ID: 1132747180

View in Genome Browser
Species Human (GRCh38)
Location 16:1441671-1441693
Sequence CGGGCAGGCGCTGGCTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132747165_1132747180 24 Left 1132747165 16:1441624-1441646 CCCGAGAGTGGCCGTGGAAGGGG 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1132747180 16:1441671-1441693 CGGGCAGGCGCTGGCTGTGTGGG 0: 1
1: 0
2: 1
3: 26
4: 233
1132747171_1132747180 13 Left 1132747171 16:1441635-1441657 CCGTGGAAGGGGCTTCGGGGCTG 0: 1
1: 0
2: 3
3: 22
4: 236
Right 1132747180 16:1441671-1441693 CGGGCAGGCGCTGGCTGTGTGGG 0: 1
1: 0
2: 1
3: 26
4: 233
1132747167_1132747180 23 Left 1132747167 16:1441625-1441647 CCGAGAGTGGCCGTGGAAGGGGC 0: 1
1: 0
2: 2
3: 10
4: 179
Right 1132747180 16:1441671-1441693 CGGGCAGGCGCTGGCTGTGTGGG 0: 1
1: 0
2: 1
3: 26
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132747180 Original CRISPR CGGGCAGGCGCTGGCTGTGT GGG Intronic
900134139 1:1107060-1107082 TGGGGAGGCTCGGGCTGTGTGGG - Intronic
900318785 1:2072437-2072459 CGGGCAAGCGCCGGGTGGGTTGG + Intronic
900576463 1:3384969-3384991 CGGGCATGGGCAGGCTGGGTGGG + Intronic
901280062 1:8026718-8026740 CGGGCCGCCGCTGGCCGTGTGGG + Intergenic
901624213 1:10614510-10614532 TGAGCAGACGCTGGCTGTGTGGG - Intronic
902433908 1:16384666-16384688 TGGGCCGTGGCTGGCTGTGTGGG + Intronic
902768545 1:18632413-18632435 CGGGCGGGCGCTGGATGTTTAGG - Intronic
903121197 1:21217985-21218007 CGGGAAAGCGGTGGCTGTGGAGG + Intronic
903919259 1:26787947-26787969 CGCGCAGGCGCGGGCCGCGTGGG + Intronic
904424130 1:30412780-30412802 CTGGCAGGGGCTGGGTGAGTGGG + Intergenic
904626249 1:31805537-31805559 GGGCCAGGGTCTGGCTGTGTTGG - Intronic
905920881 1:41717889-41717911 ACGGCAGGCTCTGGCTGTGCTGG + Intronic
908229145 1:62086861-62086883 CCGGCAGGAGCAGGCTCTGTGGG + Intronic
910709374 1:90163666-90163688 CGGGCAGGCCTTAGCTGTGAGGG - Intergenic
914922982 1:151859992-151860014 TAGGCAGGTGTTGGCTGTGTGGG + Intergenic
915110823 1:153563838-153563860 GGAGCAGGCGCTGGCTGTGCTGG - Exonic
915357089 1:155261889-155261911 TGGGCTGGTGCTGGCAGTGTTGG - Intronic
917959712 1:180132515-180132537 CAGTCAGGCGCTGTCTGAGTGGG + Intergenic
919754276 1:201056941-201056963 GGGGCCGGGGCTGGCTGTGGAGG - Intronic
920232622 1:204480665-204480687 TGGGCAGGGCCAGGCTGTGTGGG + Intronic
920302164 1:204995750-204995772 TGGGCAGGCTCTGGCTGAGAAGG + Intronic
921258238 1:213361899-213361921 AGGGCAGGCTTTGGCTGTGAAGG + Intergenic
922502865 1:226110003-226110025 CGGGCAGGGGCTGGCTGGCCGGG + Intergenic
922526652 1:226309288-226309310 CGGGCAGGCGCGGGCGGAGCCGG - Exonic
924787330 1:247210621-247210643 CGGGCTGGAACTGGCTGTGGCGG - Intergenic
1063371997 10:5528087-5528109 CAGGCAGGCACTGGCTGGGGTGG + Intergenic
