ID: 1132752693

View in Genome Browser
Species Human (GRCh38)
Location 16:1466088-1466110
Sequence CTGGGGACATGAAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 609}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132752687_1132752693 -4 Left 1132752687 16:1466069-1466091 CCTGAATCTTTAGCAACATCTGG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG 0: 1
1: 0
2: 5
3: 59
4: 609
1132752686_1132752693 5 Left 1132752686 16:1466060-1466082 CCACTATCTCCTGAATCTTTAGC 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG 0: 1
1: 0
2: 5
3: 59
4: 609
1132752684_1132752693 27 Left 1132752684 16:1466038-1466060 CCTTTGGAGACGACTCCAATTTC 0: 1
1: 0
2: 0
3: 1
4: 73
Right 1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG 0: 1
1: 0
2: 5
3: 59
4: 609
1132752685_1132752693 12 Left 1132752685 16:1466053-1466075 CCAATTTCCACTATCTCCTGAAT 0: 1
1: 0
2: 0
3: 22
4: 266
Right 1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG 0: 1
1: 0
2: 5
3: 59
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132752693 Original CRISPR CTGGGGACATGAAGGGAAGA AGG Intronic
900235631 1:1588721-1588743 CGGGGGAAGGGAAGGGAAGAAGG - Intergenic
900264039 1:1748309-1748331 CTGGGGAGAGGAAGAGAGGAAGG - Intergenic
900493362 1:2964364-2964386 ATGAGGACATGAAGGAAGGAAGG - Intergenic
900662056 1:3789680-3789702 CAGGGGACAGGAAGGGAAGCGGG + Intronic
900767773 1:4516784-4516806 CTGGGGACAAGGTGGGCAGAGGG + Intergenic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901216938 1:7560271-7560293 CAGGGGACCTGAAGGGCAGTGGG - Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902382748 1:16060277-16060299 GTGGGGGCATTAAGGGAAGGGGG - Intronic
902705951 1:18204578-18204600 GAGGGGAGATGAAGGGGAGAGGG + Intronic
903176591 1:21585228-21585250 GTGGGGACAGGAAGGGAACATGG + Intergenic
904340396 1:29830409-29830431 CTGGGGACATGGGGGCAGGATGG - Intergenic
904459267 1:30665933-30665955 CTGGGGACAGAAGGGAAAGAGGG - Intergenic
905037041 1:34925192-34925214 CTTGGGACATAGAGGGAAGGTGG - Intronic
905339179 1:37266570-37266592 CTTAGGACATGAGGGGAAGCTGG - Intergenic
906104987 1:43286244-43286266 GTGGGGACTTGCAGGGTAGAGGG - Intergenic
906140914 1:43532839-43532861 GTGTGGAAATGAAGGCAAGAGGG - Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906461522 1:46038093-46038115 AGGGGGACAAGAATGGAAGAAGG + Intergenic
906607459 1:47181934-47181956 CAGGAGACAGGAAAGGAAGAGGG + Intergenic
907071471 1:51539483-51539505 GTGGGGGCATAAAAGGAAGAGGG - Intergenic
907252136 1:53146574-53146596 CGGGGGACTGGAAGGGAAAAAGG - Intergenic
907603640 1:55794309-55794331 CTGGGGTCATGAATGGCAGTGGG + Intergenic
907680388 1:56557843-56557865 CCGGGGACTTGCAGAGAAGAAGG - Intronic
910821211 1:91349347-91349369 CTGGTCACATGAAGGCGAGAGGG - Intronic
910929184 1:92425684-92425706 CTGGGGAGATGAGGTGAGGATGG + Intergenic
911583236 1:99659509-99659531 CTGGGGAAATTTAGGGAAGCAGG + Intronic
911606453 1:99910967-99910989 ATGGGGAGATGAAGGGAAGAAGG - Intronic
912811746 1:112800346-112800368 CTGGGGAGAAGCAGTGAAGATGG - Intergenic
912859248 1:113198383-113198405 CTGTGAACATGAAGGGTATATGG - Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913152514 1:116058949-116058971 TTGGGGACTTGGAGGGAAGCGGG + Intronic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
913672849 1:121114554-121114576 CTGGGGAGAACAAGTGAAGAAGG + Intergenic
914024625 1:143901930-143901952 CTGGGGAGAACAAGTGAAGAAGG + Intergenic
914663111 1:149809950-149809972 CTGGGGAGAACAAGTGAAGAAGG + Intronic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
915543568 1:156583335-156583357 CAGGGGACATGAAGGGACAGTGG + Exonic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
916242920 1:162657820-162657842 GTGGGGAGGGGAAGGGAAGAAGG - Intronic
916849989 1:168693985-168694007 CTGGGCAGATGAGGGGAAGGGGG + Intergenic
916891686 1:169117804-169117826 CTGGGGAGATGAAGGGAACAGGG + Intronic
917967062 1:180185543-180185565 CTGGGGGCAGGAGGGGAAGCAGG - Intronic
918063410 1:181082095-181082117 CTGGGGACAATAAGGGGAGAGGG - Intergenic
918878532 1:190083802-190083824 CTGGGTACATGAGGGAGAGAAGG - Intergenic
919436433 1:197567983-197568005 CTGGGGAGATGAGGGGAGGGAGG + Intronic
919504362 1:198379556-198379578 CTGAGGATATAAAGTGAAGAAGG + Intergenic
919653509 1:200174696-200174718 CTGGGGCCTTCAAAGGAAGAGGG - Exonic
919793282 1:201305972-201305994 CTGGGGCCATGGAAGGGAGATGG + Intronic
919975190 1:202605790-202605812 CTGGGGACGAGAGGTGAAGAGGG + Intronic
920038842 1:203083275-203083297 CCGGGGACAGGCAGGGAAAAGGG - Exonic
920547336 1:206829381-206829403 GTGGGGAGAGGAAAGGAAGAGGG + Intronic
921132225 1:212229689-212229711 GTGGGGAGAGGAAGGGAGGAGGG - Intergenic
921902293 1:220463412-220463434 CTGGGGCCATGAATGGCAGCTGG + Intergenic
923039667 1:230310535-230310557 ATGGGGACAGGAATGGAAAAGGG - Intergenic
923094227 1:230761832-230761854 CTGGGAACAGGAAGGGAGGTTGG - Intronic
923211594 1:231808576-231808598 AAGGGGAAATGAAGGGGAGATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923552780 1:234977511-234977533 CTGAGGACATGGGGTGAAGATGG - Intergenic
924627744 1:245709871-245709893 CTGGGCACATTCAGGCAAGAAGG + Intergenic
924884930 1:248204395-248204417 TTGGGGACATGAGGGAAATACGG - Intergenic
1062973418 10:1665682-1665704 CTGAGGACATCAAGAGAAAAAGG + Intronic
1063213522 10:3903270-3903292 ACGGGGACTTGAAGGGAAGCAGG + Intergenic
1063610708 10:7559786-7559808 CTGGGGATACGATGAGAAGATGG - Exonic
1063908966 10:10810630-10810652 CAGGGGAGTGGAAGGGAAGATGG + Intergenic
1066489738 10:35883102-35883124 CAGGGCACCTGAAGGAAAGAAGG - Intergenic
1066556597 10:36621218-36621240 ATGAAGAAATGAAGGGAAGAAGG - Intergenic
1067563974 10:47323412-47323434 AAGGGGACAGGAAGGGAAGGGGG - Intronic
1067743498 10:48914716-48914738 CTGGGTCCATGAGGGGAAGAGGG - Intronic
