ID: 1132746664

View in Genome Browser
Species Human (GRCh38)
Location 16:1439063-1439085
Sequence ACAGCTTGGCCTCCCTCTTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132746661_1132746664 4 Left 1132746661 16:1439036-1439058 CCAGGAAGCTCTTCTGCAGGAAG 0: 1
1: 0
2: 1
3: 25
4: 307
Right 1132746664 16:1439063-1439085 ACAGCTTGGCCTCCCTCTTCAGG 0: 1
1: 0
2: 2
3: 19
4: 214
1132746657_1132746664 19 Left 1132746657 16:1439021-1439043 CCACCTTCTCCAGGGCCAGGAAG 0: 1
1: 0
2: 6
3: 52
4: 507
Right 1132746664 16:1439063-1439085 ACAGCTTGGCCTCCCTCTTCAGG 0: 1
1: 0
2: 2
3: 19
4: 214
1132746656_1132746664 20 Left 1132746656 16:1439020-1439042 CCCACCTTCTCCAGGGCCAGGAA 0: 1
1: 0
2: 1
3: 43
4: 323
Right 1132746664 16:1439063-1439085 ACAGCTTGGCCTCCCTCTTCAGG 0: 1
1: 0
2: 2
3: 19
4: 214
1132746658_1132746664 16 Left 1132746658 16:1439024-1439046 CCTTCTCCAGGGCCAGGAAGCTC 0: 1
1: 0
2: 5
3: 42
4: 380
Right 1132746664 16:1439063-1439085 ACAGCTTGGCCTCCCTCTTCAGG 0: 1
1: 0
2: 2
3: 19
4: 214
1132746659_1132746664 10 Left 1132746659 16:1439030-1439052 CCAGGGCCAGGAAGCTCTTCTGC 0: 1
1: 0
2: 2
3: 34
4: 261
Right 1132746664 16:1439063-1439085 ACAGCTTGGCCTCCCTCTTCAGG 0: 1
1: 0
2: 2
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132746664 Original CRISPR ACAGCTTGGCCTCCCTCTTC AGG Exonic
900353356 1:2247848-2247870 ACACCTTGGCCTCCTTCCCCTGG + Intronic
901064034 1:6486221-6486243 CCATCCTGGCCTCCCCCTTCTGG - Intronic
901207885 1:7507773-7507795 AGAGCTTGGACTCCCTTTGCAGG - Intronic
902365758 1:15973095-15973117 CCAGCTTGGCTCCCCTCGTCCGG + Exonic
902727848 1:18349237-18349259 AGAGCTTGGCCTCTCTGCTCTGG + Intronic
903464869 1:23545123-23545145 ACAGCTGGGCCTCCCTCCACAGG - Intergenic
903932347 1:26870041-26870063 AGAGCTGGGCCTCCATTTTCTGG - Intergenic
905240570 1:36578415-36578437 ACTGCTAGGGCTGCCTCTTCGGG + Intergenic
905632236 1:39525202-39525224 ACACCCTGGCCTCCCTCCCCAGG - Intronic
905824940 1:41020331-41020353 ACACCCTGGCCTCCCTCCCCTGG - Exonic
907050369 1:51326088-51326110 AGACCTAGGCCTGCCTCTTCAGG + Intronic
907546030 1:55260792-55260814 ACAGCTCAGGCTCGCTCTTCTGG - Intergenic
910292781 1:85615598-85615620 ACACCTTTGCCTCCCTCCTTAGG + Intergenic
911650912 1:100387162-100387184 ACAACTGGGCCTCCCTCTTATGG - Intronic
912448232 1:109753198-109753220 TCAGCTTTGTTTCCCTCTTCAGG - Exonic
912748671 1:112267472-112267494 AGAGTTTGACCTCCCTGTTCTGG - Intergenic
913227173 1:116710472-116710494 ACAGCTTGGCCACACTCTGTTGG + Intergenic
913608621 1:120489708-120489730 ACATCTCTGACTCCCTCTTCTGG + Intergenic
