ID: 1132750687

View in Genome Browser
Species Human (GRCh38)
Location 16:1456057-1456079
Sequence TCCTTCCAACACACAGGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132750680_1132750687 14 Left 1132750680 16:1456020-1456042 CCCTCAGCGGGCACTGGGCCTAC 0: 1
1: 0
2: 0
3: 14
4: 90
Right 1132750687 16:1456057-1456079 TCCTTCCAACACACAGGGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132750679_1132750687 17 Left 1132750679 16:1456017-1456039 CCACCCTCAGCGGGCACTGGGCC 0: 1
1: 0
2: 0
3: 17
4: 215
Right 1132750687 16:1456057-1456079 TCCTTCCAACACACAGGGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132750676_1132750687 23 Left 1132750676 16:1456011-1456033 CCTCTGCCACCCTCAGCGGGCAC 0: 1
1: 0
2: 3
3: 21
4: 263
Right 1132750687 16:1456057-1456079 TCCTTCCAACACACAGGGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132750681_1132750687 13 Left 1132750681 16:1456021-1456043 CCTCAGCGGGCACTGGGCCTACA 0: 1
1: 0
2: 1
3: 17
4: 143
Right 1132750687 16:1456057-1456079 TCCTTCCAACACACAGGGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132750673_1132750687 28 Left 1132750673 16:1456006-1456028 CCAAGCCTCTGCCACCCTCAGCG 0: 1
1: 0
2: 8
3: 46
4: 449
Right 1132750687 16:1456057-1456079 TCCTTCCAACACACAGGGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 131
1132750683_1132750687 -4 Left 1132750683 16:1456038-1456060 CCTACAGAGAGGAGACCGTTCCT 0: 1
1: 0
2: 0
3: 3
4: 90
Right 1132750687 16:1456057-1456079 TCCTTCCAACACACAGGGCGAGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132750687 Original CRISPR TCCTTCCAACACACAGGGCG AGG Intronic
903761243 1:25700303-25700325 TCCTTCTAGCACGCAGGGCATGG + Intronic
905293445 1:36939157-36939179 TCCTTCCACCACACAACGCATGG + Intronic
905655697 1:39684680-39684702 CCCCTGCCACACACAGGGCGGGG + Intronic
912516383 1:110219044-110219066 TCTTTCCACCACAAAGGGCATGG - Intronic
913008650 1:114660548-114660570 ACCTTCCAACACTCAAGGGGAGG - Intronic
917600718 1:176571051-176571073 CCCCTCCAACACCCAGGGCAGGG + Intronic
917627150 1:176857866-176857888 TCCTTCCAAACCACAGGGACAGG + Intronic
924741946 1:246799354-246799376 TCCTTTTGTCACACAGGGCGTGG - Intergenic
1062804595 10:408177-408199 CCTTTCCAACACACAGTGCTGGG - Intronic
1065023221 10:21517422-21517444 TCCTTCCAAAATCCCGGGCGGGG + Exonic
1066651624 10:37661440-37661462 TCCTTCCACAACACTGGGCATGG + Intergenic
1067035409 10:42911868-42911890 TCCTTCCACAACACTGGGCATGG + Intergenic
1067564430 10:47326474-47326496 TGCTTGTCACACACAGGGCGTGG + Intergenic
1067718393 10:48707477-48707499 TCAGTCCAGCACACAGGGCTGGG - Intronic
1069871392 10:71535328-71535350 TGATTCCCTCACACAGGGCGTGG + Intronic
1070767829 10:79066897-79066919 TCCTTCCACCACCGAGGGAGAGG - Intergenic
1075092748 10:119452671-119452693 TCCTTACAGTACACAGCGCGGGG - Exonic
1075535955 10:123272359-123272381 TCCTTCCATCACACAGCTAGAGG - Intergenic
