ID: 1132749020

View in Genome Browser
Species Human (GRCh38)
Location 16:1448841-1448863
Sequence GGTTTCTGGGGGCGGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132749020_1132749031 0 Left 1132749020 16:1448841-1448863 CCCAGAGGCCGCCCCCAGAAACC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1132749031 16:1448864-1448886 CTGAGCCTACCCCCCGGGACCGG 0: 1
1: 0
2: 0
3: 3
4: 96
1132749020_1132749043 21 Left 1132749020 16:1448841-1448863 CCCAGAGGCCGCCCCCAGAAACC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1132749043 16:1448885-1448907 GGCTGTTTGGAGGCTCACAGGGG 0: 1
1: 0
2: 3
3: 16
4: 232
1132749020_1132749037 11 Left 1132749020 16:1448841-1448863 CCCAGAGGCCGCCCCCAGAAACC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1132749037 16:1448875-1448897 CCCCGGGACCGGCTGTTTGGAGG 0: 1
1: 0
2: 0
3: 13
4: 86
1132749020_1132749028 -5 Left 1132749020 16:1448841-1448863 CCCAGAGGCCGCCCCCAGAAACC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1132749028 16:1448859-1448881 AAACCCTGAGCCTACCCCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 145
1132749020_1132749041 19 Left 1132749020 16:1448841-1448863 CCCAGAGGCCGCCCCCAGAAACC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1132749041 16:1448883-1448905 CCGGCTGTTTGGAGGCTCACAGG 0: 1
1: 0
2: 1
3: 6
4: 99
1132749020_1132749033 8 Left 1132749020 16:1448841-1448863 CCCAGAGGCCGCCCCCAGAAACC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1132749033 16:1448872-1448894 ACCCCCCGGGACCGGCTGTTTGG 0: 1
1: 0
2: 0
3: 0
4: 60
1132749020_1132749042 20 Left 1132749020 16:1448841-1448863 CCCAGAGGCCGCCCCCAGAAACC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1132749042 16:1448884-1448906 CGGCTGTTTGGAGGCTCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1132749020_1132749027 -6 Left 1132749020 16:1448841-1448863 CCCAGAGGCCGCCCCCAGAAACC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1132749027 16:1448858-1448880 GAAACCCTGAGCCTACCCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132749020 Original CRISPR GGTTTCTGGGGGCGGCCTCT GGG (reversed) Intronic
900393607 1:2444196-2444218 GGGATCTGGGGGCCGCCCCTCGG + Intronic
900495461 1:2974089-2974111 GGATTCTGGGGGCCTCATCTGGG - Intergenic
900680457 1:3913451-3913473 GGTGTCTGGGTGAGGCCACTGGG + Intergenic
901617847 1:10556065-10556087 GGTTTCAGTGGCAGGCCTCTGGG - Intronic
902076238 1:13788959-13788981 GGTTTCTGAGTGCGCCCTCTAGG + Intronic
904620495 1:31772279-31772301 GGTGTCCGGGGGCCGCCTGTCGG + Intergenic
905503228 1:38455821-38455843 GGTTTCTGGGGGTTGTCCCTGGG - Intergenic
912246139 1:107964108-107964130 GGGCCCTGGGGGCGGCCTCCGGG + Intronic
914875947 1:151512783-151512805 GGAGTCTGGGGGCTGGCTCTGGG + Intronic
916425441 1:164675715-164675737 AGTGTCTGGGGGCGGGGTCTGGG - Intronic
