ID: 1132752702

View in Genome Browser
Species Human (GRCh38)
Location 16:1466123-1466145
Sequence GTGGAGGGACCGCATGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132752702 Original CRISPR GTGGAGGGACCGCATGCGCA GGG Intronic
900805900 1:4768293-4768315 GTGGAGGAAACACATGAGCATGG - Intronic
901216711 1:7559242-7559264 GTGGAGGGACAGGAGGCACAAGG - Intronic
903355190 1:22742118-22742140 GTGGATGGACCCTATGAGCAGGG - Intronic
913997078 1:143660524-143660546 ATGGAGGGACCGGATGGCCATGG - Intergenic
917794377 1:178522083-178522105 GTGGAGGGAGCGGATGGGCCAGG - Intronic
1063647449 10:7899228-7899250 ATGGAGGGACCGAATGAGAACGG - Intronic
1066391237 10:34978851-34978873 ATGAAGGGACAGCATGCCCAGGG - Intergenic
1070282776 10:75061974-75061996 GTGAGGGGACTGCAGGCGCAGGG + Intergenic
1073142977 10:101261232-101261254 GTGGAGGCATCGCAAGCCCAAGG + Intergenic
1073534994 10:104268769-104268791 GTGTGGGGACCGCATCCGGAGGG + Intergenic
1077172924 11:1176406-1176428 GTGGAGGGACCACAGGACCAGGG - Intronic
1077395401 11:2318050-2318072 GTGGAGGGACCACAGGACCAGGG - Exonic
1083992090 11:66252723-66252745 GTGGAGGGACCGCAGGCCTTGGG - Intergenic
1084582410 11:70032267-70032289 GTGGACGGACTGCAGGCCCAGGG + Intergenic
1091675038 12:2483048-2483070 GGGGAGGGACTCCATGCACATGG - Intronic
1093687545 12:22073847-22073869 GTGCAGGGACTGCATGGACAAGG + Intronic
1094593392 12:31842151-31842173 GTGGATGGACAGCAGGCTCAAGG - Intergenic
1096212314 12:49776160-49776182 GTGGAGGCACGGCATGGGGAGGG + Intergenic
1098864085 12:75742131-75742153 GTAGAGGGACCGGATGGGGATGG - Intergenic
1099880229 12:88459032-88459054 GTGGAGGGACAACCTGTGCAAGG + Intergenic
1103720864 12:122974747-122974769 GCGGAGGGACCGGAAGCGCCAGG + Exonic
1107945061 13:45410716-45410738 GTGGGAGGACCGCTTGAGCACGG + Intronic
1110416582 13:75260089-75260111 GTGGAGGGAGGGCATGTGAAAGG - Intergenic
1117205235 14:53435616-53435638 GTGGTGGCACAGCATGAGCATGG + Intergenic
1117668038 14:58077511-58077533 GTGGGGGGACCGCTTGAGCCTGG + Intronic
1121045392 14:90784151-90784173 GTGAAGGGACAGCAGGCACATGG - Intronic
1122804624 14:104250245-104250267 GTGGAGGGACCACATGAGCAAGG + Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123121184 14:105917877-105917899 GGGGAGGGCCTGCATGTGCAGGG + Intergenic
1123403887 15:20009446-20009468 GGGGAGGGCCTGCATGTGCAGGG + Intergenic
1123513227 15:21016092-21016114 GGGGAGGGCCTGCATGTGCAGGG + Intergenic
1124356297 15:28997203-28997225 GTGGAGGGAGCACATTCACAAGG + Intronic
1124414588 15:29464713-29464735 GTGGAGGGGCCCCCTGGGCAGGG + Intronic
1124909063 15:33900399-33900421 GTGGAAGGACCGCTTGAGCCTGG - Intronic
1129172811 15:73818213-73818235 GTGGCGGGAACGAATGTGCAGGG - Intergenic
1132752702 16:1466123-1466145 GTGGAGGGACCGCATGCGCAGGG + Intronic
1136353232 16:29725917-29725939 GTGGAAGGATTGCATGAGCAGGG - Intergenic
1142770612 17:2094146-2094168 GTGAAGGGACCTCATGGACAAGG - Intronic
1154225375 18:12498718-12498740 GTGGAGGGATCGCTTGAGCCTGG - Intronic
1154305494 18:13227832-13227854 GGGGAGGGACCTCATGGGAAGGG - Intronic
1160052625 18:75449979-75450001 GTGGAGGGACTGCTTGAGCTTGG + Intergenic
1160537176 18:79600832-79600854 GTGGAGGGACCCCCTGCGGGTGG - Intergenic
1161326333 19:3665956-3665978 GTGGAGGGAGGGCAGGGGCAGGG - Intronic
1162419013 19:10555247-10555269 GCGGCGGGGCCACATGCGCAGGG - Intronic
1166125956 19:40715503-40715525 GTGGAGGGGCTCCATGTGCAAGG - Intronic
1166385226 19:42376824-42376846 GTGGAGGGACCCCAAGTCCAGGG - Exonic