1064244308 10:13657104-13657126 TGGGCTGGCTCTGGCTGTGCAGG + Exonic
1065101292 10:22335285-22335307 CCGGCAGGCGCAGGCTCTGCAGG - Intergenic
1065801780 10:29358958-29358980 CGAGCAGGTGTTGGCTGTGTGGG + Intergenic
1067711076 10:48651657-48651679 CAGGCAGGTGCTCGCTGGGTGGG - Intronic
1073083529 10:100874214-100874236 CGGCCAGGAGCCGGCTGAGTGGG + Intergenic
1073299346 10:102461480-102461502 CGGGCAGGAGCGGGCTGGGCTGG + Intronic
1074317042 10:112370056-112370078 CGGGGAGGCTCTGGCTGTGCAGG - Intergenic
1076226394 10:128779675-128779697 TGGGCAGATGCTCGCTGTGTGGG - Intergenic
1076685414 10:132196424-132196446 CAGGCAGGTGCTGGATGTGCTGG + Intronic
1076738080 10:132467626-132467648 CGGGCAGAGGCTGGCTTTGGGGG - Intergenic
1077141660 11:1027504-1027526 CGTGCAGGGGATGGCTGTGGGGG + Exonic
1077421769 11:2453954-2453976 CAGGCAGGGTCTTGCTGTGTTGG + Intronic
1077499975 11:2904913-2904935 CGGGCTGGTGATGGCTGTGGAGG + Intronic
1080178648 11:29396397-29396419 AGGGCAGGGGTTGGCAGTGTGGG + Intergenic
1080601110 11:33821173-33821195 CAGGCTGGCCCTGGCAGTGTGGG - Intergenic
1081966507 11:47173390-47173412 CGGGCAGGCGTGGGGTGTCTGGG - Intronic
1083173325 11:60935284-60935306 GGAGCAGGCGCTGGCTGTGACGG + Exonic
1083397066 11:62399583-62399605 TGGCCAGGGGCTGGCTGAGTTGG - Intergenic
1084190927 11:67498396-67498418 CTGGCAGGCCCTGGCTCTGTGGG + Intronic
1084447392 11:69211810-69211832 GGGGCAGGGGCTGTGTGTGTTGG - Intergenic
1085034767 11:73293232-73293254 CTGGCTGCCACTGGCTGTGTGGG + Intronic
1085868174 11:80319483-80319505 AGGGCAGGAGCTGGTTGTGGAGG - Intergenic
1088745066 11:112798116-112798138 CGGTCAGGTGCTGGCTGTGTTGG + Intergenic
1088771749 11:113042592-113042614 CAGGCAGGCACTGGAAGTGTGGG - Intronic
1089765010 11:120756899-120756921 TGGGCAGGGGCTGGCTGGGCTGG - Intronic
1091222930 11:133940933-133940955 CGGGCAGGCAGGGGCTGTGTCGG - Intronic
1092545814 12:9450471-9450493 CGGGCAGGCTCCGGCCGCGTAGG + Intergenic
1095937997 12:47705827-47705849 CGGGCCGGGGCTGGCGGTGGAGG - Intronic
1100017563 12:90029572-90029594 AGAGCAGGTGCTGTCTGTGTAGG - Intergenic
1101447412 12:104747183-104747205 CGGGCAGCCGCTGGAGGCGTGGG - Intronic
1103564488 12:121808597-121808619 AGGGCAGGCTCTGGGTCTGTGGG - Intronic
1107885615 13:44872221-44872243 AGGGCAGGAGGAGGCTGTGTGGG + Intergenic
1107993428 13:45838522-45838544 GGGGCAGGCGCTGGCACTGCAGG - Intronic
1112379084 13:98871786-98871808 CTGACAGGTGCTGCCTGTGTGGG + Intronic
1112771795 13:102800448-102800470 CGCGGAGGCGCGGGCTGGGTTGG + Intronic
1113346318 13:109482069-109482091 AGGCCAGGGGCTGCCTGTGTGGG - Intergenic
1113412760 13:110104938-110104960 TGGGAAGGAGCAGGCTGTGTCGG - Intergenic
1113891105 13:113736014-113736036 CTGCCAGGCGCAGGCTCTGTTGG + Exonic
1119618452 14:76113689-76113711 CAGGCAGGAAATGGCTGTGTTGG - Intergenic