1068543132 10:58318673-58318695 CTGGAGAGAGGAAAGGAAGAAGG - Intergenic
1069534336 10:69241837-69241859 CTGGGGACAAGAGTGGAAGCAGG + Intronic
1069954812 10:72043451-72043473 CTGGGGAAAGGAGGAGAAGAGGG + Intergenic
1070391099 10:75971211-75971233 ATGGGGAGAGAAAGGGAAGAAGG - Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070674366 10:78402140-78402162 CAGGGGACAGGAAGGGATGGTGG + Intergenic
1071341687 10:84654680-84654702 CTGGGGACATAGAGGGTAAAAGG - Intergenic
1071404575 10:85317811-85317833 CTGGGGAAGTCAAGGGAAGAGGG + Intergenic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072681269 10:97508681-97508703 GTGGGGAAATTAAAGGAAGAAGG - Intronic
1072764213 10:98082842-98082864 CAGGGGACATGGGGGGAAGCTGG + Intergenic
1072967676 10:99988393-99988415 CTGGGTACAGGAAAGGAAGAAGG + Intronic
1074015473 10:109529902-109529924 CTGGGGAAGTGCAGGGAACAGGG + Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074730348 10:116366270-116366292 CTGGGGTAATGAAGGGAGTATGG - Intronic
1075341850 10:121653183-121653205 TTGGGGACTAGAAGGGTAGAAGG + Intergenic
1075956048 10:126524235-126524257 ATGTGGTCATGAAGGGAGGAAGG - Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076079391 10:127565116-127565138 CTGGGGACAGGGAGGAAAGTCGG - Intergenic
1076364639 10:129914152-129914174 CAGGGGACATGACGGGCAGAGGG + Intronic
1077259334 11:1607434-1607456 GTGGGGTCAGGAAAGGAAGACGG + Intergenic
1077478699 11:2803035-2803057 GAGGTGACATGAAGGGAAGGTGG + Intronic
1077498090 11:2896428-2896450 CTGGAGGCAGGAAGGGACGATGG - Intronic
1077504611 11:2924278-2924300 CTGGGGACAGGAGGGGCAGGTGG + Intronic
1077895706 11:6451628-6451650 GTGAGAACATGAAGGGATGAAGG + Intronic
1077959078 11:7053932-7053954 GTGGGGGAATGAGGGGAAGAGGG - Intronic
1078144227 11:8712103-8712125 CTGGCGACAAGCAGGGAAGGCGG + Intronic
1078316541 11:10298020-10298042 ATGGGAGCAGGAAGGGAAGAAGG + Intergenic
1078545502 11:12244138-12244160 CTGGGAACATGCAGGGAATAGGG - Intronic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1079281747 11:19093522-19093544 CTGGGGACATGGAGTTAACAGGG - Intergenic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080867102 11:36204999-36205021 CTGGGAACCTGAGGGGAAGATGG - Intronic
1082745269 11:56954305-56954327 TAGGGGACAGAAAGGGAAGAGGG + Intergenic
1082824574 11:57568179-57568201 CTGGGCCCATGGAGGGAAGGCGG - Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083486174 11:62984276-62984298 CAGGGGCCAAGATGGGAAGATGG - Intronic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1083891486 11:65597982-65598004 CTGGGGTGATGCAGGGAGGAGGG - Exonic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1087250701 11:95896049-95896071 CTGGGGAGAGCAAGGGGAGAGGG - Intronic
1088693875 11:112349819-112349841 CTGGGGACAGGAAAGGAAGGGGG + Intergenic
1089359006 11:117874186-117874208 CTGGGGACATGAAGGTGAGGAGG - Intronic
1089383440 11:118052368-118052390 CTGGGGCCCTGCAGGGAAGCAGG + Intergenic
1089778591 11:120856989-120857011 CTGGGAACATGGAGGGATAAGGG - Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090096966 11:123751955-123751977 TTTGGGTCATGACGGGAAGAAGG - Intergenic
1090187305 11:124746874-124746896 GGGGCGAGATGAAGGGAAGAGGG + Exonic
1090449758 11:126796164-126796186 TAGAGGTCATGAAGGGAAGAAGG + Intronic
1090451237 11:126808186-126808208 CTGGGAGCATAAAGGAAAGAGGG + Intronic
1090900434 11:131026159-131026181 CTGGGGATAAGAGGGGAAAAGGG + Intergenic
1091167448 11:133492172-133492194 GAGTGGACAGGAAGGGAAGAGGG + Intronic
1091349702 11:134883093-134883115 CAGGGGATGTGAAGGGAAGTCGG + Intergenic
1091353032 11:134913037-134913059 CTTGTGACAGGAAGGGAAGCAGG + Intergenic
1091394018 12:142698-142720 CTGGGGAAGGGAAGGGAAGCCGG - Intronic
1091410547 12:236502-236524 CTGGAGGGAGGAAGGGAAGAGGG - Intronic
1091681821 12:2532890-2532912 CTGGGGGCATGACAGGAAGTGGG - Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1093030414 12:14283515-14283537 CTGGAGAAATGAAGGTAAGAGGG + Intergenic
1093059633 12:14589319-14589341 CTGGGGCCAAGAATGGCAGAAGG - Intergenic
1093121113 12:15272864-15272886 CTGGGGACATGGAGTGGGGAAGG - Intronic
1093757223 12:22866344-22866366 CTGGGGAAAGGAAGAGAATAGGG - Intergenic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1095952732 12:47790388-47790410 CGGGGGGCATGATGGGGAGATGG + Intronic
1096096378 12:48938330-48938352 TTGGTGAGATTAAGGGAAGAAGG - Exonic
1096522117 12:52190193-52190215 CTAGGCACATGAATGGAAGAAGG + Intronic
1097156438 12:57015639-57015661 CTGGGGACATCACGGGAACTTGG - Intronic
1097277239 12:57821838-57821860 CTTGGGACAAGAAGGGAAGGTGG + Exonic
1098067692 12:66636780-66636802 GTGAGGACATGAAGAGAAGGTGG + Intronic
1099504393 12:83454792-83454814 ATGGGGATATGATGAGAAGATGG + Intergenic
1099736600 12:86575126-86575148 CTGGTGACATGAATGAATGAGGG - Intronic
1100231527 12:92613262-92613284 CTGGGGACATGCAGTGAACAAGG - Intergenic
1100421830 12:94442352-94442374 CTGGGGACCTGGGGGGAAGGAGG + Intronic
1100435240 12:94565234-94565256 GTCAGGACATGAAGTGAAGAGGG + Intergenic
1100723167 12:97380224-97380246 CTGGGTATATGAAGGAAGGAAGG + Intergenic
1101100282 12:101384689-101384711 CTGGGGGCAGGAAGGAAAGGAGG + Intronic
1101452311 12:104790573-104790595 TTGGGGACACTAAGGGGAGAAGG - Intergenic
1102060376 12:109926717-109926739 CTGGGGCCATGAATGGCAGCAGG + Intronic
1102228712 12:111247674-111247696 CTGGGGGCAGGATGGGGAGAGGG + Intronic
1102491335 12:113291207-113291229 CTGGGGACATGCAGGGAGATGGG - Intronic
1102534357 12:113569780-113569802 CTGAGGACATGGAGTCAAGAGGG + Intergenic
1103194950 12:119035977-119035999 CAGGCCACATGAAGGGAAAAGGG + Intronic
1103483133 12:121264157-121264179 CTGGGGATGTGACGGGAAGGAGG - Intronic
1103919802 12:124393412-124393434 CTGGGGACATGATGGCCATAGGG - Intronic
1104177613 12:126348201-126348223 CTGGAGACTCGAAGGGAGGAAGG - Intergenic
