1184408442 22:44313270-44313292 CCAACAGAGACTGAGGGCCACGG - Intergenic
1184756410 22:46518456-46518478 CCCACTGAGAAGGGAGGCCTCGG + Intronic
950108493 3:10403580-10403602 CCCAGAGGAAATGAAGGCCTGGG - Intronic
952043338 3:29286316-29286338 CCCACTGATAATGAAGGCTTGGG - Intronic
952729701 3:36625998-36626020 TCCACAGAGAATGAAAGCCGTGG + Intergenic
952883155 3:37997981-37998003 CCCTCAGAGACAGAAGGCATGGG - Intronic
953009795 3:39014094-39014116 CCCAAAAAGAATGAAGGTGTGGG - Intergenic
953459597 3:43072074-43072096 CCCACAGAGAATGTAGAATTTGG + Intergenic
954190848 3:48959499-48959521 CCCACATAGACTCTAGGCCTAGG - Intronic
954936731 3:54333601-54333623 CCCACCGAGAGTGAAGCCCCCGG + Intronic
956191087 3:66609269-66609291 CCAACAGAGAATGTAAGCCCTGG + Intergenic
956890383 3:73607434-73607456 CCCACAGCTAATGATGCCCTGGG - Intronic
961483971 3:127204738-127204760 CCCACAGGGACTGAAGCTCTAGG - Intergenic
962389053 3:134956518-134956540 GCCCCAGACAATGAAGGCCTAGG - Intronic
963125597 3:141812944-141812966 CTCAAAGAGAATGAAGGCATTGG - Intronic
964874713 3:161353788-161353810 CCCACAGAGAATGTAGAGCAAGG - Intronic
965455641 3:168896598-168896620 TCCACAGAGCAGCAAGGCCTTGG + Intergenic
969218642 4:5744673-5744695 CCCACACAGAAACAGGGCCTTGG + Intronic
969578137 4:8048333-8048355 CCCACAGAAATGGAAGGGCTGGG + Intronic
970938861 4:21607587-21607609 CCCAGAGTGAATGAATGGCTGGG - Intronic
971863319 4:32137567-32137589 CCCAGGGAAAATGAAGGCTTGGG + Intergenic
976121853 4:81791820-81791842 CCCAAAGAGAATGAAGCTATTGG + Intronic
976540355 4:86267364-86267386 TACACAGAGCATGAAAGCCTTGG - Intronic
980379786 4:131997783-131997805 CCCACAGTGAATTTAGTCCTAGG - Intergenic
982341804 4:154307865-154307887 CCCAGAGAGAAAGGAGGCATTGG + Intronic
982583326 4:157206711-157206733 ACCACAGACTATGAAGACCTGGG - Intronic
983755403 4:171328872-171328894 GCCACAAAGACTGAAGCCCTTGG + Intergenic
984265213 4:177490172-177490194 CCCACTCAGAGTGAGGGCCTGGG - Intergenic
984845092 4:184101956-184101978 CCCAGAGAGAATGCAGGCACCGG - Intronic
985090206 4:186354673-186354695 CCCAGAGAGAAGCAGGGCCTTGG + Intergenic
985573706 5:664040-664062 CCCACAGACACTGCAGGACTGGG + Exonic
985612907 5:899840-899862 CACACACTGAATGAAGCCCTGGG - Intronic
989168038 5:38449528-38449550 CCCCCAGAGACTGAAGGCTTGGG - Intronic
990622613 5:57577128-57577150 CCCACAGAAAATGAGTGACTGGG - Intergenic
991596911 5:68315690-68315712 CCCCCAGAGAAAGTAGTCCTAGG + Intergenic
992942889 5:81780168-81780190 CTTACAGAGAATAAAGGCATAGG + Intergenic
992970751 5:82054798-82054820 CCCTTAGAGGATGGAGGCCTAGG + Intronic
996034075 5:118738748-118738770 CCCACAGAATAAGAAGTCCTGGG + Intergenic
998753686 5:145352476-145352498 CCCATAGAGAAGGAAGCCCCTGG + Intergenic