1121585496 14:95060402-95060424 CGGAGAAGCGCTGGCTGGGTGGG - Intergenic
1122016820 14:98803460-98803482 CAGGCAGAGGCTGCCTGTGTTGG - Intergenic
1122600142 14:102917316-102917338 GGGGCTGGGGCTGGCTGGGTGGG - Intergenic
1127490705 15:59459951-59459973 TGGTCAGGGACTGGCTGTGTCGG - Exonic
1127700447 15:61494846-61494868 AGGGCAGGTACTGGCTGTGAAGG - Intergenic
1127906739 15:63381737-63381759 GGGGCGGGCGCGGGCTGTGCCGG + Exonic
1127997575 15:64162672-64162694 AGGGCAGGGGCTGGGGGTGTCGG + Intronic
1129202102 15:74009076-74009098 CAGGCAAGTGCTGGCAGTGTGGG - Intronic
1129239350 15:74242449-74242471 AGGGCAGGCCCTGGTTGGGTGGG - Intronic
1132587200 16:710734-710756 AGGGCAGGAGCTGGCTGGCTGGG - Intronic
1132673470 16:1112142-1112164 CCGGCAGCCTCTGGCTGTCTCGG - Intergenic
1132743920 16:1428927-1428949 TGGCCAGGCCCTGGCTGTGGGGG - Intergenic
1132747180 16:1441671-1441693 CGGGCAGGCGCTGGCTGTGTGGG + Intronic
1133025134 16:2985899-2985921 CAGGCAGGCCCTGCCTGGGTGGG + Intergenic
1133447019 16:5870219-5870241 CTGGGAGGCGTTGGCTGGGTAGG + Intergenic
1133800914 16:9084646-9084668 AGGACAGGCGCTGGTTGTGGTGG + Intergenic
1135324887 16:21520098-21520120 GGGGCTGGCGCTGGTGGTGTGGG - Intergenic
1136188402 16:28601249-28601271 CGGGGAGGAGCTGGCTGGGGCGG - Intergenic
1136190871 16:28614243-28614265 CGGGGAGGAGCTGGCTGGGGCGG - Intronic
1137691728 16:50432840-50432862 CGGGCATGAGCTGCTTGTGTGGG + Intergenic
1138540301 16:57683810-57683832 CAGGCAGGAGCTGGCAGTGGGGG + Intronic
1139349642 16:66327151-66327173 CGAGCTGGCGCTGGCAGGGTGGG - Intergenic
1141067471 16:80925685-80925707 CAGGCAGGAGCGGGCTGGGTGGG + Intergenic
1142037092 16:87869155-87869177 GGGGCTGGCGCTGGTGGTGTGGG - Exonic
1142131951 16:88435171-88435193 GGTGCAGCTGCTGGCTGTGTGGG - Exonic
1143141183 17:4742624-4742646 AGGGCAGGGGCTGGGTGTTTGGG + Intronic
1143485338 17:7251165-7251187 AGGGTGGGCGCTGGCGGTGTTGG - Intronic
1143730681 17:8881058-8881080 CTGCCAGGGGCTGGCAGTGTTGG - Intronic
1145910690 17:28540395-28540417 CAGCCTGGCCCTGGCTGTGTAGG + Intronic
1146654268 17:34626139-34626161 CGGGCTGGGGCTGGCCGGGTGGG - Exonic
1147735234 17:42633293-42633315 CAGACAGTCGCTGGCTGTCTGGG - Intergenic
1147990057 17:44326974-44326996 CCGGCAGGCGCCGGCTGACTGGG - Intergenic
1150158786 17:62876208-62876230 AGGGCAGGCCCAGGCTGTGAAGG - Intergenic
1152077138 17:78166742-78166764 GGGGCAGGCTCTGTGTGTGTTGG - Intergenic
1152362191 17:79837804-79837826 GTGGCAGGCGGTGGCTGCGTGGG + Intronic
1152529287 17:80907619-80907641 GGGGCAGGCACGGGCTATGTGGG - Intronic
1152684886 17:81689030-81689052 CGGGCAGGGGCAGGCAGTGATGG + Intronic
1152783171 17:82235394-82235416 CGGGCAGTCTCTGGCGGTGAGGG - Exonic
1152897077 17:82918310-82918332 AGGGCAGGGGCTGTCTCTGTGGG - Intronic