914370362 1:147019486-147019508 ACAACTCTGACTCCCTCTTCTGG + Intergenic
914484332 1:148093924-148093946 ACAACTCTGACTCCCTCTTCTGG - Intergenic
914582581 1:149032130-149032152 ACATCTCTGACTCCCTCTTCTGG - Exonic
915762006 1:158323792-158323814 ACAGCTTGGGCACCCTCCTTGGG - Intergenic
915835657 1:159172953-159172975 ACAGCCTGCCCTCCCTCCTCAGG - Intronic
916553382 1:165871564-165871586 TCAGCCTGGCCTGCCTTTTCAGG + Intronic
920342723 1:205285495-205285517 ACAGCTTGGCCTGTATCCTCTGG + Intergenic
920440452 1:205977216-205977238 ACATCTTGTCCACCCTCTCCAGG + Exonic
921465100 1:215477707-215477729 GCAGCTTGGTCTCCTGCTTCAGG - Intergenic
922947810 1:229531645-229531667 GCAGCTTGGGCTCTCTCTCCAGG + Exonic
923038346 1:230301154-230301176 AGAGCTTGGCCCCTCTCGTCAGG - Intergenic
923095651 1:230773311-230773333 AGAGATTGGCCTCCCTCTCCTGG + Intronic
923534146 1:234835650-234835672 TCAGCCTGGCTGCCCTCTTCAGG - Intergenic
923861551 1:237896981-237897003 ACAGCTTGGTCTCGAACTTCTGG - Intergenic
924931856 1:248739348-248739370 CCAGCATCGCCTCCCACTTCTGG - Intronic
1063142431 10:3267413-3267435 CCTCCTTGGCCTCCCTCTCCGGG + Intergenic
1067083640 10:43227119-43227141 ACAGTTTGGTCTCCTTCCTCTGG + Intronic
1067091393 10:43267221-43267243 AAAGCCTGGCCGCCCTCTCCCGG - Intergenic
1070314459 10:75296619-75296641 ACAGCTTCGATTCCATCTTCAGG - Intergenic
1075918414 10:126189652-126189674 ACAGATTGGGCTCCCTGTCCTGG + Intronic
1076112698 10:127873060-127873082 AGACCTTGGCCTCCCTCTGCTGG - Intergenic
1076479954 10:130778391-130778413 ACAGCACGGCCTCACTCTGCAGG + Intergenic
1077019007 11:409281-409303 TCAGCCTGGCCTGCCTCTGCTGG + Intronic
1077048894 11:557970-557992 GCAGCTCGGCCTCCATCTCCTGG + Exonic
1077535176 11:3120591-3120613 ACAGCTTGGTCCAGCTCTTCAGG + Exonic
1078648961 11:13169480-13169502 ACATCTTGGCCTTCCAGTTCAGG + Intergenic
1079201898 11:18383722-18383744 GTAGCTTGGCCTCACTCTGCAGG - Intergenic
1079493497 11:21015295-21015317 TCTGCTTTTCCTCCCTCTTCTGG - Intronic
1083173881 11:60937695-60937717 ACAGCGTGGCCTCCCTCCTTGGG - Intronic
1083783485 11:64930505-64930527 ACTGCTTGTGCTCCGTCTTCAGG - Exonic
1084268907 11:68018897-68018919 AGAGCTGGGCCTGCCCCTTCCGG + Intronic
1085508391 11:77073057-77073079 ACAGCTGGGCGTCCCTGTGCAGG - Intronic
1086988086 11:93271708-93271730 GCAGATTGGCCTCCCTATTGTGG - Intergenic
1089633900 11:119800251-119800273 ACAGCTTGGCCTGCCTCTGCAGG + Intergenic
1090104296 11:123835476-123835498 CTATCTTGGCCTCCCTGTTCTGG + Intergenic