1104378800 12:128288855-128288877 CTGGGGAAATCAAGGGAAGGAGG - Intronic
1104466373 12:128994073-128994095 AAGGGGGCAGGAAGGGAAGATGG - Intergenic
1104895070 12:132160009-132160031 CTGGGGAAACGAATGAAAGAAGG - Intergenic
1105053586 12:133077825-133077847 ATGGTGAACTGAAGGGAAGAAGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105614470 13:21999785-21999807 CTGGGTGCAGGAAGGCAAGAGGG + Intergenic
1105896821 13:24723703-24723725 CTGGAGTCATGAAGGGAGGCAGG - Intergenic
1106459654 13:29957800-29957822 TTGGGGAAATAACGGGAAGAGGG + Intergenic
1107205919 13:37788258-37788280 TTTGTGACATGAAGGGAAGAAGG - Intronic
1107795387 13:44046264-44046286 CTAGTGAAAGGAAGGGAAGAGGG + Intergenic
1107903814 13:45044065-45044087 ATGGGACCGTGAAGGGAAGATGG - Intergenic
1108459767 13:50653333-50653355 TTGGGGACAAGAAGTGGAGATGG + Intronic
1108555311 13:51585122-51585144 CTGAGGACAGGAGGGAAAGAGGG + Intronic
1108698937 13:52927279-52927301 AAGGGGACATGAATGGAAGGAGG - Intergenic
1109128535 13:58549821-58549843 CTGGGTACAGGAAGGGCTGAGGG - Intergenic
1109335931 13:60993736-60993758 CTGTGCACAGGAAGGGAAAAAGG - Intergenic
1109805090 13:67429263-67429285 TTCAGGCCATGAAGGGAAGAGGG + Intergenic
1110124870 13:71930201-71930223 ATGGGGACATGAATGGCAAAGGG - Intergenic
1110999963 13:82165683-82165705 CTGGGGCCATGAATGGCAGCGGG - Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112653036 13:101418979-101419001 CTGGGGACATGGAGGCAAATGGG - Intergenic
1112728360 13:102330744-102330766 ATGAGGCCATGAAGGGAGGAGGG - Intronic
1113139316 13:107129247-107129269 CTGGGGACAGAAAGCAAAGATGG + Intergenic
1113375613 13:109762699-109762721 CTGGGGACAGGGAGGTGAGAAGG - Intronic
1113439850 13:110319814-110319836 CTTGGGAGGAGAAGGGAAGAGGG - Intronic
1113741249 13:112713971-112713993 CTGGGGCCAGGAATGGAAGCTGG - Intronic
1113820208 13:113208469-113208491 CCGGGGACCCGAACGGAAGAAGG + Intronic
1115157844 14:30360566-30360588 GTGTGGAAATGAAGGGAAGGAGG + Intergenic
1115622154 14:35151535-35151557 ATGGGGATATGAAGGAAAGAGGG - Intronic
1116385844 14:44328847-44328869 CAGGGGACTTGGAGGGGAGAGGG - Intergenic
1116680330 14:47960804-47960826 ATGGGGAGATCATGGGAAGAAGG - Intergenic
1118712478 14:68533442-68533464 CTGGAGACATCAAGAGAGGATGG + Intronic
1118762828 14:68890917-68890939 CTGGGGACATGTGGGGAGGGTGG - Intronic
1118973421 14:70656526-70656548 CTGAGGACATGAGGGAAAGATGG + Intronic
1119394325 14:74315042-74315064 CTTGGGAGAGGAAGGGAAGCAGG + Intronic
1120964903 14:90158489-90158511 CTGGGGACCAGAAGGGAAGGGGG + Intronic
1121566117 14:94910445-94910467 CTGGGAGCCTGAAGGGGAGAGGG - Intergenic
1121816336 14:96931924-96931946 CTGCGGAAATGCAGGCAAGATGG + Intergenic
1122613969 14:103004187-103004209 CTTGGGAGAGGAAGGGATGAGGG - Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1124382247 15:29176735-29176757 CTGGCGACCTGGAGGGAAGGAGG - Intronic
1125300714 15:38252015-38252037 TTTGGGAAATGAAGGGAGGAGGG + Intergenic
1125387826 15:39156958-39156980 ATTAGGACATGAAGGGAAAAAGG + Intergenic
1125587167 15:40828974-40828996 CTGGGGTCCTGAAGGGTACAGGG + Intergenic
1125790362 15:42360995-42361017 CTAGGGTCCTGAAGGGAAGATGG + Intronic
1126430314 15:48576549-48576571 CTGGAGGAATGAAGGGAAGGTGG + Intronic
1126436039 15:48638811-48638833 CAGGGGACATGACAGCAAGAGGG + Intronic
1126518888 15:49566193-49566215 CTTGGGAAGTGAAGGGAAAAGGG + Intronic
1126522145 15:49606831-49606853 CAAGGGAAATGAAGAGAAGAAGG + Intronic
1127008348 15:54595255-54595277 CTAAGGACATGAAGGCAATAAGG + Intronic
1127122800 15:55785997-55786019 CTGGAGAAAAGAAGGAAAGACGG + Intergenic
1127321779 15:57853883-57853905 GAAGGGACATGAAGGAAAGAAGG - Intergenic
1127326098 15:57896589-57896611 CTTGGGGCTTGAAGAGAAGAAGG - Intergenic
1128118493 15:65128532-65128554 CCAGTGACATGAAGGGAAGGTGG + Intronic
1128341943 15:66828526-66828548 CTGAGGACCTAAAAGGAAGAAGG - Intergenic
1128697927 15:69782225-69782247 CTGTGGACATGAGAGGGAGATGG + Intergenic
1129112058 15:73342959-73342981 TTGGGGACAGGCAGGGAATAGGG - Intronic
1129270540 15:74417211-74417233 CTGGGGCCATGCAGGAAAGCAGG - Intronic
1129608316 15:77035485-77035507 CTGGGAACAGGGAGGAAAGAGGG - Intronic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129854217 15:78812142-78812164 CTGGGGCCACGAAGGACAGACGG - Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130878139 15:88032080-88032102 CTGGGGACAGGAAGAGTAGGAGG + Intronic
1131168940 15:90162867-90162889 CTGGGGAGATAAAGGGAGAAAGG - Intronic
1131397670 15:92099328-92099350 CTGGAGACAGGAAGGGACTAAGG - Intronic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1133000063 16:2845781-2845803 CTCAGGCCATGATGGGAAGAGGG + Intergenic
1133085215 16:3356853-3356875 CTGGGGAAAGGAAGAGAAGTTGG + Exonic
1133824983 16:9270334-9270356 CTGAGGACCTGAAAGGGAGAAGG - Intergenic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1135108272 16:19670111-19670133 ATGAGGACATAACGGGAAGATGG - Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135323227 16:21510534-21510556 CTCAGGTCATGATGGGAAGAAGG + Intergenic
1136173509 16:28502509-28502531 CTGGGCACATGGAGGAAGGATGG - Intronic
1136239068 16:28933127-28933149 CTGGGGAGATGCCGGGAAGCGGG + Intronic
1136334711 16:29603721-29603743 CTCAGGTCATGATGGGAAGAGGG + Intergenic
1136774221 16:32863024-32863046 CTGGGGACAGCAAGGAAAGGAGG + Intergenic
1136896390 16:33998490-33998512 CTGGGGACAGCAAGGAAAGGAGG - Intergenic
1137501705 16:49016603-49016625 AGGGGGACACGCAGGGAAGAGGG + Intergenic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1138590296 16:57995988-57996010 CTGGGGACTGGGAGGGCAGAGGG - Exonic
1138632312 16:58307673-58307695 CTCAGGCCATGATGGGAAGAGGG + Intronic
1139366003 16:66433989-66434011 GCGGGGACATGAAGGGGAGTGGG + Intronic