1154041424 18:10859844-10859866 CGGGGAGGTGGTGGCTGTGCTGG + Intronic
1154297309 18:13162200-13162222 CGGGGTGGTGCTGGCTGTCTGGG - Intergenic
1155092203 18:22523126-22523148 TGGGCAGGGGCTGGGTGTGTTGG + Intergenic
1155517420 18:26637436-26637458 GGAGGAGGCGCTGGGTGTGTGGG + Intronic
1156118953 18:33820227-33820249 CGGGTGGGCGCCGGCTGGGTGGG - Intergenic
1157676575 18:49573030-49573052 CAGGCAGGCTCTGGCTGGGTAGG + Intronic
1158436099 18:57436259-57436281 CGGACAGGCGCTGGTGGTGGTGG - Exonic
1159552202 18:69906933-69906955 GGGGCAGGTGCTGGCTGTTAGGG - Intronic
1160677503 19:399299-399321 GGGGGAGGGGCTGGCAGTGTGGG + Intergenic
1160875316 19:1294018-1294040 CGGGGTGGCGGTGGCTGTGCCGG + Intronic
1161072845 19:2271044-2271066 AGGGGAAGCGCTGGCTGTCTTGG + Intronic
1161269825 19:3383686-3383708 CTGGCAGCCCCTGGGTGTGTGGG - Intronic
1162054132 19:8052698-8052720 CGGGCAGGGGGTGGCTGGGTGGG + Intronic
1163245029 19:16088149-16088171 TGGGAAGGAGCTGGCTGTGTTGG + Intronic
1165638586 19:37364596-37364618 AGGGCTGTCGCTGGCTGTGGAGG + Intronic
1165846626 19:38821794-38821816 CGGGGAGGCTCGGGCTGTGCAGG - Intronic
1165992788 19:39825854-39825876 GGGGCAGGCGCTGGGTGAGGTGG + Exonic
1166118023 19:40667589-40667611 GGGGCAGGCGCTGGCTCAGGGGG + Exonic
1166532249 19:43550054-43550076 GGGGCAGGGGCAGGCTCTGTTGG - Intronic
1166832152 19:45645344-45645366 GGGGCCGGCGGTGGCTGTGGTGG - Exonic
1166873998 19:45886236-45886258 CGGGCAGACGCGGGCTGGGGGGG + Intergenic
1167103946 19:47419652-47419674 CGGGGAGGGGCAGGCTGTGGGGG + Intergenic
1168267226 19:55229610-55229632 GGGCCAGGCACTGGCTGTGAGGG - Intergenic
925384577 2:3453267-3453289 TGGTCAGGCGCCGGCAGTGTGGG - Intronic
925532954 2:4884263-4884285 CGGGTGGGCACTGGCTCTGTGGG + Intergenic
927104363 2:19810920-19810942 GGGGAAGGCGCTGGCTGGGAAGG - Intergenic
927219903 2:20697086-20697108 CTGGCAGGCCCTGGATGTATGGG - Intronic
934277964 2:91589000-91589022 CGGACAGGGGCTGGGTGGGTGGG + Intergenic
935336926 2:102024617-102024639 CGGGTAGGCGCTCTCTATGTGGG - Exonic
935615851 2:105081057-105081079 CGGGCAGCCTCAGGCTGTGCGGG - Intronic
937895959 2:126977000-126977022 CGGGGTGGTGCTGGCTGGGTGGG - Intergenic
938032706 2:128009118-128009140 GGGGCAGGCGGTGGGGGTGTGGG - Intronic
941791523 2:169557233-169557255 CGAGCAAGCCCTGGCAGTGTTGG - Exonic
946310543 2:218880562-218880584 GGGGGCGGCGCTGTCTGTGTCGG - Exonic
946371129 2:219281953-219281975 CGGGCAGAAGCTGGCAGTGGTGG + Exonic
946784086 2:223224002-223224024 AGGGTAGAAGCTGGCTGTGTAGG + Intergenic
948463820 2:238142849-238142871 CGGGCAGGCGCTGGAGGAGGAGG + Exonic
948609616 2:239158598-239158620 CGGGGAGGCGCTGGCAGTTGGGG - Intronic
948622724 2:239246515-239246537 CGGCCAGGCGCTGGCTGAGCAGG + Intronic