1091137558 11:133205499-133205521 ACAGCACTGCCTCCCACTTCAGG - Intronic
1091406157 12:210802-210824 ACTGCTGGGCCTCCCTTTTGAGG - Intronic
1091800354 12:3321099-3321121 TCAGCTTGGCCTCAGGCTTCAGG - Intergenic
1096100093 12:48965620-48965642 GCAGCCTGGGCTCCCTCTTGTGG - Exonic
1096263921 12:50109379-50109401 TCAGCTTAGCCTCCCACTCCTGG - Intronic
1099244595 12:80180005-80180027 ACAGCTTAGACTACATCTTCTGG - Intergenic
1099477440 12:83124065-83124087 ACAGTTTCACCTCCCTCTTTCGG + Intronic
1101250025 12:102924022-102924044 AGAGCTTGGCCTACGTCCTCTGG - Intronic
1101491888 12:105217275-105217297 ATAGCTGTGACTCCCTCTTCAGG - Intronic
1102961762 12:117098126-117098148 ACAGCTGGGCCACCCTCTCTTGG + Intronic
1102991857 12:117321697-117321719 AGAGCTTGGAATCCCTCTGCTGG - Intronic
1103455243 12:121060172-121060194 TCAGCTGAGCCTCCCTCTGCTGG + Intergenic
1104359795 12:128121764-128121786 TCAGCATGGCCTTCCTCTTTAGG - Intergenic
1105013967 12:132774675-132774697 CCAGCTTAGGCTCCCTTTTCTGG + Intronic
1107455002 13:40546635-40546657 ACAGCCTGGCCTCCTGCTCCAGG - Intergenic
1108690466 13:52855177-52855199 ACAATTTGGCCTCCCTCCTCTGG - Intergenic
1109755315 13:66751101-66751123 ACCACTTGCACTCCCTCTTCAGG + Intronic
1113577916 13:111407404-111407426 TCAGCTTGGCATCCCTGTTGTGG - Intergenic
1113816080 13:113172139-113172161 CCAGCTTGGAATCCCGCTTCCGG - Exonic
1114221941 14:20704539-20704561 ACAACTTGACCTCCCAATTCTGG + Intergenic
1118013138 14:61630451-61630473 ACTGCTTTGCCTCCCTCTGTGGG + Intronic
1120079316 14:80197856-80197878 ACATCTCTGTCTCCCTCTTCGGG + Intronic
1120347275 14:83307059-83307081 ACACCTCAGCCTCCCTCCTCTGG + Intergenic
1120347315 14:83307323-83307345 ACAGCTCAGCCTCCTTCCTCTGG + Intergenic
1121633723 14:95439745-95439767 ACAGCTGGGCCTCCTTCTCCGGG + Exonic
1122265546 14:100545008-100545030 ACAGCTTGTCCTCCAGCTCCTGG + Exonic
1122887416 14:104716315-104716337 ACAGCTTGTCCTCGCTGTTGGGG + Intronic
1125723767 15:41857587-41857609 GGAGCTTGGCCACCTTCTTCTGG + Exonic
1125752454 15:42037724-42037746 ACATCTGTGACTCCCTCTTCGGG + Intronic
1126196324 15:45935976-45935998 ACATCTTGGTTTCCCTCTTTTGG - Intergenic
1128521695 15:68379563-68379585 ACAGCTGGGCCGAACTCTTCTGG + Intronic
1130867588 15:87945669-87945691 TCAGCTTCACCTCCCTGTTCTGG + Intronic
1132716040 16:1290253-1290275 ACAGCCTGGTCTCCCTCCTCTGG + Intergenic
1132746664 16:1439063-1439085 ACAGCTTGGCCTCCCTCTTCAGG + Exonic
1134133423 16:11665124-11665146 ACAGCTGGGACTCCCTGCTCGGG - Intergenic
1135610847 16:23865845-23865867 AGAGAGAGGCCTCCCTCTTCTGG - Intronic