1140771271 16:78205985-78206007 ATGGAGACAGGAAGGGAGGAAGG - Intronic
1140802696 16:78503214-78503236 CTGAGAGCATGATGGGAAGATGG + Intronic
1141608178 16:85167449-85167471 CTGGGGACATGCAGGTCAGCGGG - Intergenic
1141693191 16:85607829-85607851 GTGGGGGCCTCAAGGGAAGAAGG - Intergenic
1141854791 16:86673669-86673691 GTGGGTGCATGAAGGGAAGGAGG - Intergenic
1142014883 16:87740119-87740141 CAGGGGACAGGAAGAGAAGGTGG + Intronic
1142215151 16:88826314-88826336 CTGGGTACAGGCAGGGAACAGGG + Intronic
1142215165 16:88826363-88826385 CTGGGTACAGGCAGGGAACAGGG + Intronic
1142311934 16:89319286-89319308 CTAGGGACATGAAGAGAATCAGG - Intronic
1203076645 16_KI270728v1_random:1125143-1125165 CTGGGGACAGCAAGGAAAGGAGG + Intergenic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143332089 17:6144953-6144975 CTGGAAACAAGAATGGAAGATGG - Intergenic
1143817483 17:9529022-9529044 ACAGGGACATGGAGGGAAGAGGG + Intronic
1144397916 17:14863169-14863191 CTGGGCAAGTGAAGGTAAGAAGG + Intergenic
1144760143 17:17702501-17702523 CTGGGGACAAGAATGGGAGAAGG - Intronic
1145752909 17:27367937-27367959 CTTGGCACATGACGGGAAGAGGG - Intergenic
1145778534 17:27546235-27546257 CTGGGGATATGAGGGAAATACGG + Intronic
1145960096 17:28882238-28882260 CTGGGGACAAAAGGGGCAGAAGG + Intronic
1145960886 17:28885976-28885998 GTAGGGACAGGAAGGGAAGGAGG + Intronic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146678754 17:34792053-34792075 TTGGGGCCATGAAAGGAGGATGG + Intergenic
1147363692 17:39946671-39946693 CTGGGGAGCAGAAGGGGAGATGG - Intergenic
1147596499 17:41721401-41721423 CTGGGGACTTGAAGATAACAGGG + Intronic
1147606588 17:41777157-41777179 CTGGGGAGGTCAAGGGAACATGG + Intronic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147953460 17:44119751-44119773 GGTGGGACATGAAGGGGAGAAGG + Intronic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148559863 17:48599771-48599793 CTGGGGACAAGAAGGGGCCAGGG + Intronic
1149555471 17:57570571-57570593 CTGGGGACAAGAAGGCAGGCAGG - Intronic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151210994 17:72543593-72543615 CAGGGGACATGGAAGGGAGAGGG - Intergenic
1151348826 17:73519508-73519530 CCAGGGACAAGAAGGAAAGATGG + Intronic
1151382630 17:73736226-73736248 GTGGGGACAGGCAGGAAAGAAGG + Intergenic
1151468894 17:74305456-74305478 CTGGGGACAGGAGGGGATGCAGG + Intronic
1151681180 17:75623756-75623778 GTGGGGACAGGAAGGGCAGGTGG - Intergenic
1151820628 17:76494888-76494910 TTGGGGCAATGAAGGGAAGGGGG + Intronic
1151922792 17:77170188-77170210 CTGGGGAAAGGAAGCTAAGAAGG + Intronic
1151982733 17:77523615-77523637 CTGGGGACATAAATTCAAGATGG - Intergenic
1152192993 17:78899755-78899777 CTGGGGACATGCGGGTAGGATGG - Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152352355 17:79790878-79790900 CAGGGGACGTCAAGGGAAGGTGG - Intergenic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1152675941 17:81641285-81641307 TTGGGGAGGTGAAGGGAAGCTGG + Intronic
1153838929 18:8989051-8989073 CTGGGGAAATCAAGGGATGCTGG - Intergenic
1154170823 18:12048700-12048722 CTGGCTACAGGAAGGGAAGAAGG - Intergenic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1156186384 18:34668666-34668688 CTGGGTACATAAAGAAAAGAAGG - Intronic
1157308172 18:46531992-46532014 CTGGTGACAAAAAAGGAAGATGG + Intronic
1157492054 18:48130343-48130365 CTGGGGGCTTTAAGGGAAGTGGG + Intronic
1157564786 18:48672640-48672662 CTGGAGGCAAGAAGGAAAGAGGG + Intronic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158058715 18:53312965-53312987 GTGGGGAGAGGAAGGGAGGAGGG + Intronic
1158185402 18:54765709-54765731 ATGGGGAAAGGAAAGGAAGAAGG - Intronic
1158438614 18:57453148-57453170 TAGGGGACAGGCAGGGAAGAAGG - Intronic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159881082 18:73859122-73859144 AGGGGGGCATGCAGGGAAGAAGG + Intergenic
1159975347 18:74704397-74704419 CGGGGAAAATGAAGGGAAAAAGG + Intronic
1160289046 18:77573236-77573258 CTGGGGAAAAGAAAGTAAGAAGG - Intergenic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1160578977 18:79873079-79873101 CTGGGGACAGGATGGGCAGCAGG + Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161824185 19:6551546-6551568 CTGGGGCCATGAACGGCAGCAGG - Intergenic
1161956794 19:7500659-7500681 CTGGGGACATCACGGGAAACTGG - Intronic
1161994941 19:7706259-7706281 CTGGGGTTACGAAGGGGAGAAGG + Intergenic
1162272633 19:9628885-9628907 CTGGGGACCTAACGGCAAGAAGG + Intronic
1162418561 19:10552870-10552892 CTGAGGACCTGGCGGGAAGAGGG - Exonic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1164404546 19:27932356-27932378 CTTGGTAGATGAAGAGAAGAAGG - Intergenic
1164686216 19:30168392-30168414 CAGGGGGCGTGTAGGGAAGAGGG - Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165028683 19:32981441-32981463 GAGGGGAAAGGAAGGGAAGAGGG + Intronic
1165052591 19:33151440-33151462 CTGGGGACAGGCAGGCAGGAGGG + Intronic
1165811183 19:38612778-38612800 ATGGGGACAGGAAGGGAAGGAGG + Intronic
1165830614 19:38728590-38728612 CTGGAGACTTCTAGGGAAGAAGG - Intronic
1165965314 19:39572953-39572975 CTGGGGACTTGGGGGGAAAAGGG - Intergenic
1166253498 19:41586652-41586674 CTGGGGACAGGAAGGGATGGGGG + Intronic
1166335710 19:42105717-42105739 ATGGGGAGAGGAAGGGAAGGTGG - Intronic
1166356797 19:42232090-42232112 CTGGGGACCTCAAGTGAGGAGGG + Exonic
1167013130 19:46821964-46821986 CTGGGGCCATGAATGGCAGCAGG + Intergenic
1167409897 19:49338517-49338539 CAGGGGACATTACGGGAACATGG - Intronic
1168127012 19:54289854-54289876 GTGGGGGCATGAAGGGATGCTGG + Intergenic
1168269149 19:55240206-55240228 CTGGAGACATGAAGGGCAGCAGG + Intronic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
1168483801 19:56743558-56743580 CTGGGGACAGGAATCAAAGAAGG - Intergenic
1168497894 19:56869516-56869538 CTGGGGAAATGAAAGGAAGTGGG - Intergenic
1168687755 19:58358586-58358608 CTGGGGACAGGAAGGCAGCAGGG + Intronic