1001309203 5:170598660-170598682 CACACAGAGAGGGGAGGCCTGGG + Intronic
1002478193 5:179482014-179482036 CCCACATCAAATGAAGGCCCAGG - Intergenic
1002605447 5:180380413-180380435 CCACCAGAGAAGGAAGGGCTTGG - Intergenic
1004034397 6:11908845-11908867 CCAAAAGAGAAAGAGGGCCTTGG + Intergenic
1004210545 6:13637664-13637686 CCCCCAGAGAATAAAAGCGTAGG - Intronic
1005760675 6:28964944-28964966 CCCAAAGAGATTGCAGGCATGGG - Intergenic
1005899589 6:30206053-30206075 CCCACAGGGAATGGAGCTCTAGG - Intronic
1006256860 6:32838808-32838830 CCAGCCCAGAATGAAGGCCTTGG - Exonic
1007731105 6:43947406-43947428 AACACATAGAATGAAGGTCTAGG + Intergenic
1008076799 6:47154127-47154149 CCCACAGAGAATGATGGAGATGG - Intergenic
1012974394 6:105764416-105764438 CCCTCAGAGAAGCAAGGCTTGGG - Intergenic
1013300138 6:108797395-108797417 CCCAAAGAGAATGAATGCAGTGG - Intergenic
1013938263 6:115626980-115627002 CCTACAGAAAATGGAGGACTGGG - Intergenic
1014866752 6:126541638-126541660 CAGAAAGAGAATGAAAGCCTTGG + Intergenic
1017214191 6:151890851-151890873 AACACAGAGAATGAAGGCGAAGG - Intronic
1018376659 6:163219396-163219418 CCCAGAGACAGTGAAGGCTTGGG - Intronic
1021303868 7:19007004-19007026 AGAAAAGAGAATGAAGGCCTGGG + Intergenic
1022472226 7:30688976-30688998 GCCACTGATAATGAAGGGCTTGG - Intronic
1022496204 7:30854727-30854749 CCCAAAGACCCTGAAGGCCTGGG + Intronic
1024247587 7:47481875-47481897 CCCAGAGAGATTAAAGGCCAAGG - Intronic
1024743287 7:52378254-52378276 ACCACAGAGAATGGAGGGATGGG - Intergenic
1027435510 7:78160075-78160097 CGCAAAGAGAATGAGGGCTTCGG - Exonic
1028406981 7:90485894-90485916 CCCACAGAGACTTCTGGCCTTGG - Intronic
1029239119 7:99146010-99146032 GTCACAGAGAGTGAATGCCTGGG + Intergenic
1029595907 7:101537598-101537620 CCCACAGAGCCTGCAGACCTGGG - Intronic
1030607183 7:111650197-111650219 ACCACAGAAAATAAAAGCCTGGG - Intergenic
1032043310 7:128580183-128580205 CCCACAGGGAATGAAGCATTAGG + Intergenic
1032059615 7:128713689-128713711 CCCTCAGAGGAAGAAGGCTTGGG - Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1035584476 8:761260-761282 TCCACAGAGATGGAAGGCGTGGG - Intergenic
1035706618 8:1680368-1680390 CTTACAGAGAATAACGGCCTTGG + Intronic
1037325073 8:17680874-17680896 CCCCCAGTGAACGAAGGCCCGGG - Intronic
1039581823 8:38672933-38672955 TCCACAGAGACTGAAAGCCAGGG - Intergenic
1042209855 8:66369324-66369346 CCCATAGAGAAAGAGAGCCTTGG + Intergenic
1042686499 8:71447181-71447203 CCCAAAGAGGAGGAAGGTCTGGG - Intronic
1047882805 8:129215162-129215184 CCCAAGGAGAAAGAATGCCTTGG + Intergenic
1049345487 8:142136495-142136517 CCCACAGAGGATGGGGTCCTTGG - Intergenic
1049522576 8:143101812-143101834 CTCACGGAGAAAGAAGTCCTAGG + Intergenic
1049778703 8:144417839-144417861 CCCACAGAGAGGGCAGGGCTGGG - Intergenic