924083122 1:240420194-240420216 GGCCTCTGGGTGGGGCCTCTGGG + Intronic
1063515993 10:6695986-6696008 GGTGTCTGAGGCAGGCCTCTAGG + Intergenic
1063853668 10:10222417-10222439 TGCTTCTGGGGGAGGCCTCAGGG + Intergenic
1064155068 10:12897087-12897109 AGTGTCTGGGGGGGGTCTCTGGG + Exonic
1069983014 10:72265520-72265542 GCTTCCTGGGGGCTGCTTCTGGG + Intergenic
1070311435 10:75276422-75276444 GGTTTTTTGGGTCGGCCCCTTGG + Intergenic
1070957619 10:80474544-80474566 GGATTCTGGGTGGGGCCCCTTGG + Intronic
1072921710 10:99582387-99582409 GGTTTCTGGGAAGGGCTTCTTGG + Intergenic
1076603089 10:131671781-131671803 AGTTTCTGGGAACTGCCTCTAGG - Intergenic
1077023787 11:430903-430925 GGTATCTGGGGGCGTCCGCGGGG + Intronic
1077023820 11:430983-431005 GGTATCTGGGGGCGTCCGCGGGG + Intronic
1077023918 11:431223-431245 GGTATCTGGGGGCGTCCGCGGGG + Intronic
1079327214 11:19504628-19504650 GATTTCTGGGGAAGGCCTCTAGG + Intronic
1079357071 11:19738556-19738578 GGATACTGGGGGCGGGGTCTGGG - Intronic
1081961070 11:47137924-47137946 GGTTTCTGTGGGGAGCCTCAGGG + Intronic
1083603463 11:63962660-63962682 TGGGTCTGGGGGCCGCCTCTGGG + Intergenic
1084213779 11:67635819-67635841 GGTTTCTGGAGGCAGGCTCTGGG - Intronic
1084412137 11:69011289-69011311 GGGTCCTGGGAGCGGCCCCTGGG - Intronic
1091708077 12:2713626-2713648 GGCTTCTAGGAGTGGCCTCTGGG - Intergenic
1092403022 12:8193879-8193901 GGTTTCTGGGAGCTGCCAGTGGG + Intergenic
1092409535 12:8243073-8243095 GCGTCCTGGGGGCGGACTCTAGG + Intergenic
1092955034 12:13541893-13541915 TGTCTCTGGGGGCAGACTCTAGG + Exonic
1094693425 12:32792774-32792796 GGCTTCTGGATGCGGCCTGTGGG + Intronic
1097876249 12:64646842-64646864 GGTTACTGAGGGCCTCCTCTGGG + Intronic
1097891556 12:64781643-64781665 CGATTCTGGCGGCGCCCTCTAGG - Intronic
1098081793 12:66794267-66794289 GGTTTCTGTGGGTGGCTTATGGG + Intronic
1099203920 12:79706813-79706835 GGTTTCTGGTGGGGGCCTCAGGG + Intergenic
1101371702 12:104137537-104137559 GCGCTCTGGGGGCGGCCTCCTGG - Intronic
1102231423 12:111265164-111265186 AGTTCCTGGGAGGGGCCTCTGGG + Intronic
1102991077 12:117316728-117316750 GGCTTATGTGGGGGGCCTCTGGG + Intronic
1103919661 12:124392881-124392903 GAGTCCTGGGGGAGGCCTCTGGG + Intronic
1103956095 12:124577730-124577752 GGTGGCTGGGGAAGGCCTCTTGG + Intergenic
1104842418 12:131831436-131831458 GGCTTCTGCCGGTGGCCTCTGGG + Intronic
1122291214 14:100681403-100681425 TGATTCTGGGGTGGGCCTCTGGG + Intergenic
1122530404 14:102421529-102421551 GGGCCCTGGGGGTGGCCTCTAGG + Intronic
1123024678 14:105419230-105419252 GGTCTTTGGAGGTGGCCTCTGGG + Intronic
1202834422 14_GL000009v2_random:67302-67324 GGTTTCTGGGGCCAGCCCCATGG + Intergenic
1127062049 15:55196744-55196766 GGTTCCTGGGCGCGGCGGCTCGG - Intronic
1130516717 15:84631387-84631409 GTCTTCGGGCGGCGGCCTCTGGG + Intergenic
1131166466 15:90145459-90145481 GGCCTCTGTGGGCAGCCTCTTGG + Intergenic