948652520 2:239457283-239457305 TGGGCAGGGGCTCACTGTGTTGG + Intergenic
1169195723 20:3681165-3681187 CGGCCAGGCACTTGCTGTGCAGG + Intronic
1172227640 20:33315858-33315880 CAGGCAGGGGCTGTCTGGGTGGG - Intergenic
1172621038 20:36318729-36318751 CAGGGAGGCTCTGGCTGGGTGGG + Intronic
1174442983 20:50570728-50570750 CGGGCAGGGAGTGGCTGTGCTGG + Intronic
1175776342 20:61656218-61656240 CGGGCAGGCGCGTGCTGGGGTGG + Intronic
1175936718 20:62517616-62517638 GGGGCAGGGGGAGGCTGTGTGGG - Intergenic
1176170627 20:63694907-63694929 CGACAAGGTGCTGGCTGTGTTGG + Exonic
1176385628 21:6137494-6137516 AGGGCAGGCTCTGGCTGGGAGGG + Intergenic
1177144204 21:17390187-17390209 CAGGCAGGAGCTGGCTGTCTTGG - Intergenic
1178992578 21:37367527-37367549 CGGGGCGGCGCTGGCTGCGGAGG + Intronic
1179646099 21:42777273-42777295 CGGGCAGGCTCTGGGTGTGCAGG - Intergenic
1179737845 21:43400758-43400780 AGGGCAGGCTCTGGCTGGGAGGG - Intergenic
1179953463 21:44724452-44724474 TGGGAAGGCTCTGGCTCTGTGGG + Intergenic
1180791442 22:18577572-18577594 CTGGCAGGCCCGGGCTTTGTGGG - Intergenic
1181230297 22:21417739-21417761 CTGGCAGGCCCGGGCTTTGTGGG + Intronic
1181248353 22:21517124-21517146 CTGGCAGGCCCGGGCTTTGTGGG - Intergenic
1183369874 22:37426555-37426577 CGGGGAGGGGGTGGGTGTGTTGG - Intronic
1183406037 22:37631112-37631134 GGGGCAGGTGCAGGCTGGGTTGG + Intronic
1183411757 22:37659064-37659086 CGGGCAGGCGCTGGCGCAGCAGG - Exonic
1184053153 22:42023780-42023802 CTGGCAGGGGCTGGGTGTGGTGG - Intronic
1184428621 22:44428136-44428158 CAAGCAGGCGCTGGCTTTCTGGG + Intergenic
1184778153 22:46633478-46633500 CAGGGAAGGGCTGGCTGTGTGGG + Intronic
1185415101 22:50705402-50705424 CAGGCAGCTGCTGGCGGTGTAGG - Intergenic
949281478 3:2352494-2352516 CTGCCAGGGGCTGGCTGTGCCGG - Intronic
949950462 3:9224807-9224829 CAGGGAGGGGCTGGCTGTGCAGG + Intronic
961681786 3:128604343-128604365 CAGGCAGGTCCTGGCTGTGCAGG + Intergenic
966982853 3:185153604-185153626 CGGGCAGGGGTTGGCGGTGCTGG - Intergenic
967477778 3:189941170-189941192 CTGGGAGGCGTTGGCTTTGTAGG - Intergenic
968891425 4:3371279-3371301 CGGGCCGCCTCTGGCTGTCTTGG + Intronic
968967489 4:3776463-3776485 CGGGCAGGAGCTGGCTGCTGAGG + Intergenic
969442039 4:7222955-7222977 CAGGCAGGCCCTGGCTGCGTCGG + Intronic
970609149 4:17709419-17709441 GGAGGAGGCGCTGGCTGAGTCGG - Exonic
970691949 4:18630633-18630655 TGGGGAGGCTCTGGCTGCGTGGG + Intergenic
973144226 4:46804892-46804914 CGGGGAGGCTCAGGCTGCGTGGG + Intronic
976267419 4:83197165-83197187 AGAACAGGTGCTGGCTGTGTGGG + Intergenic
981315619 4:143337112-143337134 TCGGCAGGCGTCGGCTGTGTCGG + Exonic
982284968 4:153724973-153724995 CGGGCAGGGGTGAGCTGTGTGGG + Intronic
982284987 4:153725027-153725049 CGGGCAGGGGTAGGCTGCGTGGG + Intronic
982692808 4:158567199-158567221 CGGGGAGGCTCCGGCTGTGCAGG - Intronic