1050270782 9:3942402-3942424 CCCAAAGAGAAGAAAGGCATGGG + Intronic
1051229231 9:14937010-14937032 CCCATAGAGAATACAGGCTTAGG + Intergenic
1053427786 9:38022433-38022455 CTCTGAGAGAATGATGGCCTGGG + Intronic
1053644333 9:40111991-40112013 GCCACGGAGAAGGGAGGCCTGGG + Intergenic
1053761666 9:41352889-41352911 GCCACAGAGAAGCAGGGCCTGGG - Intergenic
1053761825 9:41353496-41353518 GCCACGGAGAAGGGAGGCCTGGG - Intergenic
1053762673 9:41357100-41357122 GCCACAGAGAAGCAGGGCCTGGG - Intergenic
1054325182 9:63709234-63709256 GCCACGGAGAAGGGAGGCCTGGG + Intergenic
1054325342 9:63709847-63709869 GCCACAGAGAAGCAGGGCCTGGG + Intergenic
1054350685 9:64015413-64015435 GCCACGGAGAAGGGAGGCCTGGG - Intergenic
1054350798 9:64015856-64015878 GCCACAGAGAAGCACGGCCTGGG - Intergenic
1054540259 9:66264007-66264029 GCCACAGAGAAGCAGGGCCTGGG - Intergenic
1054540418 9:66264616-66264638 GCCACGGAGAAGGGAGGCCTGGG - Intergenic
1054725440 9:68645543-68645565 CCCACAAGTAATGAAGCCCTAGG + Intergenic
1054750777 9:68903940-68903962 CCCACAGATAAAGTAAGCCTTGG - Intronic
1054804728 9:69386926-69386948 CCCACAGTGAAGGCAGGTCTTGG - Intronic
1055764383 9:79645898-79645920 CCCAAAGATAATAAAGGCCTAGG + Intronic
1056979450 9:91295108-91295130 TCCAGAGAGAATGAAAGCCAAGG - Intronic
1059506464 9:114803794-114803816 CCCAGAGAGAACTAAAGCCTAGG - Intronic
1059908193 9:119012033-119012055 CCCAGAGAGCATGAAGACCCAGG - Intergenic
1060190096 9:121587192-121587214 CCCACAGGGAATGTAGATCTGGG + Intronic
1062079580 9:134616605-134616627 CCTTCAGAGAATAAAGGTCTGGG - Intergenic
1062082645 9:134632538-134632560 CCGACAGACACTGAAGACCTGGG - Intergenic
1062424079 9:136498074-136498096 CCCAGAGGGCATCAAGGCCTGGG - Intronic
1202791776 9_KI270719v1_random:93709-93731 GCCACGGAGAAGGGAGGCCTGGG + Intergenic
1202791937 9_KI270719v1_random:94320-94342 GCCACAGAGAAGCAGGGCCTGGG + Intergenic
1186201483 X:7159331-7159353 GACACAGAGAATGAATTCCTTGG + Intergenic
1188559073 X:31447353-31447375 CACAAAGAGAATGAAGACTTTGG - Intronic
1189861530 X:45276808-45276830 CCCACTGAGAATGAAGCAGTGGG - Intergenic
1189943954 X:46157775-46157797 CCCACTGAAAATACAGGCCTAGG + Intergenic
1192198930 X:69051474-69051496 GAGACAGAGATTGAAGGCCTAGG - Intergenic
1193052632 X:77117088-77117110 ACCAGAGAGAAAGGAGGCCTAGG + Intergenic
1193331215 X:80237545-80237567 CCACCAGAAAATGAAGCCCTTGG + Intergenic
1194680544 X:96847069-96847091 GCAACAAAGAATGAAGGCCATGG - Intronic
1195975019 X:110517211-110517233 CCCACAGTGGATGAGAGCCTTGG + Intergenic
1196553936 X:117064289-117064311 GCCAAAGAGCATGAAAGCCTGGG - Intergenic
1198674866 X:139120769-139120791 CCCACAGTGCCTGAAGGCGTAGG - Intronic
1201151390 Y:11097277-11097299 GCCACAGAGAAGCAGGGCCTGGG - Intergenic