1131357279 15:91756989-91757011 GGTTTCTGGGAACTGACTCTGGG + Intergenic
1131479650 15:92769898-92769920 GGTTCCTGGGGGCCTACTCTTGG + Intronic
1132749020 16:1448841-1448863 GGTTTCTGGGGGCGGCCTCTGGG - Intronic
1133312542 16:4859409-4859431 CGTTTCTGGAGGTGGCCTCAGGG + Intronic
1133398423 16:5466527-5466549 GGTTTCTGTGTGTGCCCTCTGGG + Intergenic
1135608428 16:23843307-23843329 GGTCTCTGGGGTCTGCTTCTGGG - Intronic
1136016168 16:27402539-27402561 GGCTTCTGGGGGTGGCAGCTGGG - Exonic
1136413512 16:30090713-30090735 TGTTTCTGGTGGGGGTCTCTTGG - Intronic
1137768048 16:50992902-50992924 GGATTCTGGGGCGGGCCTGTGGG - Intergenic
1138347906 16:56331276-56331298 GGTTTCTGGGACCTGCCTCTAGG - Intronic
1138457188 16:57127944-57127966 GGTTTGTGTGTGTGGCCTCTCGG + Intronic
1139080017 16:63506124-63506146 GGTTTCATGGGTTGGCCTCTTGG - Intergenic
1142597411 17:1036292-1036314 GGACTCTCTGGGCGGCCTCTTGG - Intronic
1142694812 17:1627963-1627985 GGCTGCTGGGGGCGGCCGCAGGG - Intronic
1143519573 17:7437726-7437748 GGTTTCTGGAAGCTGCCCCTGGG - Intergenic
1145781332 17:27565909-27565931 GGTTTCTGGTGTAGACCTCTAGG + Intronic
1147214808 17:38892871-38892893 GGGTTCCCGGGGGGGCCTCTTGG + Intronic
1151681215 17:75623871-75623893 GGCTTCTGGGGGTGGCTTCTGGG + Intergenic
1152648848 17:81482730-81482752 AGGATCTGGGGGAGGCCTCTGGG - Intergenic
1154156368 18:11947590-11947612 AGAATCTGGGGGCGGCCTCCCGG - Intergenic
1160204603 18:76822611-76822633 GGCTTCGGGGGGCGGCCCCGCGG - Intronic
1160438922 18:78874080-78874102 GGTTGCTGTGGGCAGCCTCGTGG + Intergenic
1165060662 19:33203817-33203839 GGTTTCTGGAGGGGGCCTTGGGG + Intronic
1166784355 19:45358701-45358723 GGTGGCTGGGGAGGGCCTCTCGG - Intronic
1167775316 19:51550807-51550829 GGTGTCTGTGGGCCCCCTCTGGG + Intergenic
1167853668 19:52220989-52221011 GGTTGCTGGTGGCTGCCTCGCGG - Exonic
1168332274 19:55577774-55577796 GGGTTCTGGGGGCGGGCGATGGG + Exonic
1202638261 1_KI270706v1_random:60390-60412 GGTTTCTGGGGCCAGCCCCATGG - Intergenic
925038636 2:712485-712507 GTTTTCTGCGGGCGTCATCTAGG + Intergenic
925367483 2:3320432-3320454 AGTTGCTGGGGGCTGCCTCTGGG - Intronic
926089787 2:10042793-10042815 GGTTTCAGCGGGCGCCTTCTGGG + Intergenic
928694217 2:33832772-33832794 GGTTTCTGGGGTGTGCCTCTTGG + Intergenic
932659030 2:73636307-73636329 GGTTCCTGGGGGCTCACTCTTGG + Intergenic
943690979 2:190869270-190869292 GGTTTCTGGGGATGGGCTCAGGG - Intergenic
944005745 2:194903206-194903228 GGTGTTTGGAGGTGGCCTCTAGG + Intergenic
945654373 2:212605358-212605380 GCATTCTGCTGGCGGCCTCTGGG + Intergenic
947601423 2:231453077-231453099 GGTTTCTTTGGGAGGCCTGTGGG - Exonic
947919594 2:233857563-233857585 GGTTTCTGGGTGCAGCATCTTGG + Intergenic
948929426 2:241122628-241122650 GGTTTTTGGAGGAGTCCTCTAGG - Intronic
1169328723 20:4699383-4699405 GGTGGCTGGGGGCAGCCTCATGG + Exonic
