ID: 1132748754

View in Genome Browser
Species Human (GRCh38)
Location 16:1447711-1447733
Sequence CAGGCTGCAAGACAGGCCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132748750_1132748754 -10 Left 1132748750 16:1447698-1447720 CCCTGGAGCCGGGCAGGCTGCAA 0: 1
1: 0
2: 3
3: 18
4: 189
Right 1132748754 16:1447711-1447733 CAGGCTGCAAGACAGGCCCGCGG 0: 1
1: 0
2: 2
3: 21
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132748754 Original CRISPR CAGGCTGCAAGACAGGCCCG CGG Exonic
900519494 1:3098735-3098757 CAGTCTTCTGGACAGGCCCGGGG + Intronic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
901884026 1:12210179-12210201 CAGGCTGGAGGACAGGACCATGG - Intergenic
901930489 1:12593909-12593931 CAGCCTACAAGACTGGCCAGGGG + Intronic
902514561 1:16983167-16983189 CAGGCTGCCATAAAGGGCCGGGG - Intergenic
902927108 1:19703369-19703391 CAGGGGGCTAGACAGGCCAGTGG - Intronic
903334246 1:22614294-22614316 CAGGCAGACAGACAGGCCCAGGG - Intergenic
904012891 1:27399773-27399795 CAGGCTGGAAAACAGGCTCCCGG + Intergenic
904873360 1:33635504-33635526 CAGGCTACATGCCAGGCCAGGGG - Intronic
907159521 1:52360284-52360306 CCTGCTCCAAGACAGGCCAGGGG + Intronic
912369394 1:109161964-109161986 CAGGCTGGTGCACAGGCCCGGGG - Exonic
912388116 1:109282797-109282819 CAGGGTGCAAGCCAGGGTCGGGG + Intronic
912518238 1:110228956-110228978 AAGGCCGAAAGACAGGTCCGGGG - Intronic
912929143 1:113940818-113940840 CATGCTGCAAAACAGGACTGTGG + Exonic
913163743 1:116167613-116167635 AAGGCTGCAAGGCAGGCCAGAGG - Intergenic
915311032 1:155005883-155005905 CAGGCGCCAAGGCGGGCCCGGGG + Intronic
917361019 1:174176288-174176310 CAAACTGCAAGACAGACCAGTGG - Intronic
917451388 1:175150592-175150614 CAGGCTGCAAGCCAGGCACTAGG + Intergenic
917452084 1:175155759-175155781 CTGGCTTCAGGACAGGCCGGGGG - Intergenic
918999059 1:191804343-191804365 CTAGCTACAAGAGAGGCCCGTGG - Intergenic
919763039 1:201110370-201110392 CAGGCTGCTGGACAGGCTCATGG + Intronic
919883570 1:201916739-201916761 CAGGCTGCGAGGCAGGTCCTGGG - Intronic
1067801250 10:49360990-49361012 CAGGGTGCAGGACAAGCCCTAGG + Intergenic
1068779429 10:60903647-60903669 CAGGCTGAGAAACAGGCCCCTGG + Intronic
1071444032 10:85729557-85729579 CAGCTTGCAAGAGAGGCCCATGG - Exonic
1073932463 10:108591589-108591611 CAGGCTCCTAGACTGGCCAGTGG + Intergenic
1077251015 11:1560727-1560749 CCCGCTGCAGGACAGCCCCGGGG + Intronic
1077440393 11:2566153-2566175 CAGGCTGCAAAAGTGGCCCTGGG - Intronic
1077650203 11:3964574-3964596 CAGGCTGCACCACTGGCCTGAGG - Intronic
1083700000 11:64470008-64470030 CAGGGTGAGAGACAGGCCTGAGG - Intergenic
1084785837 11:71441155-71441177 CAGGCAGCAAGAAAGGCCAGGGG + Intronic
1089620855 11:119721410-119721432 CAGGCAGCAAAACAGGCCAGTGG - Intronic
1089659115 11:119974425-119974447 CAGGGAGGAAGACAGGCCCCTGG + Intergenic
1089891608 11:121886986-121887008 CAGGCTGCTAAACAGACCCTGGG + Intergenic
1089984847 11:122803519-122803541 CAGGCAGCAAGACCAGCCCAGGG + Intronic
