ID: 1132748485

View in Genome Browser
Species Human (GRCh38)
Location 16:1446767-1446789
Sequence CACAAGGCAGGGAGCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 251}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132748485_1132748497 4 Left 1132748485 16:1446767-1446789 CCTGTGGAGCTCCCTGCCTTGTG 0: 1
1: 0
2: 3
3: 20
4: 251
Right 1132748497 16:1446794-1446816 GCTGGGGCAGCACAGGCAGGGGG 0: 1
1: 0
2: 9
3: 115
4: 995
1132748485_1132748498 10 Left 1132748485 16:1446767-1446789 CCTGTGGAGCTCCCTGCCTTGTG 0: 1
1: 0
2: 3
3: 20
4: 251
Right 1132748498 16:1446800-1446822 GCAGCACAGGCAGGGGGCCCTGG 0: 1
1: 0
2: 10
3: 77
4: 713
1132748485_1132748494 1 Left 1132748485 16:1446767-1446789 CCTGTGGAGCTCCCTGCCTTGTG 0: 1
1: 0
2: 3
3: 20
4: 251
Right 1132748494 16:1446791-1446813 GTGGCTGGGGCAGCACAGGCAGG 0: 1
1: 1
2: 9
3: 93
4: 640
1132748485_1132748501 13 Left 1132748485 16:1446767-1446789 CCTGTGGAGCTCCCTGCCTTGTG 0: 1
1: 0
2: 3
3: 20
4: 251
Right 1132748501 16:1446803-1446825 GCACAGGCAGGGGGCCCTGGGGG 0: 1
1: 1
2: 7
3: 55
4: 628
1132748485_1132748495 2 Left 1132748485 16:1446767-1446789 CCTGTGGAGCTCCCTGCCTTGTG 0: 1
1: 0
2: 3
3: 20
4: 251
Right 1132748495 16:1446792-1446814 TGGCTGGGGCAGCACAGGCAGGG 0: 1
1: 1
2: 2
3: 64
4: 546
1132748485_1132748500 12 Left 1132748485 16:1446767-1446789 CCTGTGGAGCTCCCTGCCTTGTG 0: 1
1: 0
2: 3
3: 20
4: 251
Right 1132748500 16:1446802-1446824 AGCACAGGCAGGGGGCCCTGGGG 0: 1
1: 1
2: 5
3: 57
4: 550
1132748485_1132748493 -3 Left 1132748485 16:1446767-1446789 CCTGTGGAGCTCCCTGCCTTGTG 0: 1
1: 0
2: 3
3: 20
4: 251
Right 1132748493 16:1446787-1446809 GTGTGTGGCTGGGGCAGCACAGG 0: 1
1: 0
2: 4
3: 45
4: 519
1132748485_1132748499 11 Left 1132748485 16:1446767-1446789 CCTGTGGAGCTCCCTGCCTTGTG 0: 1
1: 0
2: 3
3: 20
4: 251
Right 1132748499 16:1446801-1446823 CAGCACAGGCAGGGGGCCCTGGG 0: 1
1: 1
2: 6
3: 49
4: 501
1132748485_1132748496 3 Left 1132748485 16:1446767-1446789 CCTGTGGAGCTCCCTGCCTTGTG 0: 1
1: 0
2: 3
3: 20
4: 251
Right 1132748496 16:1446793-1446815 GGCTGGGGCAGCACAGGCAGGGG 0: 1
1: 1
2: 12
3: 111
4: 984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132748485 Original CRISPR CACAAGGCAGGGAGCTCCAC AGG (reversed) Intronic