1075540109 10:123305419-123305441 GCCTTCCATTACACAGGGTGAGG + Intergenic
1076245042 10:128940456-128940478 TCCTTCCAACACAGGAGGCAGGG + Intergenic
1077101805 11:825796-825818 TCCTGCCAGTACACAGGGCAGGG + Intergenic
1077472204 11:2769377-2769399 TCCTCCCAACTCACAGAGGGTGG - Intronic
1088716421 11:112553625-112553647 TCCTTCCAACTCAGAGGCTGTGG + Intergenic
1088909840 11:114182533-114182555 TCCTTCCTACACACGGGGGCTGG - Intronic
1090406267 11:126477353-126477375 TCCCTCCCACACACAGGGAAAGG - Intronic
1091936684 12:4440433-4440455 TCCATCCAACACACACTGCCAGG - Intronic
1094449713 12:30571873-30571895 TCCTTCCAAAACATGGGGAGGGG - Intergenic
1094504710 12:31051884-31051906 GCCTACGAACACACAGGGCAAGG - Intergenic
1094854470 12:34396809-34396831 TCCTTCCACAACACAGTGCCTGG - Intergenic
1096102402 12:48978011-48978033 TCCTTCCGACACTCAGGATGGGG + Intergenic
1097144834 12:56933027-56933049 CACTTCCAGCACACAGGGTGTGG - Intronic
1104967296 12:132514024-132514046 TGTTTCCAACACGCAGGGCAGGG - Intronic
1111268707 13:85853283-85853305 TCCTGCCAACTCATAGGGGGTGG - Intergenic
1112339246 13:98538805-98538827 TCCTTCCCACACTCAGGCCCTGG + Intronic
1114552809 14:23543629-23543651 CCCTTCCTTCACACAGGGCATGG - Intronic
1119537441 14:75413939-75413961 TCCTTCCCCCACACAGTGCCTGG - Intergenic
1122812918 14:104297860-104297882 TCCTGCCACCCCACAGGGCTGGG + Intergenic
1122891721 14:104735135-104735157 TCCTGCTCACACACAGGTCGGGG - Intronic
1124367794 15:29085969-29085991 TCCATCCCCCACACAGGGGGAGG - Intronic
1127635800 15:60868630-60868652 TCCTTCCACCCCAAAGTGCGTGG + Intronic
1131680254 15:94714191-94714213 TGCTTCCAAACCACAGGGCTAGG + Intergenic
1131711610 15:95062005-95062027 TCCTACCAACACCCAGGGTTAGG - Intergenic
1132750687 16:1456057-1456079 TCCTTCCAACACACAGGGCGAGG + Intronic
1132899477 16:2245348-2245370 TCCTTCCTGCAGACAGGGCGGGG - Intronic
1133450047 16:5896349-5896371 TCCTCCCACCCCACAGGGAGGGG - Intergenic
1136475936 16:30513406-30513428 TCCTTCCAACACACACTGCTGGG - Intronic
1137432819 16:48432389-48432411 TCCTTCCAACACTCTGGCCTGGG + Intronic
1140297821 16:73726216-73726238 TCCTTCCAACACAGTGGGGCTGG + Intergenic
1140838512 16:78817774-78817796 TCCATCCAAGACAGAGGGTGAGG - Intronic
1140896349 16:79328047-79328069 TCCTTACAACTCACAGGGTTGGG - Intergenic
1140939453 16:79707955-79707977 TCCGTCCGACACACAGGGACAGG - Intergenic
1141033779 16:80611163-80611185 TCCTTCCAAGACAGAGAGCTGGG + Intronic
1142904927 17:3035057-3035079 TCATTCCCACACACGTGGCGGGG - Exonic
1143280318 17:5749158-5749180 GGCTTCCAACTCACAGGCCGTGG - Intergenic
1144018571 17:11220416-11220438 GCCTCCCAGCACACAGGGCCAGG - Intergenic
1145828473 17:27895716-27895738 TCCTGCCAGAACACAGGGTGAGG + Intergenic
1146625376 17:34431294-34431316 TCCTTCCACCACAAAGGAAGAGG - Intergenic
1147760190 17:42793130-42793152 TCCTTACACCACACAGTGCCTGG + Intronic