1136460965 16:30409754-30409776 CCAGCTCTGCCTGCCTCTTCTGG + Intronic
1138547176 16:57726888-57726910 ACAGCTTCTCCTCCCTCTTCAGG - Exonic
1138713642 16:58997379-58997401 ACAGCCTGGCTTTCCTCTTCTGG - Intergenic
1140893480 16:79305252-79305274 GCAGCTTGGCCGCCCGGTTCTGG - Intergenic
1141841930 16:86579143-86579165 CCGGCTTGGGCTTCCTCTTCCGG - Exonic
1142118065 16:88370727-88370749 ACAGCTCGGCCTCAGACTTCTGG - Intergenic
1142405118 16:89884254-89884276 ACAGCAAGGCCCCCGTCTTCAGG + Intronic
1144456956 17:15426649-15426671 ACAGCATGGCCTCCCCATGCAGG - Intergenic
1147698894 17:42379170-42379192 ACGGCTTGGCTTCCCTATTGTGG - Intronic
1148736895 17:49870018-49870040 CCAGCTTGCCCTCCCCCTCCAGG - Intergenic
1151535250 17:74735711-74735733 AGAGCTTGGGTTACCTCTTCTGG - Intronic
1152620826 17:81364015-81364037 ACATCTTGGCCTCAGGCTTCAGG - Intergenic
1153979431 18:10296648-10296670 ACCGCTTGGGCCCTCTCTTCTGG + Intergenic
1159722368 18:71907637-71907659 ATAGCTTACCCTTCCTCTTCAGG - Intergenic
1160561755 18:79763190-79763212 ACAGCTTGTCCTCCTTTTGCCGG + Intergenic
1161087152 19:2340489-2340511 AGAGCTTGGCCTGGCTCTTAGGG + Intronic
1164280332 19:23763157-23763179 ACAGCCTGGTCTCCCTTCTCGGG - Intronic
1167269084 19:48498059-48498081 ACACCTTGTCCTCGCTCTTTGGG + Exonic
1167443842 19:49525820-49525842 ACATCTTTGCCTCCCTCCTCTGG - Intronic
1168141529 19:54391165-54391187 ATAGCTTGGGCTCCCTCTTGTGG + Intergenic
925692573 2:6539953-6539975 ACACCTTGGACTCCATCTACAGG - Intergenic
925702222 2:6650222-6650244 ACAGTTTGGCTTCCCTGTTCTGG - Intergenic
927675598 2:25103721-25103743 GCAGCTTGGCCACCATCTTGAGG - Exonic
931216900 2:60253711-60253733 ACAGCATGCCCTCCCTTTCCTGG + Intergenic
932566438 2:72914238-72914260 ACAGCCTAGCCTACCTGTTCTGG - Intergenic
934550928 2:95261138-95261160 CCTGCAGGGCCTCCCTCTTCTGG - Intergenic
940183237 2:150957064-150957086 ACAGCATAGCCTGCCTCTGCTGG - Intergenic
940245813 2:151614539-151614561 ACAGCTTGGCCACCATATTGGGG - Exonic
940283359 2:152009790-152009812 TCAGTTTGGCCTCCCTCTGCGGG + Intronic
942145972 2:173026581-173026603 ACAGTTGGGCCTTCCTGTTCTGG - Exonic
946035730 2:216740738-216740760 ACAGCTGGCCCTCCTGCTTCAGG + Intergenic
947997140 2:234537561-234537583 ACATCTTGGCTTTCATCTTCAGG + Intergenic
948330661 2:237161746-237161768 GGAGCCTGGCCTCCCTCCTCTGG - Intergenic
948894105 2:240920333-240920355 GCTGCTTGGCCTCCCACCTCTGG - Intronic
1168859625 20:1036755-1036777 TCACCATGGCCTCCCTCTTAAGG + Intergenic
1169344797 20:4821659-4821681 ACAGCTTGGGTTCCCTGTGCTGG - Intronic