925034554 2:675795-675817 ATGGGGACAGGAAAGGGAGAAGG + Intronic
925737442 2:6976107-6976129 CTGGGCACATGACTGGAAGTGGG + Intronic
926686697 2:15703765-15703787 TTGGGAACCTGAAGGGAAGTAGG + Intronic
926757189 2:16245592-16245614 CTGGGCACATAAGGGCAAGAAGG + Intergenic
927894852 2:26775154-26775176 CTGGGGGCAGGAAAAGAAGAGGG - Exonic
928099303 2:28426249-28426271 CTGGAGACTTGTAGGCAAGAGGG - Intergenic
928770396 2:34697625-34697647 TTGGTGTCATGAGGGGAAGAAGG + Intergenic
928940039 2:36718287-36718309 CTGGGGACTGGAAGAGAAGAAGG + Intronic
929262630 2:39882945-39882967 CTGGGAACAGGAAGGGAATGGGG - Intergenic
929487533 2:42368256-42368278 CTGGGGACAGGAAGGAAGGTGGG - Intronic
929489230 2:42381806-42381828 TTGGGATCATGAAGGGAAAAAGG + Intronic
929835999 2:45400250-45400272 CTGGGGGCAGGAAGGGCAGGAGG + Intronic
929882310 2:45847674-45847696 CTGGGGCCATGAATGGAAGCAGG - Intronic
929927969 2:46230909-46230931 CTGGGGACAGGAAGTAAAGGCGG + Intergenic
930055200 2:47246525-47246547 CTGGGGATATGCAGTGAGGAAGG - Intergenic
932327718 2:70874098-70874120 CTGGGGCCATCAGGGGAAGGTGG + Intergenic
932582368 2:73000183-73000205 CTGTTTACATGAAGTGAAGAAGG - Intronic
933066904 2:77808867-77808889 ATGGGAACAAAAAGGGAAGATGG + Intergenic
933239083 2:79898979-79899001 CTGGGCAAGTGAAGGGAAGGAGG + Intronic
933801828 2:85966683-85966705 CTGGGTACATAAAGGAATGAAGG + Intergenic
935436742 2:103043840-103043862 TTGGGGACATGGGGGGAAGAGGG + Intergenic
936506975 2:113115824-113115846 CTGGGGACATCGAGGGTAAAGGG - Intronic
937231030 2:120398359-120398381 CTGGGGCCAGGATGGGAAGCAGG + Intergenic
937341426 2:121093449-121093471 CTGGGCCCATGCAGGCAAGATGG + Intergenic
937899960 2:127012278-127012300 CTGGGGAGTGGCAGGGAAGAGGG + Intergenic
942160157 2:173176652-173176674 CAGGGGACATGAAGAAAACATGG + Intronic
942335431 2:174879912-174879934 CACAGGGCATGAAGGGAAGATGG + Intronic
942730977 2:179060544-179060566 TTGGATAGATGAAGGGAAGAGGG - Intergenic
942817999 2:180075420-180075442 ATTGGGAAATGAAGGGGAGAAGG + Intergenic
943701906 2:190996075-190996097 CCGGGGACAGGAAGAGAGGAAGG + Intronic
943973625 2:194443037-194443059 GTGAGGACATGAAAAGAAGAGGG - Intergenic
944383399 2:199137879-199137901 CTGGGGCCAGGAAGGTAAGTAGG - Intergenic
944944891 2:204672388-204672410 CACTGGACATGAAGGGCAGATGG + Intronic
945686267 2:212974273-212974295 CTGGTGACAAGAAGGGAGAATGG + Intergenic
945780842 2:214169848-214169870 CTGGGGATAAAAAGGGAAAACGG + Intronic
945915052 2:215694806-215694828 CTGGGGATGGGAGGGGAAGAGGG + Intergenic
946053042 2:216880040-216880062 AAGGGGAAAGGAAGGGAAGAGGG + Intergenic
946484196 2:220085151-220085173 CTGGGCACATGAAGAGTTGAGGG - Intergenic
946493563 2:220173008-220173030 CCAGGGACTGGAAGGGAAGAAGG + Intergenic
946622820 2:221577059-221577081 TTGGGGACTTGGGGGGAAGATGG - Intergenic
947567406 2:231203343-231203365 TGTGGGACATGAGGGGAAGAAGG - Intronic
1168951590 20:1805526-1805548 CTGGGGATGAGAAGGGAAGGTGG + Intergenic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169287102 20:4318505-4318527 CTGGGGACAGGAAGGGAGTGGGG + Intergenic
1169549480 20:6687609-6687631 CTGGGTACTTGGAGGAAAGAGGG - Intergenic
1170329569 20:15193716-15193738 CTGGGGAAATGAGAGGATGAGGG - Intronic
1170438615 20:16355198-16355220 GTGGGGACAGGCAGGGGAGACGG + Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171456631 20:25276146-25276168 CTGGGAACATGGAGGGTAGCAGG + Intronic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1172588301 20:36100328-36100350 CTGGGGACAAGGTGGGGAGAGGG - Intronic
1172780795 20:37436085-37436107 ATGGGGACATGGATGGATGATGG - Intergenic
1172791771 20:37510784-37510806 CTGTAGTCATGAGGGGAAGAAGG - Intronic
1173955385 20:47028415-47028437 GTGGGGGCAAGAAGAGAAGAAGG - Intronic
1174037841 20:47679061-47679083 GTGGGGACAGGAAGGGCAGGAGG - Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1175306001 20:57975905-57975927 CTGAGGCCATGAAGGAAAGGAGG + Intergenic
1175826927 20:61941610-61941632 CTGGGGAAATGAAGTGGGGAGGG - Intergenic
1175890839 20:62315250-62315272 TTGGGGACATGAAGCCAGGATGG - Intronic
1176254899 20:64146742-64146764 CTGGGGTCTTGAGGGGAAGTTGG - Intergenic
1176298735 21:5088511-5088533 CTGGGGTGGTGAAGGGGAGAGGG - Intergenic
1176430746 21:6573995-6574017 CTGAGCTCATGAAGGGCAGAGGG + Intergenic
1176996182 21:15558056-15558078 CTGGCAAAGTGAAGGGAAGATGG - Intergenic
1177522950 21:22253753-22253775 CAGGGAACATGAAGGAAATATGG - Intergenic
1178933275 21:36838225-36838247 CTGGTGGCAGGAAGGGCAGAAGG - Intronic
1178994666 21:37388038-37388060 AGGAGGTCATGAAGGGAAGAGGG - Intronic
1179419696 21:41225602-41225624 CTGGGGACCAGAAGGGAAAGGGG + Intronic
1179706140 21:43181457-43181479 CTGAGCTCATGAAGGGCAGAGGG + Intergenic
1179858291 21:44173438-44173460 CTGGGGTGGTGAAGGGGAGAGGG + Intergenic
1179882232 21:44297711-44297733 CTGGGGTCAGGAGGGGAAGGGGG - Exonic
1179990854 21:44947669-44947691 CAGGGCACAGGAAGGGAACAGGG - Intronic
1180115717 21:45703677-45703699 CGGGGGGCATGAACAGAAGAAGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180815584 22:18787397-18787419 ATGGGGACAGGAAGGGATGGGGG + Intergenic
1181089772 22:20464646-20464668 TAGGGGACATGCAGGAAAGAAGG + Intronic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181699982 22:24615239-24615261 ATGGGGACAGGAAGGGATGGGGG - Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181884748 22:26011398-26011420 ATGAGAACATGAAGGGAGGAGGG + Intronic
1182410423 22:30180807-30180829 GGGGGGAAAGGAAGGGAAGAAGG - Intergenic
1182471238 22:30549629-30549651 GGGGGGACATGAAGGGGGGAAGG - Intergenic
1182501719 22:30752987-30753009 CTAGGGTCATGATGGGAAGTGGG - Intronic
1183046095 22:35221447-35221469 CTGGGAAGATGGAGCGAAGAAGG + Intergenic
1183469332 22:37997290-37997312 CTGGGGACAGAAAGAGGAGAAGG - Intronic