984758407 4:183343980-183344002 CGGGCAGGGGCTGGCTGGGGAGG + Intergenic
999318926 5:150601320-150601342 CTGGCAGGGCCTGGCTGTCTGGG + Intronic
1001396179 5:171420652-171420674 CGAGGAGGCGCTGGCTGTCGCGG + Intronic
1001939432 5:175730005-175730027 CGCGCAGGTGCTGGCTGGATAGG - Intergenic
1002140486 5:177134371-177134393 CGGGCAGGCGGCGGCGGCGTCGG + Intronic
1002432614 5:179212230-179212252 TGGGCAGGCACGGGCTCTGTGGG + Intronic
1002432685 5:179212492-179212514 TGGGCAGGCACGGGCTTTGTGGG + Intronic
1003981437 6:11393924-11393946 CAGTCAGGAGGTGGCTGTGTTGG - Intergenic
1004338182 6:14783665-14783687 CGGGGAGGCTCTGGCTGTGCAGG + Intergenic
1004634575 6:17454411-17454433 TGTCCAGGCGCTGGCTGAGTAGG + Intronic
1006386406 6:33733476-33733498 CGGGCAGCCGCAGGCTAAGTGGG - Intronic
1006602329 6:35234222-35234244 AGGGCATGAGCTTGCTGTGTGGG + Intronic
1007433637 6:41792151-41792173 CTGGCAGGCGCTGACTGAGATGG - Exonic
1007469123 6:42076918-42076940 CAGGCAGGGGCTGGCTATGAAGG - Intronic
1009800754 6:68533689-68533711 CGGGGAGGCTCGGGCTGTGCAGG - Intergenic
1011099969 6:83709321-83709343 CGGAGAGCCGCTGGCTGGGTGGG - Exonic
1011879895 6:92011807-92011829 CGGGGAGGCTCAGGCTGTGCAGG + Intergenic
1014233984 6:118935041-118935063 CGGGGACGCGCGGGCTGTGTCGG + Exonic
1017873106 6:158502824-158502846 CGGGGAGGCGCTGGCGGTATGGG - Exonic
1017914094 6:158818779-158818801 CGGGCTCGCGCTGGCTGTCCCGG - Intronic
1018490485 6:164287744-164287766 CAGGCAGGCGCTGGCTAGGCTGG + Intergenic
1019200003 6:170306589-170306611 CGCGCAGGCGCCGGCGGCGTGGG - Intronic
1019723435 7:2587263-2587285 GGGCCAGGCAGTGGCTGTGTGGG + Intronic
1020083340 7:5297882-5297904 CTGGCAGGGGCTGTCTGTGCTGG - Intronic
1020107275 7:5427988-5428010 CGGGCAGCTCCTGGCTGGGTTGG - Intergenic
1021983671 7:26079125-26079147 AGGGCATGCGCGGGCGGTGTGGG - Intergenic
1025210937 7:57019317-57019339 CTGGCAGGGGCTGTCTGTGCTGG + Intergenic
1025661018 7:63557530-63557552 CTGGCAGGGGCTGTCTGTGCTGG - Intergenic
1026017385 7:66682090-66682112 CGGGCGTGCGCTGGCGGTGCCGG + Intronic
1026837833 7:73649947-73649969 CGGCCAGGAGCGGGCAGTGTGGG + Intergenic
1027778990 7:82499869-82499891 CGGGGAGGCTCGGGCTGTGCAGG - Intergenic
1029210070 7:98900368-98900390 CGGCCTGGCACTGGCTTTGTGGG + Intronic
1029548454 7:101223610-101223632 CGGGCAGGTGTTCGCTGCGTGGG + Intronic
1030772182 7:113488196-113488218 CGGGGAGGCTCAGGCTGTGTGGG + Intergenic
1032012595 7:128356676-128356698 GAGGCAGGCGCTGGCTGGGGAGG + Intronic
1032085949 7:128884035-128884057 GGGGCAGGAGCTGGCTGGGGGGG + Exonic
1032090108 7:128907313-128907335 CTGGCAGACGCAGGCTGTGCAGG + Exonic
1034413336 7:150952616-150952638 CTGCCAGCCGCTGGCTGTGGTGG - Exonic
1034950135 7:155291350-155291372 TGGGCAGGAGGAGGCTGTGTGGG - Intergenic