1170017444 20:11797650-11797672 AGAGCATGGCCTCCATCTGCAGG - Intergenic
1170035184 20:11982031-11982053 ACAATTTGACCTTCCTCTTCAGG - Intergenic
1170814333 20:19699957-19699979 ACAGCATGGCCTATCGCTTCTGG + Intronic
1173188136 20:40856883-40856905 ACACCTTTCCCTTCCTCTTCTGG - Intergenic
1173847450 20:46197099-46197121 GCTGCATGGCCTCCCTTTTCTGG - Intronic
1174161468 20:48553852-48553874 CCTGCGTGACCTCCCTCTTCTGG + Intergenic
1174282095 20:49446891-49446913 AGTGCCTGGCCTCCCTCTACAGG + Intronic
1174615656 20:51833396-51833418 TGAGCTTGGCCTCTCTCTTAAGG - Intergenic
1176038593 20:63052430-63052452 ACGACTTGGCCTCCCAGTTCGGG - Intergenic
1177471935 21:21570580-21570602 ACAGCTTGGCCTACTTTTACAGG - Intergenic
1177483372 21:21722946-21722968 ACAGCTTGCCCTCCCTAATGTGG + Intergenic
1178835269 21:36092087-36092109 TCAGCTTGGGCTCCATCTCCAGG + Intergenic
1179494216 21:41761480-41761502 CCAGTGTGGCCTCCCTCCTCCGG + Intronic
1179550809 21:42142291-42142313 ACAGGACGGCCTGCCTCTTCGGG - Exonic
1181148109 22:20863134-20863156 ACACCTTGGCCTCCCAGTGCTGG + Intronic
1181920582 22:26317418-26317440 TCTGCTTGGCTTGCCTCTTCTGG + Intronic
1182467452 22:30526078-30526100 GCCACTTGGCTTCCCTCTTCTGG - Intronic
1182505587 22:30779928-30779950 ACAGCTTGTCTTCCCTCCTCAGG + Intronic
1182522652 22:30893025-30893047 ACAGCTTGCCCTGCCTCAGCAGG - Intronic
1182820072 22:33208046-33208068 AAAGCATGGCTTTCCTCTTCAGG - Intronic
1183959463 22:41402595-41402617 CCAGCTGGCCCTCCCTCTTAAGG + Intergenic
1184242113 22:43216811-43216833 ACAGCTTCCCCGCCCTCTCCAGG + Intronic
950090221 3:10289790-10289812 TCTGCTTGACCTCCATCTTCCGG + Exonic
952635841 3:35529514-35529536 ACAACTAGGTCTCCCTCTTTCGG - Intergenic
953631286 3:44620217-44620239 CTAGCTTTGCCTCACTCTTCTGG + Intronic
955380491 3:58434144-58434166 ACAGGTTGGCCTAACTCTTAAGG - Intergenic
956642525 3:71428476-71428498 ACAGCTTGGTCCACCCCTTCGGG + Intronic
959877366 3:111400507-111400529 ACAGCTTAGCCTCCCTCAGTGGG + Intronic
961452563 3:127008999-127009021 ACACCTTGGCCTGGCTCTTCAGG - Intronic
961525811 3:127496663-127496685 ACAGCCTGGCCCCACACTTCAGG - Intergenic
964273427 3:154983467-154983489 ACAGCTTGTCGTCCCTCTCTTGG - Intergenic
967525473 3:190487692-190487714 ACAGCTTGACCTACCTCCCCAGG - Intergenic
968276728 3:197445969-197445991 ACAGCGGGGCCTCCCTCAGCAGG + Intergenic
968460947 4:724429-724451 ACAGCATGGGCTCCGCCTTCTGG - Intronic
968670811 4:1850349-1850371 CCTGCTTGGCTTCCCTCTTGGGG - Intronic
968689365 4:1982678-1982700 CCAGCTTGTCCTCCCTGCTCCGG - Intergenic