1183905514 22:41037316-41037338 GTGGGGAGAGGATGGGAAGAAGG + Intergenic
1184255030 22:43281674-43281696 ATGGGGACAGCAAGGGGAGAGGG - Intronic
1184806679 22:46799127-46799149 CTGTGGAAAGGAAGGGAAGGTGG - Intronic
1184824522 22:46939353-46939375 CTAAGGATATGAAGGGAATATGG + Intronic
1184866267 22:47203357-47203379 GCAGGGAAATGAAGGGAAGAGGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949424753 3:3904903-3904925 CTGGAGGCATGAGGTGAAGATGG + Intronic
949517817 3:4822874-4822896 CTTGGCAGATCAAGGGAAGAGGG + Intronic
949602150 3:5611767-5611789 CTGGGGACTTTAAGGGAACATGG + Intergenic
949782386 3:7704754-7704776 TTGGGGACATCAGGGAAAGATGG - Intronic
950134486 3:10571154-10571176 GTGGTTACATGAAGTGAAGAAGG + Intronic
950477589 3:13223676-13223698 CTGGGGACATGCAGGGACCGCGG + Intergenic
950916084 3:16646637-16646659 ATGGGGCCAAGAGGGGAAGAGGG + Intronic
950929952 3:16778738-16778760 CTGGGGACATAAAGAAATGAAGG + Intergenic
950950816 3:16996376-16996398 CTGGAGGCTGGAAGGGAAGAGGG - Intronic
950954015 3:17031415-17031437 CTGCAGACATGAAAGGAGGAAGG - Intronic
951514968 3:23548872-23548894 CTTGGCACATGAAGTGAAAAGGG - Intronic
951680626 3:25290826-25290848 CTGGGGAAAGCAAGAGAAGAGGG - Intronic
952070181 3:29625117-29625139 CTGGGGAGGTGAAGGCAAAAAGG - Intronic
952933782 3:38379694-38379716 CTGGGGACATGAATGGATCTTGG + Intronic
952946558 3:38481536-38481558 CTGGGGAGGTGCAGGGATGAGGG + Intronic
953388883 3:42523141-42523163 AGGGGGACATGAAGGGCAGGAGG - Intronic
953533167 3:43756283-43756305 GTGGGGCCAGGAAGGGAAGGAGG + Intergenic
953664731 3:44917681-44917703 CTGGGGACATCAGAGGAGGATGG - Intronic
953754477 3:45634804-45634826 CTGGGAATATGCAGGGCAGATGG + Intronic
954294021 3:49664276-49664298 CTAGGGAAATAAAGAGAAGAAGG - Intronic
954393421 3:50279394-50279416 CTGGGGACATCAAGGAGGGATGG + Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956264434 3:67380999-67381021 GTGGGGACACGCAGAGAAGAGGG + Intronic
956877670 3:73479708-73479730 CTGGGGTCAGGCAGGGGAGATGG - Intronic
956974231 3:74561611-74561633 TGGGGGACGTGAGGGGAAGAAGG - Intergenic
957088979 3:75709395-75709417 CTGGGGACATGACTGGATCATGG - Intergenic
960755375 3:121005792-121005814 CTGGGTACATGACGAAAAGAAGG - Intronic
960975499 3:123169880-123169902 CTGGTGACAGTTAGGGAAGAGGG - Intronic
961414517 3:126747752-126747774 CTCTGGAAATGAAGGGAAGGAGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
964791847 3:160460350-160460372 CTGGGGCCATAAATGGCAGAAGG - Intronic
965447367 3:168791692-168791714 ATGGGGAGATGAAGAGAAGTTGG + Intergenic
965992955 3:174843245-174843267 CTGGGGAAGGGAGGGGAAGATGG - Intronic
966736016 3:183187860-183187882 CTGGGTAGGGGAAGGGAAGAAGG - Intronic
967817981 3:193815306-193815328 CTGGGGAAGGGAAGGGAAGGGGG - Intergenic
968649336 4:1754200-1754222 CTGGGGGCATGTGGGGAGGAGGG + Intergenic
968704236 4:2070583-2070605 CTGCGTAATTGAAGGGAAGAAGG + Intergenic
968814174 4:2813123-2813145 CTGGGAACAGGAAGGAAACAAGG + Intronic
969108974 4:4829462-4829484 CAGGGAAAATGCAGGGAAGAGGG - Intergenic
969269599 4:6090254-6090276 CTGCAGACATGCAGGGGAGAAGG + Intronic
969344466 4:6562587-6562609 CTGGGCCCCTGAAGGGAGGAGGG + Intronic
969449983 4:7267501-7267523 CTGGATACATGGAGGAAAGATGG + Intronic
969478808 4:7436065-7436087 CAGGGGTCAGGAAGAGAAGACGG + Intronic
969566262 4:7980189-7980211 TTCAGGCCATGAAGGGAAGAGGG + Intronic
969646642 4:8433879-8433901 CTGGGGACATGTAGTAAGGAAGG + Intronic
969955044 4:10880498-10880520 CTTGGGACATGAAGTGAACTGGG - Intergenic
970369801 4:15395254-15395276 CTGGGGTGATTTAGGGAAGAGGG + Intronic
971019247 4:22517076-22517098 CTGGGCACAGGAAGCAAAGACGG - Intergenic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
971217522 4:24674733-24674755 CTGGGTACAGGATGGGCAGAGGG - Intergenic
972203881 4:36747865-36747887 CTGGGGCCATGAATGGCAGTGGG + Intergenic
972248050 4:37267086-37267108 ATGTGGTCATAAAGGGAAGAAGG + Intronic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
975530478 4:75394892-75394914 GTGGGGACATGTGGGGGAGAAGG - Intergenic
977120968 4:93101420-93101442 CAGGGGCCAAGAAGGGTAGAGGG - Intronic
977372992 4:96163949-96163971 CAGGGGACAGGAGAGGAAGAAGG + Intergenic
979490145 4:121316706-121316728 CTGGTGACATGAAGAGGAAATGG + Intergenic
979608817 4:122669077-122669099 CAGGAGACATGATGGGGAGATGG + Intergenic
980253417 4:130347400-130347422 CTGGGGACATGCTGGGGAGTAGG + Intergenic
980617386 4:135248117-135248139 CTGAGGAAATGAGGGGTAGAGGG - Intergenic
984123901 4:175781298-175781320 CTGAAGAAATGAAGGGAAGGGGG + Intronic
985150705 4:186944321-186944343 CTGGGAAGAGGAAGGGAAAAGGG + Intergenic
986168330 5:5294814-5294836 CAGGTGACAGGAAAGGAAGAGGG + Intronic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
987008374 5:13734628-13734650 ATGGGAACATTTAGGGAAGAGGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987206080 5:15627439-15627461 CTGGGTCCATGTAGGGAAAATGG + Intronic
987353606 5:17043017-17043039 GTGGTGAGAGGAAGGGAAGAGGG + Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988459724 5:31423377-31423399 CTGGGAACATGTCAGGAAGACGG - Intronic
990476285 5:56164343-56164365 CCAGGGACAGGAAGGGGAGACGG - Intronic
991208129 5:64073484-64073506 CATTGGACATGAAGGGAGGAAGG - Intergenic
992193023 5:74312668-74312690 CTCAGGCCATGATGGGAAGAGGG + Intergenic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
994615620 5:102100580-102100602 GTGGGAACATGGAGGGGAGAAGG - Intergenic
994790849 5:104224095-104224117 CTGGGGCCATGAATGGCAGCAGG - Intergenic
995355982 5:111238200-111238222 CTGGAGAGATGAAGGAAACAGGG - Intronic
995393530 5:111664047-111664069 CAGGGTACATGAGGGAAAGAAGG + Intronic
996470757 5:123857474-123857496 CTGGAGACATAAGGGGAAGACGG + Intergenic
996663914 5:126035735-126035757 ATGGAGACATGAAGGAATGAAGG - Intergenic