1169328731 20:4699407-4699429 GGTGGCTGGGGGCAGCCTCATGG + Exonic
1172133135 20:32669228-32669250 GTTAACTGGGGGCGGACTCTAGG + Intergenic
1172976229 20:38907986-38908008 GGTGCCTGGGTGCAGCCTCTAGG + Intronic
1173579227 20:44135183-44135205 ATTTTCTGGGGGTGGCCTCTGGG - Intronic
1175099673 20:56570109-56570131 GGTTTCTGGAGGCTCACTCTTGG - Intergenic
1175948947 20:62572195-62572217 GATTGCTGGTGGCGCCCTCTTGG + Intergenic
1176120697 20:63453282-63453304 GGGTCCTGGCGGAGGCCTCTGGG - Intronic
1177894583 21:26844601-26844623 GGTTTCCGGAAGCGGCGTCTCGG + Exonic
1184513259 22:44945389-44945411 GATTTCTAGGGGCGGCTGCTTGG - Intronic
1184753015 22:46499955-46499977 GGGTGGTGGGGGCGGCCGCTGGG - Intronic
950870109 3:16220833-16220855 GGTTCCTGGGGGCAGGCTGTGGG + Intronic
953719872 3:45346080-45346102 GGTCTCTGGGAGGAGCCTCTGGG + Intergenic
954108631 3:48422281-48422303 GGCTGCTGGGAGGGGCCTCTGGG - Intronic
954407896 3:50355641-50355663 GGATTCTGGGGGAGGAGTCTAGG - Intronic
956732533 3:72209850-72209872 AGTTTCTGGGGGTGGCGTCTGGG - Intergenic
959100405 3:102003152-102003174 GGTTACTGAGGGCTGCCGCTTGG + Intergenic
960971946 3:123146011-123146033 GGGTTGTGGGGGCAGCGTCTGGG + Intronic
962172631 3:133118202-133118224 GGTTTCTGGGGCCCTCCTTTGGG + Intronic
967796160 3:193601209-193601231 GGTTCCTGGGGGCTCACTCTTGG - Intronic
969245689 4:5931268-5931290 AGTGTTTGGGGGCCGCCTCTTGG - Intronic
969756411 4:9153145-9153167 GCGTCCTGGGGGCGGACTCTAGG - Intergenic
969762999 4:9203791-9203813 GGTTTCTGGGAGCTGCCAGTGGG - Intergenic
973713961 4:53656649-53656671 AGTTTCTGGGGGCCAGCTCTGGG + Intronic
978910508 4:114057393-114057415 TGTTTCTGAGGGTGGCCTCTTGG - Intergenic
981154188 4:141414447-141414469 GGTGCCTGAGGGGGGCCTCTGGG + Intergenic
983037411 4:162885008-162885030 GGTTTCTGGTGAGGGCTTCTGGG + Intergenic
1202765600 4_GL000008v2_random:146248-146270 GGTTTCTGGGGCCAGCCCCATGG - Intergenic
987050852 5:14145046-14145068 GGGTGCTGGTGGCGGCCTCGGGG + Intronic
992143312 5:73820663-73820685 CGTTTCTGGGGGAAGCATCTAGG - Intronic
992195103 5:74331247-74331269 GGTTTCTGCTGAAGGCCTCTGGG - Intergenic
995560801 5:113379125-113379147 CATTTCTGGGAGTGGCCTCTGGG + Intronic
997383813 5:133456869-133456891 GGTTTCCTGGGGCATCCTCTGGG - Intronic
999179171 5:149656808-149656830 GGTCTCAGGGGACTGCCTCTAGG - Intergenic
1001073587 5:168607305-168607327 GGATTCTGGGGGATGCCTCAAGG - Intergenic
1002442834 5:179273233-179273255 GGCGGCGGGGGGCGGCCTCTGGG - Intronic
1002825124 6:765478-765500 GGTTTCTGGGGGCACCTTTTGGG - Intergenic
1003130441 6:3390866-3390888 GATCTCTGGGTGCGGCTTCTGGG - Intronic
1011400325 6:86954368-86954390 GATTTGTGGGGCAGGCCTCTAGG - Intronic
1019408125 7:894543-894565 GGTGTCTGGGGGGGGCATCCGGG - Intronic
1020414106 7:7926014-7926036 GGCTTCTGAGGGGGGCCTCAGGG - Intronic