970595660 4:17597707-17597729 ACTGCTTTGCCGCCCTCTGCAGG - Intronic
974129168 4:57731494-57731516 ACACCTCCTCCTCCCTCTTCTGG + Intergenic
975913398 4:79296526-79296548 ACACCTTGGCCTTCCTTATCTGG + Intronic
976772050 4:88663795-88663817 ACAGCTTGGCTTCTCTTTTTTGG + Intronic
982833290 4:160090069-160090091 CCACCTTGGCCTCCCAGTTCTGG - Intergenic
983779389 4:171649460-171649482 TCATCTTGGAATCCCTCTTCAGG + Intergenic
985616373 5:924590-924612 ACAGCTTGGCCTTCACCTCCTGG + Intergenic
996755940 5:126935255-126935277 ACAGTTTGCCCTCCCTCATGTGG + Intronic
997161854 5:131617233-131617255 CCAGATTGGCCTCCTACTTCTGG - Intronic
1001755891 5:174168147-174168169 ACAGTTTCGCATCCATCTTCTGG + Intronic
1001767479 5:174262304-174262326 AAAGCTTGGCTTCTGTCTTCTGG - Intergenic
1002376520 5:178793128-178793150 ACAGCTTCACCTTCCGCTTCTGG + Intergenic
1002435568 5:179228842-179228864 AGAGCTTCGGCTCCCTCCTCTGG - Intronic
1005671205 6:28107962-28107984 CCAGCTTGGACACCCTCTCCAGG - Intergenic
1005877394 6:30022188-30022210 ACAGCATTAACTCCCTCTTCTGG + Intergenic
1010327450 6:74581438-74581460 AATGCTTGGCCTCGTTCTTCAGG + Intergenic
1012847921 6:104413152-104413174 GCAGCAAGGCCTGCCTCTTCAGG - Intergenic
1013811525 6:114049866-114049888 CCAGCTTGTCTTCCCTCTGCTGG - Intergenic
1015954288 6:138583849-138583871 CCACCTTGGCCTCCCTCATATGG - Intronic
1016076115 6:139797482-139797504 AGAGCATGGCATCCCTCTCCTGG + Intergenic
1019310210 7:356838-356860 CCAGGGAGGCCTCCCTCTTCAGG + Intergenic
1019496023 7:1341057-1341079 ACAGCTCGGCCTTCCCCTTGGGG + Intergenic
1022098576 7:27156053-27156075 ACAGCCTGGCTCCGCTCTTCCGG + Intronic
1023867910 7:44247514-44247536 TCAGCCTGGCCTCCCTCCTGAGG - Intronic
1024231491 7:47367183-47367205 ACAGCCTGGCCGTCCTCTCCTGG + Intronic
1024273616 7:47660133-47660155 ACATCTTGGCCTCCCTCCTGAGG + Exonic
1025227945 7:57180083-57180105 ACTGCTTGGCCACCGTCTGCAGG + Intergenic
1025258972 7:57404622-57404644 ACAGCCCGGCTTCCCCCTTCAGG - Intergenic
1025710102 7:63900679-63900701 ACAGCCCGGCTTTCCTCTTCAGG - Intergenic
1027779860 7:82507753-82507775 ACAGCATGGCCCCAGTCTTCAGG + Intergenic
1030196551 7:106858896-106858918 AAAGCTTGGCCTGCATTTTCTGG - Intergenic
1031721954 7:125187582-125187604 AGATCTGGGTCTCCCTCTTCAGG - Intergenic
1032781847 7:135170349-135170371 ACAGCCCGCCCTCCCTCTGCGGG + Intronic
1032802303 7:135326738-135326760 ACAGCTTTGCTTTTCTCTTCTGG + Intergenic
1033040978 7:137917957-137917979 ACAGAGTGGTCTCCCTCCTCTGG - Intronic
1033667052 7:143451474-143451496 ACAGTTTGGCCTCACTCTCTTGG + Intergenic