1090386922 11:126362716-126362738 CAGAGTGCAAGACCTGCCCGAGG - Intronic
1090721298 11:129475735-129475757 CAGGCCCCAAGACAGGCTCTTGG - Intergenic
1092181232 12:6448299-6448321 CAGGCTGCAAGAAAGCCTGGTGG - Intronic
1092780188 12:11979041-11979063 CAGGCTGCTAGACAGATCAGAGG - Intergenic
1094100880 12:26761059-26761081 CAGGCTTCAGGCCAGGCCCATGG + Intronic
1095450151 12:42322561-42322583 CAGTCTATAAGACAGGCCCTAGG + Intronic
1097250277 12:57628678-57628700 CAGGCTGAACGGCAGGCCAGAGG - Intronic
1102351447 12:112195161-112195183 CAGGCTGGAAGAGAAGCCTGAGG - Intronic
1103558700 12:121780935-121780957 TCGGCTGCAAGACAGACCTGAGG - Exonic
1104648509 12:130514141-130514163 CAGGCTGCAGGACAGATCTGGGG + Intronic
1104965827 12:132508444-132508466 CGCGCTGCCAGGCAGGCCCGGGG - Intronic
1112128437 13:96496024-96496046 CAAACAGCAAGACAGGCCTGGGG - Intronic
1112494815 13:99896189-99896211 CGGGCTGCGCGACAGGCGCGCGG - Exonic
1113440814 13:110326678-110326700 GAGGCAGCCAGACAGGCGCGGGG - Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115610780 14:35046685-35046707 CAGGCTAAAAGAGCGGCCCGCGG - Intronic
1119385689 14:74257130-74257152 CATCCTGCAGCACAGGCCCGCGG + Intronic
1121127808 14:91418670-91418692 CTGGCTGGAAGGCAAGCCCGGGG + Intergenic
1121514448 14:94540153-94540175 CAGGCTGAATGACAGGCAGGGGG - Intergenic
1122072038 14:99211204-99211226 CGGGGTGCCAGACAGGCCTGGGG - Intronic
1202892082 14_KI270722v1_random:168249-168271 CAGCCAGCAGGACAGGCCAGGGG - Intergenic
1124375563 15:29126888-29126910 CTGGCTGCACTCCAGGCCCGGGG - Intronic
1128364226 15:66985928-66985950 CAGGCTGCCAGAGATGCCAGTGG + Intergenic
1128588249 15:68870571-68870593 CAAACTGCAAGACAGACCAGTGG + Intronic
1129264207 15:74385385-74385407 GAGGCTGCCAGCCAGGCCCTGGG - Intergenic
1130957710 15:88639136-88639158 CAGGCTGCGGGGCAGGCCAGAGG + Intronic
1131059944 15:89398439-89398461 TAGGCTGCAAGAAAGGCAGGGGG - Intergenic
1132311633 15:100861916-100861938 CAGCTTGCAACACAGGCCCCCGG + Intergenic
1132549164 16:547294-547316 CACGCTGCACAACACGCCCGTGG + Exonic
1132574719 16:659112-659134 CAGCCTGCAAGACAGGTGAGTGG + Exonic
1132748754 16:1447711-1447733 CAGGCTGCAAGACAGGCCCGCGG + Exonic
1132982228 16:2744186-2744208 CAGGCAGCAACACAGTCCTGGGG + Intergenic
1133143849 16:3769095-3769117 CAGGCTCCAAGCCTCGCCCGAGG + Intronic
1134417585 16:14057925-14057947 CAGGATCCCAAACAGGCCCGTGG - Intergenic
1135351903 16:21736323-21736345 CAGACTGAAAGACAGCCCAGAGG - Exonic
1135450391 16:22552446-22552468 CAGACTGAAAGACAGCCCAGAGG - Intergenic
1137615916 16:49846883-49846905 CAGGCTGGAAGACTGGGCAGGGG - Intronic
1139447981 16:67009996-67010018 CGGGCTGCAGGAGAGGCCAGAGG - Intergenic
1141681176 16:85544861-85544883 CAGGCAGCAGAACAGGACCGCGG + Intergenic
1141811275 16:86377948-86377970 AAGGATGCAAAACAGGGCCGAGG + Intergenic
1142120118 16:88383017-88383039 CTGGCTGCAGGGCTGGCCCGCGG + Intergenic
1142151481 16:88514447-88514469 CGGGCCCCAGGACAGGCCCGTGG - Exonic