1021609507 7:22443931-22443953 AGTTTATGGGGACAGCCTCTTGG - Intronic
1026922724 7:74168279-74168301 GGTTTTTGGGGGAGGCTTCCAGG - Intergenic
1026950088 7:74341022-74341044 GGTTTCTGGGAGGAGCCTTTGGG + Intronic
1029414919 7:100436472-100436494 GGTTTCCGGTAGCGGCGTCTAGG - Exonic
1029478632 7:100800020-100800042 GGTTACTGAGGGCGGGGTCTGGG + Intergenic
1030133417 7:106222293-106222315 TGCTTCTTGGGGCTGCCTCTTGG - Intergenic
1032083688 7:128872799-128872821 GGGTACTGGGGGCGGCCACCCGG - Intronic
1035567393 8:650546-650568 AGTGTCTGGGGCCGGCCTCGGGG - Intronic
1036273143 8:7325717-7325739 GGTTTCTGGGAGCTGCCAGTGGG - Intergenic
1036348205 8:7984631-7984653 GGTTTCTGGGAGCTGCCAGTGGG + Intergenic
1036379651 8:8228454-8228476 GCGTCCTGGGGGCGGACTCTAGG - Intergenic
1036843485 8:12145099-12145121 GGTTTCTGGGAGCTGCCAGTGGG + Intergenic
1036849919 8:12194200-12194222 GCGTCCTGGGGGCGGACTCTAGG + Intergenic
1036864856 8:12387418-12387440 GGTTTCTGGGAGCTGCCAGTGGG + Intergenic
1036871283 8:12436473-12436495 GCGTCCTGGGGGCGGACTCTAGG + Intergenic
1044636420 8:94329339-94329361 GGTATCTGGGGGCTCACTCTTGG + Intergenic
1048572164 8:135665210-135665232 AGTGTCTGGGGTCAGCCTCTCGG - Intergenic
1049462124 8:142735095-142735117 GGGTTCTGGGGATGGCCCCTAGG + Intronic
1052388968 9:27855992-27856014 GGTTACTAGGGGAAGCCTCTGGG + Intergenic
1055454349 9:76459153-76459175 GGCCTCTGGGGGCGGCCCCGGGG + Intronic
1056311635 9:85347132-85347154 GGTTGCTGGGAGCAGCATCTCGG + Intergenic
1057040249 9:91842761-91842783 GGTGGCTGGAGGTGGCCTCTGGG - Intronic
1057040495 9:91844303-91844325 GGTTCCTGGGGGCCTCCTCTGGG + Intronic
1057470391 9:95351167-95351189 GGTTTCTGCAGGCCGCCTCCCGG + Intergenic
1057880657 9:98790494-98790516 GGCTTCTCGGGGCGGCCACCTGG - Exonic
1060872035 9:127050428-127050450 GGATTCCAGGGGCAGCCTCTGGG - Intronic
1061029061 9:128068640-128068662 GGTCTCGGGGGACGGCCCCTTGG + Intronic
1061465553 9:130776619-130776641 GGTCTTTGGGGGCTGCCTGTTGG + Intronic
1061630012 9:131866413-131866435 GGTTTCTGGCTCAGGCCTCTGGG - Intronic
1061850660 9:133413033-133413055 GGTGTCTGGGGCCAGCCTGTGGG - Intronic
1061907835 9:133707956-133707978 GGGTCCTGGGGGCGGGGTCTTGG - Intronic
1062172829 9:135144922-135144944 TGTCTCTGGGGCCCGCCTCTGGG - Intergenic
1062550039 9:137081934-137081956 GGGTGCTGGGGGAGGGCTCTGGG + Intronic
1203546345 Un_KI270743v1:131138-131160 GGTTTCTGGGGCCAGCCCCATGG - Intergenic
1187318571 X:18220582-18220604 CGTGTCGGGGGGCGGCCTCTGGG - Intronic
1187446308 X:19364216-19364238 GGTTTCAGGAGGCGGTCCCTTGG - Intronic
1189916524 X:45861024-45861046 ACTTTCTGGGGGCGGAGTCTCGG - Intergenic
1193062367 X:77220266-77220288 GGTTTGTGGGGGATACCTCTTGG - Intergenic
1199512558 X:148638620-148638642 GGCTTCTGGGGGAGGCCTCAGGG + Intronic
1200093757 X:153647782-153647804 GGTTTCTTGGGGCGCCTTGTTGG + Intronic