997028082 5:130090011-130090033 CTAGGAGCATGAAGGAAAGAAGG - Intronic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
998165166 5:139838605-139838627 CTGGGGACAGGAGGGGGAGAGGG - Intronic
998594577 5:143515559-143515581 ATGGGGAAAGGAAGGGAAGAAGG - Intergenic
998641230 5:144013611-144013633 CTGAGGAGATGAAGGGGAGTAGG + Intergenic
998782088 5:145669052-145669074 CAGAAGACATGAAGGGAAGCTGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999087060 5:148902271-148902293 CTGGGGACAAGCAAGAAAGAGGG - Intergenic
999089261 5:148921052-148921074 CTGGGGATGTGAAGGTAAGGAGG + Intergenic
999495020 5:152088511-152088533 CAGGGGAAAGGAAGGAAAGAGGG - Intergenic
999585834 5:153088640-153088662 GTGTGGAAATGAAGGGTAGATGG + Intergenic
999672981 5:153973917-153973939 ATGAGGACATGGAAGGAAGAGGG - Intergenic
999775780 5:154812087-154812109 CTGGGTATATCAAGGGAAGTTGG + Intronic
1000018425 5:157298710-157298732 CTGGGGAGATGAAGGTATTATGG - Intronic
1000382945 5:160645296-160645318 CTGGGGACCTGAACTGCAGAAGG + Intronic
1000734877 5:164886434-164886456 CTGGGGAATGGAAGGGAATATGG + Intergenic
1001285259 5:170418447-170418469 CTGGAGAAATGATGGGAAGAGGG - Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1003674809 6:8193206-8193228 CTCAGGCCATGATGGGAAGATGG + Intergenic
1004843066 6:19609074-19609096 CTGGGGAATTGAAGGAAATAAGG - Intergenic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1005650285 6:27879312-27879334 CTTGGGACAAGGAGGGAAGGTGG + Intergenic
1005898335 6:30196750-30196772 CAGGGGGCAGGAAGGGGAGAAGG + Intronic
1006042182 6:31265702-31265724 CTGGCAAAAAGAAGGGAAGATGG + Intergenic
1006510297 6:34517729-34517751 GAGGGGACAGGGAGGGAAGATGG - Intronic
1006634174 6:35450422-35450444 CTGGGGACATGGAGGAATGGGGG + Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007172868 6:39876869-39876891 CTGGGGACAGGAAGGAAAGAGGG + Intronic
1007776159 6:44225573-44225595 CTAGAGAGATGAAGGCAAGAGGG - Intronic
1008220621 6:48850187-48850209 TTGGGGACTTGCAGGGGAGAGGG + Intergenic
1008385109 6:50880333-50880355 AAGGGGACAGGAAGGGAGGAGGG - Intergenic
1008983330 6:57512243-57512265 CTGAGGACATGTAAGGAAAAAGG + Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013195239 6:107838867-107838889 TTGGGAGGATGAAGGGAAGAAGG + Intergenic
1013983855 6:116166037-116166059 CTGGGGTCATGAAGGTAGAAAGG + Intronic
1015320397 6:131866498-131866520 AAAGGGAAATGAAGGGAAGATGG - Intronic
1015895779 6:138015253-138015275 TTGGGGACTTGAGGGGAAAAGGG - Intergenic
1016208651 6:141501849-141501871 CTTGAGAAATGCAGGGAAGAGGG - Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1017061780 6:150491307-150491329 CTGGGGAGGGGAAGGGAGGAAGG - Intergenic
1017286092 6:152677736-152677758 CTGGGGACTTGTAGGGGAAATGG + Intergenic
1018065005 6:160118663-160118685 CTGGGGCCATGAATGGCAGCAGG - Intergenic
1018102799 6:160456329-160456351 CTGGAAACATGAAGGGGAGAGGG + Intergenic
1018110704 6:160534575-160534597 CTGGACACATGAAGGGGAGAGGG + Intronic
1018605308 6:165591477-165591499 CTTGGGTTTTGAAGGGAAGATGG - Intronic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1019644408 7:2121348-2121370 GTGGGGACAGGCAGGGATGAGGG + Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1019950756 7:4370423-4370445 CTGGGGAAATGAAGGTTGGAAGG + Intergenic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020370922 7:7431298-7431320 CTGGTGACATGAAGTTAGGAGGG + Intronic
1020568068 7:9822597-9822619 CTGGGGCCATGAATGGCAGTGGG - Intergenic
1021292856 7:18867143-18867165 GTGGAGACATGCAGGGAAGAAGG + Intronic
1022176793 7:27878830-27878852 CTAGTGACATGAACGGAAGGGGG - Intronic
1022437343 7:30401878-30401900 GTGGGGAGAAGAAGAGAAGAGGG - Intronic
1023027297 7:36062238-36062260 CTGGGGACAGGCAGGGAAAGCGG + Intergenic
1023518670 7:41029089-41029111 CTGAGGACATCAGGGGAGGAGGG - Intergenic
1024024374 7:45398851-45398873 TTGGGGTCATGACAGGAAGAAGG + Intergenic
1024263637 7:47590098-47590120 GGGGGGAGAAGAAGGGAAGATGG - Intergenic
1026528252 7:71174386-71174408 CTGGGGACCTGTGGGGAAGGTGG + Intronic
1026911897 7:74095849-74095871 GTGGGGCCTTGAAGGGCAGATGG - Intronic
1026969136 7:74457359-74457381 CTAGGGACAGGAAGGGATGGAGG + Intronic
1027333763 7:77126958-77126980 CTGGGGCCATGAATGGCAGCGGG - Intronic
1027601604 7:80246975-80246997 TTTGGGCCATGAAGGGAAGGAGG - Intergenic
1027789173 7:82617321-82617343 CTGAGGACAGGAAGGGGAAAAGG - Intergenic
1028320313 7:89451289-89451311 CTGGGGAGATGAAGGGAGGGAGG - Intergenic
1028902483 7:96117187-96117209 ATGGGGAGATGAGGGGAATAGGG + Intergenic
1029538106 7:101167478-101167500 CTGGGAAGATGAAGGGGACATGG - Intergenic
1029540380 7:101179288-101179310 CAGGGGACAGGCAGGGAAGCCGG + Intronic
1029580233 7:101432353-101432375 CTGAGGACATGAAGAGGAGTGGG + Intronic
1029712884 7:102309126-102309148 CTGGGGACCTGGAAGGAAGTTGG + Intronic
1029782032 7:102744374-102744396 CTGGGGCCATGAATGGCAGCGGG + Intergenic
1030015518 7:105216377-105216399 CTGGTGAGATGAAGGAAAGGAGG + Intronic
1030023186 7:105295606-105295628 CAGGGGCCAGGAAGGGAAAATGG + Intronic
1030650191 7:112109227-112109249 GTGGGGAAATAATGGGAAGAAGG - Intronic
1030949645 7:115774092-115774114 CAGGGAACAAGAAGGGGAGAAGG - Intergenic
1032089726 7:128905416-128905438 CTGGGGACATGAAGAGAGCTGGG - Intronic
1032403350 7:131638706-131638728 GTGGGAAGAGGAAGGGAAGATGG + Intergenic
1032403360 7:131638753-131638775 CTGGGAAGAGGAAGGGAAGATGG + Intergenic
1032491930 7:132330236-132330258 GTAGGGACATGGTGGGAAGAAGG + Intronic
1032507530 7:132446929-132446951 GTGGGGAGAGGAAGGGAGGATGG - Intronic
1032510877 7:132471448-132471470 GTTGGGCCATGAAGGGATGAAGG - Intronic
1033380930 7:140818133-140818155 TTGGGGACAAGATGGGACGATGG + Intronic
1034460033 7:151193095-151193117 GTGGGGGAATGAAGGGAAAAGGG - Intronic
1034743914 7:153504550-153504572 ATGGGGACACGCAGGGCAGAAGG - Intergenic