1034555052 7:151845141-151845163 ACTGCTCGGCATCCCTCTCCTGG + Intronic
1035141667 7:156768793-156768815 CTAGCCTGGCATCCCTCTTCTGG - Intronic
1037820680 8:22133341-22133363 GCAGCTTGGCCTGACTCTCCGGG - Intronic
1038198843 8:25392971-25392993 CCAGCTTGGCCAGCCTCCTCTGG + Intronic
1038589807 8:28826443-28826465 ACGGCTTGGCTTTCCTCCTCCGG - Intronic
1041218614 8:55626647-55626669 ACAGCTTGGGCTCACGATTCAGG + Intergenic
1041224761 8:55687247-55687269 AAAGCTTTTCCTCCCTTTTCTGG - Intergenic
1043172558 8:76983518-76983540 ACAGCTTGGCTTTCAACTTCTGG + Exonic
1047666249 8:127095102-127095124 ACACTTTGGCCTCACTGTTCTGG - Intergenic
1048995160 8:139789627-139789649 ACACCCAGACCTCCCTCTTCCGG + Intronic
1049240601 8:141535731-141535753 TCAGCATGGCCTCCATCTCCTGG + Intergenic
1049640149 8:143711718-143711740 ACAGCTGGGCCAGCCTCCTCCGG + Intronic
1051713907 9:19961741-19961763 ATGGCTTCGCCTCTCTCTTCTGG + Intergenic
1051809119 9:21030763-21030785 CCAGCTTGACTTCCCTCTTCTGG - Intronic
1053174629 9:35912999-35913021 GGAGCCTGGCCTCCCTCTGCAGG + Intergenic
1055479066 9:76692169-76692191 ACAGATTCGCCTCCATTTTCTGG + Intronic
1055677395 9:78678633-78678655 ACAGGTAGGCCTCCCTTTTGAGG + Intergenic
1055704788 9:78986199-78986221 AAAGATTGCCCTTCCTCTTCTGG + Intergenic
1056014027 9:82363324-82363346 ACAGCTGTCCCTCCCTCTTCTGG - Intergenic
1057007877 9:91576549-91576571 ACAGCTTGACCCCCAACTTCAGG + Intronic
1057113585 9:92499028-92499050 AGAGCTTGGCCTCTTTCTTTGGG - Intronic
1057306616 9:93916184-93916206 GCAGCTGGGTCTCCCTCTCCTGG + Intergenic
1057518819 9:95744489-95744511 ACCTCGTTGCCTCCCTCTTCTGG - Intergenic
1058721375 9:107767768-107767790 ACAGCATGGCCTCGCTCAGCTGG + Intergenic
1060758380 9:126228535-126228557 AGGGCTTGGCCTCCCTCCGCTGG - Intergenic
1061469226 9:130809745-130809767 GCAGCTTGGCCTCCCTAATGTGG - Intronic
1061802051 9:133118079-133118101 CCAGCCTGGTCCCCCTCTTCTGG + Intronic
1186223702 X:7375534-7375556 ACTCCTTGGCCTCCCTCCTGTGG + Intergenic
1188178209 X:27021140-27021162 GTGACTTGGCCTCCCTCTTCTGG + Intergenic
1192730457 X:73797950-73797972 AGACCTTGGCCTCTGTCTTCAGG + Intergenic
1192784054 X:74320927-74320949 AGAAATTGGTCTCCCTCTTCAGG - Intergenic
1194864903 X:99053843-99053865 ACAGCTTGGGCTGCAGCTTCAGG + Intergenic
1197992066 X:132329058-132329080 GCAGCTTGGGCTACCTCTCCAGG - Intergenic
1199836289 X:151595207-151595229 ATATTTTTGCCTCCCTCTTCTGG + Intronic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1201386518 Y:13445750-13445772 ACAGCAGGGCATCCTTCTTCTGG + Intronic