1035388790 7:158491323-158491345 TGGGCAGGCACTGGCTGGGCAGG - Intronic
1036133170 8:6135149-6135171 CAGCCAGGCGCTGGGTGTTTTGG + Intergenic
1036595165 8:10205336-10205358 GGGACAGTCGCTGGCTGTGGTGG + Intronic
1037399837 8:18484368-18484390 CAGGGAGGAGCTGGCTGTGATGG - Intergenic
1041804606 8:61836620-61836642 CGGGTAGGTGCCAGCTGTGTTGG + Intergenic
1044459608 8:92429290-92429312 CGGGGAGGCTCAGGCTGCGTGGG + Intergenic
1047239447 8:123072860-123072882 CGGGAGGGCGCGGGCTGTGGAGG + Intronic
1047403886 8:124568942-124568964 CGGGCACGGGCTGGCTTTGTTGG + Intronic
1047754779 8:127910017-127910039 GGGGCAGAGGCTGGGTGTGTGGG + Intergenic
1049179626 8:141215588-141215610 GGGGCAGGTGGTGGCTCTGTGGG + Intronic
1049324760 8:142016139-142016161 CGTGCTGGGCCTGGCTGTGTGGG + Intergenic
1052576612 9:30299563-30299585 CGGGGAGGCTCAGGCTGTGCAGG - Intergenic
1053174731 9:35914543-35914565 AGGGCAGGAGGTGGCTGTGCAGG + Intergenic
1054731592 9:68706315-68706337 GGGGCAGGGGCTGGGAGTGTAGG + Intronic
1056826333 9:89878776-89878798 CGGGAAAGAGGTGGCTGTGTGGG + Intergenic
1058727568 9:107818101-107818123 CGGGGAGGCTCAGGCTGTGCAGG - Intergenic
1059409556 9:114123577-114123599 CGGAGAGGCCCTGGCTCTGTGGG + Intergenic
1060407680 9:123381020-123381042 CGTGCAGGGCCTGGCTGTGGAGG + Exonic
1060531945 9:124352831-124352853 CGTGCTGGGGCTGGCAGTGTTGG - Exonic
1060918151 9:127403355-127403377 GAGGCAGGTGCTGGATGTGTTGG + Intronic
1062384224 9:136302727-136302749 CGGGCAGGATCGGGCTGTGCTGG - Intronic
1062532252 9:137007117-137007139 CTGGCAGGGGGTGGCTGGGTCGG - Intergenic
1062580812 9:137228515-137228537 AGGTCAGGCGCTGGGTCTGTGGG - Intronic
1062629523 9:137457614-137457636 CGCGCAGGGGCTGGCTGTGATGG + Exonic
1186426675 X:9467992-9468014 CTGGATGGCGATGGCTGTGTGGG - Intronic
1186525721 X:10246468-10246490 CGGGTAGACCCTGGCTTTGTAGG + Intergenic
1186576856 X:10775880-10775902 CTGGCAGGAGCTGTTTGTGTAGG - Intronic
1187181412 X:16946784-16946806 CGAGGAGGCGGTGGCTGTGGCGG + Exonic
1187426702 X:19183960-19183982 CGTGCAGGCGCTGCCTGAGTCGG - Intergenic
1187670358 X:21659953-21659975 AGGGCAGGTGCTGGATTTGTGGG + Intergenic
1190302271 X:49063934-49063956 AGGGTAGGCGCGGGCTGTGGGGG - Exonic
1190726673 X:53194585-53194607 TGGGCAGGTGCTGGCTGGGGCGG - Exonic
1190879936 X:54484860-54484882 TGGCCAGACGCTGGCTGGGTGGG - Intronic
1195333335 X:103825256-103825278 CAGGCAGGTGCTGGCTGTAGAGG - Exonic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1199673170 X:150163475-150163497 TGGGGAGGAGCTGACTGTGTGGG - Intergenic
1200096331 X:153665848-153665870 TGGCCAGGCGGTGGCTGAGTTGG - Intergenic
1200110750 X:153739746-153739768 GAGGACGGCGCTGGCTGTGTTGG + Intronic
1200228505 X:154432447-154432469 CGGGCAGTACCTGGCTGTGTAGG - Exonic