1148442370 17:47718013-47718035 TCCTCCCAACACACACAGCCAGG + Intergenic
1148451600 17:47781560-47781582 TCCTTCCAACCCCTAGGGTGAGG + Intergenic
1150209786 17:63435660-63435682 TCCTTCCAACACCCCGGGCCTGG - Intronic
1157113705 18:44843895-44843917 TCCTCCCAACAGACAGAGAGAGG + Intronic
1157906878 18:51577118-51577140 TTCTGCCAAGACACAGGGCCAGG - Intergenic
1160387092 18:78503369-78503391 TCCCTCCCACATACAGGGCTCGG + Intergenic
1160462046 18:79046716-79046738 TCCCTCCAGCTCACAGGGCAAGG - Intergenic
1160698476 19:495615-495637 TCCTTCCATCACACGGGCAGAGG - Intronic
1161118844 19:2513906-2513928 TGCTTAAAACACACTGGGCGCGG + Exonic
1161488318 19:4547855-4547877 TTCTTCCAACACACCAGGAGTGG + Intronic
1161684793 19:5697448-5697470 TTCTTCTAACACACCAGGCGTGG - Intronic
1163447182 19:17353539-17353561 TCCCTCAAACACACAAGGCACGG + Intronic
1167703998 19:51067652-51067674 TTCTCCCACCTCACAGGGCGGGG + Intergenic
1167864788 19:52315764-52315786 TCCTTCCTACACATAGGGCTTGG + Intronic
925060954 2:889666-889688 TCCTTCCAGCAAGCAGGGTGTGG - Intergenic
926702126 2:15810775-15810797 TCCTCCCTCCACACAGGGCCCGG + Intergenic
926927097 2:17997874-17997896 GCCTTCCAAGAAACAGGGCTAGG - Intronic
932084504 2:68746395-68746417 TCCTTCCTCCTCACAGGGCAAGG + Intronic
933773078 2:85755839-85755861 TCCCACCCCCACACAGGGCGTGG + Intronic
934563860 2:95327773-95327795 TCCGTCCAACACACAGCATGAGG + Intronic
936383420 2:112007704-112007726 TGCATCCAACTCACAAGGCGTGG + Intronic
937750581 2:125472248-125472270 TGCTTCCAGCACACAGGTGGCGG - Intergenic
938541822 2:132289302-132289324 TCCTTGCAACACACAGACCCCGG + Intergenic
938660969 2:133487022-133487044 TCTTTCAAAGACACAGGGCTGGG - Intronic
942059483 2:172215172-172215194 TCCTTCAAACACTCCGGGCTGGG - Intergenic
943747524 2:191477795-191477817 TCCTTACAGCACACCGGGCTGGG - Intergenic
945751554 2:213792333-213792355 TCCTTTCAACACACTGAGGGAGG - Intronic
1176121817 20:63457521-63457543 TCCTTCCAACATCCTGGGCAGGG + Intronic
1177013501 21:15756277-15756299 CCCTTCCAAAGCACAGGGAGAGG - Intronic
1181064014 22:20297164-20297186 TACTCCCAACATACAGGGCCTGG + Intergenic
1183293927 22:37019134-37019156 TCCTTCCAAGGCAGAGGGGGTGG + Exonic
1184121426 22:42452914-42452936 TCCAGCCCACACACAGGGCCAGG - Intergenic
1184341320 22:43887650-43887672 ACCTGCCAACACACAGGGCAAGG + Exonic
1184354418 22:43969452-43969474 TCATAGCAGCACACAGGGCGTGG + Intronic
950716379 3:14850515-14850537 TCCTCCCATCACCCAGGGGGAGG - Intronic
950967725 3:17157548-17157570 TCCTCCAGACACACAGGGCAGGG + Intronic
955517235 3:59738397-59738419 TCTTGCCAACACCCATGGCGAGG + Intergenic
957058441 3:75462112-75462134 TCCTACCATCAGACAGGGCTAGG + Intergenic
964495950 3:157289942-157289964 TCCTTCCCATACACAGGGAATGG - Intronic
972530036 4:39953438-39953460 TCATTCCAACACACTGGGAGTGG + Intronic
982982312 4:162155071-162155093 TCCTGCCTACACACAAGGTGAGG - Intronic