1034748464 7:153545159-153545181 CTGGTGACATGAAGGAACAAAGG + Intergenic
1034988152 7:155530420-155530442 CAGGGGTCATGGAGGGGAGAGGG - Intronic
1035108917 7:156464256-156464278 CTGGGGACAGGAGGGCCAGAGGG - Intergenic
1035155880 7:156912628-156912650 CTGGGGACATAATGAAAAGAAGG - Intergenic
1035435039 7:158853299-158853321 TTCAGGACATGATGGGAAGAGGG + Intergenic
1035543838 8:463537-463559 GTGGGGACATAAAGGGCCGAGGG - Intronic
1035690678 8:1557551-1557573 CTGGCGGCATGAAGGCAGGACGG - Intronic
1036636652 8:10555211-10555233 TTCGGGGCATGATGGGAAGAGGG + Intergenic
1036694317 8:10964734-10964756 CTGGGGAAATCAAGGGATGAGGG - Intronic
1038714500 8:29979833-29979855 CTGGGGAAATCTGGGGAAGAAGG - Intergenic
1038850669 8:31272240-31272262 ACGGGGAGATGCAGGGAAGAGGG - Intergenic
1039338402 8:36620221-36620243 CAGGGGACATCAAGGAATGATGG + Intergenic
1039821253 8:41137397-41137419 CTGGGAATATGATGGCAAGAAGG - Intergenic
1040392809 8:46964035-46964057 CTGGGGACCTGAAGGCCACAGGG + Intergenic
1040996679 8:53409296-53409318 TTGAGGAAAGGAAGGGAAGAAGG + Intergenic
1043614762 8:82112310-82112332 CTAGGGACAGGGAGGGAAGGAGG - Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045792186 8:105996379-105996401 CTGGCAACAAGAAGGGAACATGG + Intergenic
1046145013 8:110147194-110147216 CTGATGACATGAAGGGAAAAAGG + Intergenic
1046456174 8:114465213-114465235 CTATGGACTTGAAAGGAAGATGG + Intergenic
1047120701 8:121901213-121901235 CTTGGGAAATGAAAGGCAGATGG - Intergenic
1048021292 8:130541759-130541781 CTGGGGACATGATTGGAGAAGGG - Intergenic
1048216567 8:132501036-132501058 CAGGTGACAAGAAGGAAAGAAGG - Intergenic
1048544375 8:135372683-135372705 GTGAGGACATGGGGGGAAGATGG + Intergenic
1048878776 8:138856950-138856972 ATGGGGACATGCAGGAAAGGTGG - Intronic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1048899646 8:139025021-139025043 ATGGGGACATGGAGGTTAGAGGG + Intergenic
1048958668 8:139557767-139557789 CTAGAGACATGAGGGGATGAAGG - Intergenic
1049023940 8:139975773-139975795 CAGGTGACATGAAGAGAGGAGGG - Intronic
1049273031 8:141706167-141706189 ATGGGGAGATGATGGGTAGATGG + Intergenic
1049908586 9:243659-243681 CAGGGGAAAGGTAGGGAAGAAGG - Intronic
1050652446 9:7789091-7789113 CTGGGGAATTGTAGGGAATATGG + Intergenic
1051167437 9:14279233-14279255 TAGGGGATATGATGGGAAGACGG - Intronic
1051376824 9:16410419-16410441 CTGGGTACATGAAGGTCAGAGGG - Exonic
1052248259 9:26364939-26364961 ATGAGGACATAAGGGGAAGATGG + Intergenic
1052423692 9:28276238-28276260 CTGTGTACATGAAGAGAGGATGG - Intronic
1052599717 9:30610008-30610030 CTGGATAAAAGAAGGGAAGAAGG + Intergenic
1052626205 9:30980530-30980552 CTGGGGACATGATAGGGTGAGGG + Intergenic
1053074357 9:35120242-35120264 CTGGGAACAAAAAGTGAAGAGGG - Intergenic
1053076587 9:35139166-35139188 CTGGGGCCATGAATGGCAGTGGG + Intergenic
1053617354 9:39781675-39781697 CTGGGGACTTGAATGGCAGGGGG + Intergenic
1054266812 9:62925762-62925784 CTGGGGACTTGAATGGCAGGGGG - Intergenic
1054550305 9:66595216-66595238 CTGGGGACTTGAATGGCAGGGGG - Intergenic
1055460785 9:76518517-76518539 TTGGGGACAGGAAAGGTAGAGGG - Intergenic
1055530974 9:77183383-77183405 CTGGGGACAAGAAGGGTATAAGG - Intronic
1056032152 9:82564255-82564277 CTGGAGACATGTGGGGAAGGGGG - Intergenic
1056604639 9:88076642-88076664 CAGGGGAAATGAAGGGAGGGTGG - Intergenic
1057548493 9:96035182-96035204 CTGGGGCCATGAATGGCAGCAGG + Intergenic
1058396885 9:104564423-104564445 TTGGGGACATGAATGGCAGAAGG + Intergenic
1059566285 9:115385782-115385804 CTGGGGCCATGAATGGCAGTAGG + Intronic
1060774941 9:126366142-126366164 CTGGTGAGATGAAGGGAGGGTGG - Intronic
1060919338 9:127409186-127409208 CGGGGGAGATGATGGGGAGATGG + Intergenic
1061433045 9:130543307-130543329 CTGGGGACATGCAGAGGAGGGGG - Intergenic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1061873144 9:133531264-133531286 CTGGGGAGAAGAGGGGAAGCAGG + Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1186558043 X:10581551-10581573 TTCAGGACAAGAAGGGAAGAAGG - Intronic
1187090453 X:16090613-16090635 GTGGGGACAGGAAGGAAGGAGGG + Intergenic
1187408164 X:19023033-19023055 CTTGGGAAAAGAAGGAAAGAGGG - Intronic
1188433131 X:30129552-30129574 TTGGGGACTTGGGGGGAAGAGGG + Intergenic
1188447629 X:30272842-30272864 AGGGGGTCATGAAGGAAAGATGG + Intergenic
1188674126 X:32917619-32917641 CTGGGGAAAAAAAGAGAAGAAGG + Intronic
1188947288 X:36321386-36321408 GTGGGGCCATGAGGGGAAGAGGG + Intronic
1190014721 X:46817133-46817155 CTGTGGACAGGAAGGCAGGAAGG + Intergenic
1190901026 X:54673148-54673170 CTGGGGTCAGGAAGGAAACAGGG - Intergenic
1192173966 X:68874484-68874506 CTGGGGACATCAAGGGGAGAAGG + Intergenic
1192542384 X:71985218-71985240 CTTGGGACCTCAAGGGGAGAGGG - Intergenic
1192785536 X:74331318-74331340 GTGGAGACATCAAGGGTAGAGGG + Intergenic
1193009226 X:76657325-76657347 CTGGGGAAATGAGGGGGTGAAGG + Intergenic
1193695119 X:84699228-84699250 CTGGGGACTTGAGGGGAGGATGG - Intergenic
1198329635 X:135610122-135610144 ATAGTGTCATGAAGGGAAGAAGG + Intergenic
1198337009 X:135676222-135676244 ATGGTGTCATGAAGGGGAGAAGG - Intergenic
1198337124 X:135677395-135677417 ATGGTGTCATAAAGGGAAGAAGG - Intergenic
1198362421 X:135908668-135908690 ATAGTGTCATGAAGGGAAGAAGG + Intronic
1198914213 X:141649477-141649499 CTGGGGACATGAACAGAGGGTGG - Intronic
1199012793 X:142777293-142777315 CTGTAGACATGAATGGAACATGG + Intergenic
1199287538 X:146070535-146070557 CAGAAGACACGAAGGGAAGAAGG - Intergenic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199986096 X:152952704-152952726 GTGGTGAAAAGAAGGGAAGAGGG + Intronic
1200141378 X:153904585-153904607 CTGGGGAAAGGAAGGGAAACAGG + Intronic
1200795268 Y:7335256-7335278 CTGGGGAGGTGCAGGGAAGGGGG + Intergenic
1202066625 Y:20947373-20947395 CTGGGTACATGAAGAAATGAAGG - Intergenic