1167291859 19:48629127-48629149 GTTGAGGGACAGGATGGGCAGGG - Exonic
1168682686 19:58327321-58327343 GTGGACGGACCGTGTGTGCACGG + Intronic
925093315 2:1172824-1172846 GTGGAGGGACAGCATCAGGAAGG - Intronic
925762649 2:7200510-7200532 GTGAAGAGACAGCATGCGCCAGG - Intergenic
927503170 2:23595792-23595814 GTGGAGAGACAGCATGGGAAGGG - Intronic
928528760 2:32169260-32169282 GTGGAAGGATCGCATGAGCCCGG - Intronic
929571412 2:43025429-43025451 GTGGGGGAACCACATGCCCATGG + Intergenic
933893684 2:86791824-86791846 GCCGAGGGACCGCAAGTGCAAGG - Intronic
937241490 2:120465209-120465231 GTGGTGAGACCGCATGCCCCGGG - Intergenic
945277054 2:207998416-207998438 GTGGAAGGATCGCATGAGCGTGG + Intronic
945649190 2:212538331-212538353 GTGGAGGGACCGCTTGACCGGGG - Intronic
946373555 2:219294932-219294954 CTGGAGGGACCGCATGGGCGGGG - Intronic
948046702 2:234951491-234951513 GTGGAGGGAAGGCAGGCGCGAGG - Intergenic
948374278 2:237511060-237511082 GTGGAGGGACCGGATGACCTTGG - Exonic
1169359853 20:4938839-4938861 TTGGAGGGATGGCATGAGCAGGG - Intronic
1172123044 20:32609692-32609714 GTGGAGGGAGGGAATGAGCATGG - Intergenic
1175872229 20:62213958-62213980 GTGGAGGGTCCACCTGGGCAGGG - Intergenic
1181052579 22:20244777-20244799 GTGGAGGCCCCACATGCTCATGG + Intronic
1181888217 22:26038508-26038530 GTGGTGGGACTCCATGGGCATGG - Intergenic
1183065036 22:35356890-35356912 GTGGGAGGACCGCTTGAGCAGGG - Intergenic
1183095064 22:35547054-35547076 GAGGATGGACAGCCTGCGCATGG - Exonic
1183781619 22:40002565-40002587 GTGGAGGGATCCCATGCGGCTGG + Intronic
950467065 3:13161949-13161971 GTGGGGGAACAGCATGTGCAGGG - Intergenic
954485679 3:50849126-50849148 GTGGAGGGGCCGCTTGAGCTTGG - Intronic
960047411 3:113211581-113211603 ATGGAGGGACCGGGTGCGCTGGG + Exonic
963606318 3:147414023-147414045 GGGGAGGGACCGGATGGGCGGGG + Exonic
968214359 3:196875821-196875843 GTGGAAGGATCGCTTGGGCATGG - Intronic
968657542 4:1785216-1785238 GTGGAAGGTCCCCATGGGCAGGG + Intergenic
972513572 4:39792534-39792556 GTGGTGGGACTGCTTGGGCACGG + Intergenic
979104509 4:116667285-116667307 GTGCAGGGACTGCATAGGCAAGG - Intergenic
986968760 5:13306900-13306922 GTGGAGGGAATCCATGTGCAAGG + Intergenic
991065176 5:62416816-62416838 GTGGAGGGATCGCTTGAGCCTGG - Intronic
1000257920 5:159558512-159558534 CTGGAGGGACACCATGCCCAAGG + Intergenic
1001677575 5:173531327-173531349 GTGGAGAGACAGCATGTGCTTGG - Intergenic
1005889538 6:30125742-30125764 GTGGATGGACGGCTTGCGCTTGG - Intergenic
1006054242 6:31369337-31369359 GTGCAGGGACTCCATGAGCAAGG - Intergenic
1006870488 6:37246807-37246829 GTGGAAGGACTGCTTGAGCATGG + Intronic
1016040653 6:139428792-139428814 GTGGAGGGACTGCTTGAGCCCGG - Intergenic
1020058810 7:5136959-5136981 ATGGAGGGACCGGCTGGGCACGG + Intergenic
1029650282 7:101886732-101886754 GAGCAGGGACCGCAGGCACAAGG + Intronic
1034566551 7:151920136-151920158 GTGGAAGGATCGCTTGAGCATGG + Intergenic
1035343005 7:158176558-158176580 GTGGAGGGACTGCTAGTGCAGGG + Intronic
1040439425 8:47425430-47425452 GTGCAGGGTCTGCATGGGCATGG + Intronic
1045649245 8:104327142-104327164 GTAGAGGCACCTCTTGCGCAAGG - Intergenic
1056220310 9:84445404-84445426 GTGGAGGGATCACATGAGCCTGG - Intergenic
1059177234 9:112178588-112178610 GTGGAGGGATCGCTTGAGCTTGG - Intergenic
1060524528 9:124313021-124313043 GTGGAGCAACCGCAGGCGCAAGG - Intronic
1062268777 9:135699480-135699502 GCGGAGCGACCCCACGCGCACGG + Exonic
1062316603 9:135970444-135970466 GAGGAGGGACGGCATGAGGAGGG - Intergenic
1199979417 X:152912805-152912827 GTGGAGTGGCCCCATGGGCAGGG - Intergenic