983146212 4:164217856-164217878 CCCTTCTTACACTCAGGGCGAGG - Intronic
985543969 5:500105-500127 CCCTTTCAACCCACAGGGCCGGG - Intronic
986336613 5:6760157-6760179 CCATTTCAACACACAGGGCCTGG - Intergenic
987777894 5:22393171-22393193 TCCTTCCAAGACAAAGGTAGAGG + Intronic
988551859 5:32207456-32207478 TGCTTCCAACAAACAGGACATGG - Intergenic
993844428 5:92922846-92922868 TCCTTCCTAACCACAGGGAGAGG - Intergenic
1000223121 5:159233396-159233418 TCCTTCCAACACATATGCCATGG - Intergenic
1001063933 5:168520275-168520297 TCCCTCCAACAAACATGGGGAGG + Intergenic
1001204334 5:169747965-169747987 TCCTTCCCAAACACAGGGATAGG - Intronic
1005581023 6:27235303-27235325 TCCTTCAGAAGCACAGGGCGGGG - Intergenic
1006515285 6:34542063-34542085 TCCTCCCCACCCACAGGGCTAGG - Intronic
1015981748 6:138846393-138846415 TCCTCACAAAACACAGGGTGAGG + Intronic
1018432984 6:163737435-163737457 TCCTTCCAAGACAAAGGCCTCGG - Intergenic
1019025963 6:168963137-168963159 TCATTCCAACCCAGAGGGCCAGG + Intergenic
1019671769 7:2283723-2283745 TCCTTCAAACACAGAGGGCTGGG + Intronic
1021711087 7:23415774-23415796 GCCTTCCAACCCTCAGGCCGTGG + Intronic
1022536271 7:31100579-31100601 ACCTTCCCCCACACAGGGCAGGG + Intronic
1023519632 7:41037681-41037703 TCCTTCCAACATGCAGACCGTGG + Intergenic
1023974498 7:45018116-45018138 TCCCTCCAACACACAGTTCAGGG + Intronic
1024250336 7:47501452-47501474 TCCTGCCAGCACACAGGCCACGG - Intronic
1027265934 7:76495298-76495320 TCCTTCTGACACCCAGGGCCAGG - Intronic
1027317308 7:76993415-76993437 TCCTTCTGACACCCAGGGCCAGG - Intergenic
1029125865 7:98294961-98294983 TCCTGCCTGCACACAGGGAGTGG + Intronic
1029176771 7:98670138-98670160 TCCTTCCAGCAGACAGCTCGTGG - Intergenic
1031887567 7:127257166-127257188 TCCTTGCAACACACATAGAGAGG - Intergenic
1033527626 7:142232109-142232131 TTCTTCCAATACACTGGGCAAGG - Intergenic
1041252498 8:55947852-55947874 TCCTTGCTACCCACAGGGAGTGG + Intronic
1044560379 8:93606544-93606566 TCCTTCCAACAGAGATGGGGCGG + Intergenic
1047013176 8:120693868-120693890 TCCTTTCTTCACATAGGGCGTGG + Exonic
1052363758 9:27588746-27588768 TCCATCCATCACACAGGGACTGG - Intergenic
1056703123 9:88927130-88927152 TCCTTCCCACACTCAAGGGGAGG - Intergenic
1057709916 9:97430515-97430537 ACCTTCCAAGTCACATGGCGAGG - Intronic
1057747536 9:97763992-97764014 GCCTCCCAACACACAGGAGGAGG + Intergenic
1060481919 9:124021368-124021390 TCCTTCCAAGGCCCACGGCGAGG - Intronic
1192049722 X:67713215-67713237 TATTTCCAACTCACAGGGCCTGG + Intronic
1192366794 X:70480471-70480493 TGCTTTCAACACACAAGGGGTGG - Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1193251763 X:79299119-79299141 TCCTACCAACACTCAGGGATAGG - Intergenic
1193492278 X:82164792-82164814 TCCCTCCAACACACATGGCTTGG - Intergenic
1199099160 X:143778951-143778973 TCCCTCCAAGACCCAGGGAGGGG + Intergenic
1201620786 Y:15954915-15954937 TTCTTGCAACACACATGGCTGGG - Intergenic