1143020711 17:3916027-3916049 GAGTCTGGAGGACAGGCCCGGGG + Intronic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1147552145 17:41450962-41450984 CATGCTGAAAGACAGGCCACTGG - Intergenic
1148156209 17:45426499-45426521 CAGGCTACCAGACAGGGCCAGGG - Intronic
1151399889 17:73849116-73849138 CAGGCTGCAGGACATGCTCAGGG - Intergenic
1151713534 17:75819901-75819923 CCGCCTGCAAGAGAGGCCCGGGG - Exonic
1152228912 17:79105078-79105100 CAGGCTTCAGGACAGGCCCTGGG - Intronic
1152498074 17:80688627-80688649 CAGGCATCAAGTCAGGCCAGTGG - Intronic
1152585741 17:81188694-81188716 CAGGTAGGAAGACAGGCTCGGGG + Intergenic
1152699610 17:81812460-81812482 CTGGCAGCAAGATAGGCCCTGGG - Intronic
1157583365 18:48786228-48786250 GAGGCTGAAAAACAGGCCTGAGG - Intronic
1160822535 19:1065205-1065227 CAGGCTGGGGGCCAGGCCCGTGG + Intronic
1161010437 19:1957191-1957213 CAGGCAGCCCCACAGGCCCGAGG + Intronic
1161380273 19:3961158-3961180 CAGGCTGCGAGACAGGCGTGGGG + Exonic
1161406542 19:4094393-4094415 CAGGCTGCCACCCAGGCCCCAGG - Intronic
1161590444 19:5126979-5127001 CAAACCCCAAGACAGGCCCGAGG - Intronic
1162530493 19:11233324-11233346 CAGGCTGCCACACTGGCCCGTGG - Exonic
1162860993 19:13505844-13505866 CAGGCTGGGAGAGAGACCCGGGG - Intronic
1163105594 19:15121369-15121391 CAGGTTCCAGGACAGGCACGGGG - Intronic
1163292776 19:16391530-16391552 TAGGCTGCAACCCAGGCCCGGGG - Intronic
1163417975 19:17198165-17198187 CAGGCTGCAAGACGGTGCAGTGG - Exonic
1164006226 19:21151993-21152015 CTGGCTGCACCACAGCCCCGTGG + Intronic
1164833881 19:31344586-31344608 CAGGCAGGCAGGCAGGCCCGCGG - Intronic
1165213726 19:34254707-34254729 CAGACGGCGAGACGGGCCCGCGG + Intronic
1165528685 19:36378677-36378699 CCGGCTCCAGGAAAGGCCCGCGG - Intronic
1166356834 19:42232374-42232396 CAGGGTACAAGGCAGGCCTGGGG - Intronic
1166859294 19:45800517-45800539 GAGGCTGCAGGACAGGCGGGTGG + Exonic
1168432971 19:56295904-56295926 CAGGAAGCAAGACAGGTCAGGGG - Intronic
925386736 2:3467181-3467203 CAGGCTGCAAGGGAAGCCCTCGG + Intronic
927387006 2:22546239-22546261 CAGGCTCCAATGCAGGCCCAAGG + Intergenic
928230095 2:29490653-29490675 CAGTCTGCCAAAGAGGCCCGTGG - Intronic
929568822 2:43006946-43006968 CAGGCAGAAGGACAGGCCCAGGG + Intergenic
929927822 2:46230197-46230219 CAAGCTGCAAGCCAGCCCAGTGG + Intergenic
930086599 2:47502174-47502196 GAGGCTTGAAGAGAGGCCCGGGG + Intronic
931482393 2:62654676-62654698 CAGTCTGCAAGACTGGCCTGAGG - Intergenic
934164262 2:89280115-89280137 CAGGCTGCATGACAGGCAGCAGG + Intergenic
934203012 2:89902409-89902431 CAGGCTGCATGACAGGCAGCAGG - Intergenic
935587964 2:104818531-104818553 CAGGGAACAAGACAGGCCAGAGG - Intergenic
936046661 2:109193894-109193916 CAGGCTGCAAGCCTTGCCCCAGG + Intronic
937325480 2:120987554-120987576 CAGGCTGCAAGAGTGGGCAGAGG - Intronic
937535000 2:122875339-122875361 CAGGCTCCAAGAAAGCCCAGAGG + Intergenic
938085275 2:128395838-128395860 CAGGCTGCTGGACAGGCCTTGGG + Intergenic
938101146 2:128498967-128498989 CAGGCTTCAAGAGAGGCTCTTGG + Intergenic
938662834 2:133504991-133505013 CAGGCTGGATGACTGGCCTGAGG - Intronic
940945917 2:159616973-159616995 CAGTATGCAAGACGGTCCCGGGG + Intergenic
946312133 2:218888167-218888189 CAGGCAGCAAGAGAAGCCAGAGG - Intronic
947945049 2:234093970-234093992 CAGGATGCGAGACGGGCCTGGGG - Intergenic
948805779 2:240453040-240453062 CGCGCTGGAAGCCAGGCCCGAGG + Intronic
949040171 2:241844292-241844314 CCGGCGGCGACACAGGCCCGGGG + Intergenic
1170732686 20:18988334-18988356 CAGACTGTAAGAAAGGCCAGTGG + Intergenic
1172059870 20:32179971-32179993 CAGGCTGCAACACAGGGAGGGGG - Intergenic
1172355459 20:34276780-34276802 CTGGCTCCAAGACAGGCATGTGG - Intergenic
1175215281 20:57389293-57389315 CAGGCGGCAGGGCAGCCCCGGGG - Intergenic
1175248435 20:57595145-57595167 CAGGCTCCAAGAGGGGCCCCGGG - Intergenic
1175263695 20:57690129-57690151 CAGGCTGAAAGCCAGGCAGGTGG - Intronic
1176082831 20:63282506-63282528 CAGACTTCAGGACAGGGCCGGGG - Intronic
1176248646 20:64109587-64109609 CAGGCTGCCAGCCAGCCCTGGGG - Intergenic
1176286445 21:5021601-5021623 GAGGCTGCTAGACAGGGCAGCGG - Intergenic
1178327934 21:31660168-31660190 CAGGCACCACGACAGACCCGCGG - Intronic
1179219764 21:39395825-39395847 CAGGCTGCAAGAGTGACCCATGG - Intronic
1179870736 21:44241874-44241896 GAGGCTGCTAGACAGGGCAGCGG + Intergenic
1179874159 21:44259152-44259174 CAGGCTGCCAGTCATGACCGGGG - Intronic
1180091543 21:45536082-45536104 CTGGCTGCAGGAGAGGCCCGGGG - Intronic
1180117829 21:45723731-45723753 CAGGTTGGATGCCAGGCCCGGGG + Intronic
1181432115 22:22888010-22888032 CATGCTGCAAGTCGGGCCAGAGG + Exonic
1181610214 22:24006940-24006962 CAGCCTGCATGACAGGGCCTAGG + Intergenic
1182913105 22:34004128-34004150 CAGCCTGCAGGGCACGCCCGAGG + Intergenic
1185340989 22:50291014-50291036 CAGGCTGACAGACAGACCCCTGG + Intronic
953003618 3:38957600-38957622 CACCCTGCAAGACTGGCCCCTGG - Intergenic
953171244 3:40509807-40509829 CAGGCTGCAACACAGGAAGGGGG - Intronic
955928931 3:64036441-64036463 CAGGATGCAAGTCAAGCCTGGGG + Intergenic
956855786 3:73273679-73273701 CAGTCAGGAAGCCAGGCCCGGGG + Intergenic
964379184 3:156080370-156080392 CAGAAGGCAAGACAGGCCAGTGG - Intronic
964627916 3:158776766-158776788 AAGGCTGCAGGGCAGGCCTGGGG + Intronic
965671958 3:171156766-171156788 CAGGCTGGAGGACAGGCCCTGGG + Intronic
967844902 3:194035596-194035618 CAGCCTGCAAGGCAGGCCTGTGG - Intergenic
969604168 4:8194055-8194077 CAGGCTGCAACTCAAGCCAGGGG - Intronic
971386074 4:26141413-26141435 CAGGCTGCAGCACAGGCCCCAGG + Intergenic
976392003 4:84515534-84515556 GTGGCTGCAAGGCAGGCCCCAGG - Intergenic
981034402 4:140154232-140154254 GAGGCCGTGAGACAGGCCCGCGG + Intergenic
982115955 4:152098566-152098588 CAGGGTACAAGACAGGCCCCAGG - Intergenic
990112017 5:52338133-52338155 CAGGATGCATAACAGGCCCAGGG - Intergenic
990954575 5:61330527-61330549 CAGGCTGCAAGGCAGGCGGGTGG + Intergenic
992528057 5:77630474-77630496 CAGGCTGTTGGACAGGCCCATGG + Exonic
999725177 5:154430990-154431012 CAGGCTGACTGACAGGCCAGTGG - Intergenic
999774315 5:154799951-154799973 CAGGCTGGCAGACAGGCCCTTGG - Exonic
1001571127 5:172731505-172731527 CAGGCTGACAGACAGGGACGAGG - Intergenic
1007171110 6:39864382-39864404 CAACAGGCAAGACAGGCCCGTGG - Intronic
1007756028 6:44100250-44100272 GAGGCTGCAGGACAGGCCCTGGG + Intergenic
1007816787 6:44530608-44530630 CAAGCTGCAGGGCAGGCCAGTGG + Intergenic
1008673571 6:53796129-53796151 GCGGCTGCAAGGCTGGCCCGCGG - Intronic
1015597099 6:134876044-134876066 CAGGGTGCAAGACAGAGCTGGGG + Intergenic
1015754861 6:136596970-136596992 CAGGCTGCAAGAGAGGAGCCTGG + Intronic
1017950555 6:159131666-159131688 CAGACAGAAAGACAGGCCCAGGG - Intergenic
1019005064 6:168789945-168789967 CAGGCTGCAAGCAAGGGCAGTGG - Intergenic
1019200987 6:170315029-170315051 CTGACTGCAAGCCAGGCCCTAGG - Intronic
1019445408 7:1068374-1068396 CAGGGAGCAGGACAGCCCCGGGG + Intronic
1020211924 7:6164195-6164217 CAGGCTGTCAGACAAGCCCCGGG - Exonic
1021023102 7:15628846-15628868 CAGGCTGCAAGAACAGCCCACGG - Intronic
1023773600 7:43583019-43583041 CAGGGTGCAGGGCAGGCGCGGGG + Intronic
1031604046 7:123748364-123748386 CAGGCTGGAGGACAGGCCTGCGG + Intronic
1032240308 7:130154463-130154485 CAGGAGGCGAGCCAGGCCCGAGG + Intergenic
1033288435 7:140061965-140061987 CAGGCTCCCAGAAATGCCCGGGG + Intronic
1035288872 7:157824530-157824552 AAGGCTGCCACACAGGCCCCCGG + Intronic
1037433012 8:18833546-18833568 AAGGCTCCAAGACAAGCCAGTGG + Intronic
1038611629 8:29064498-29064520 CAGGCTGAAAGACAAGCTCCGGG + Intronic
1043472599 8:80578057-80578079 CGGGCTGCGAGCCAGGCCCCCGG - Intergenic
1048160539 8:132016888-132016910 CAGCCAGCAAGACGGGCCCAAGG + Intergenic
1048820398 8:138375053-138375075 CAGGCTCCAAGACAGGATCTAGG + Intronic
1049988025 9:970343-970365 GAGAGTGCAAGACAGGCCCAAGG + Intergenic
1053513164 9:38706714-38706736 CAGGCTGGAGGACAGTCCCAGGG - Intergenic
1053514799 9:38721815-38721837 GAGGCTGCAAGAGCTGCCCGTGG + Intergenic
1054741430 9:68809931-68809953 CAGGCAGTAAGCTAGGCCCGGGG - Intronic
1056787861 9:89605552-89605574 CAGGCTGGGAGACAGGGGCGGGG + Intronic
1057142392 9:92735325-92735347 CAGGCTGCAGGACAGACGCTGGG + Intronic
1057269819 9:93644559-93644581 CACCCTGCAAGACAGGGCCGAGG - Intronic
1060524430 9:124312452-124312474 CAGGCTGCAGCAGAGGCCTGGGG - Intronic
1061001332 9:127904627-127904649 CAGGCTGCAAGCCAGGCCTGGGG + Intronic
1061033784 9:128102351-128102373 CATGCTGCAAGACAGAGGCGAGG - Exonic
1061890611 9:133617213-133617235 CAGGCAGCATGGCAGGCACGGGG + Intergenic
1062465035 9:136677208-136677230 CAGGGTGCCAGGCAGGCCTGTGG - Intronic
1062601622 9:137320966-137320988 AAGGCTGCAGGAGAGGCCCCTGG + Intronic
1203489229 Un_GL000224v1:87610-87632 CAGTCAGCAGGACAGGCCAGGGG - Intergenic
1203501850 Un_KI270741v1:29505-29527 CAGTCAGCAGGACAGGCCAGGGG - Intergenic
1187173035 X:16870172-16870194 CAGGCAGCAAGACGGGGCCCGGG - Intronic
1187399855 X:18950109-18950131 CAGGCTGCCACAGAGGCCAGCGG + Intronic
1191913072 X:66172481-66172503 CAGCCTGCAACACTGGCCCCAGG - Exonic
1200124306 X:153806037-153806059 CAGGCTGCAGGCCTGGCCCAAGG - Intronic