ID: 1132754117

View in Genome Browser
Species Human (GRCh38)
Location 16:1474495-1474517
Sequence GTCCCCCAGACTGGCCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132754117_1132754124 13 Left 1132754117 16:1474495-1474517 CCTTTAGGGCCAGTCTGGGGGAC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1132754124 16:1474531-1474553 AACGTGCGCCACGGCTGCCCCGG 0: 1
1: 0
2: 0
3: 0
4: 49
1132754117_1132754123 4 Left 1132754117 16:1474495-1474517 CCTTTAGGGCCAGTCTGGGGGAC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1132754123 16:1474522-1474544 GAGGGAATGAACGTGCGCCACGG 0: 1
1: 0
2: 1
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132754117 Original CRISPR GTCCCCCAGACTGGCCCTAA AGG (reversed) Intronic
900177274 1:1296396-1296418 CACCCCCAGCCTGGCCCTCAGGG + Intronic
908257643 1:62316151-62316173 GTCCCCCAGTCTGGCCCACATGG + Intronic
912926519 1:113917990-113918012 GTCACCCAGCCTCACCCTAAAGG + Intergenic
913200393 1:116491234-116491256 GTCCCCCAACCTGGCCATGAGGG + Intergenic
915349475 1:155215432-155215454 GTTCCCCAGAGTTGCCCAAAAGG + Intergenic
918379656 1:183941289-183941311 GAACCCAAGAGTGGCCCTAAGGG + Intronic
919796844 1:201325942-201325964 GTCTCTCAGACTGTCCCGAAGGG - Intronic
920422679 1:205845794-205845816 GCCCCCAAGCCTGGCCTTAATGG - Intronic
922717061 1:227883288-227883310 GACCCCCAGCCTGGCCCTGCAGG - Intergenic
923262907 1:232284382-232284404 GAGCCACACACTGGCCCTAATGG + Intergenic
1075835726 10:125451008-125451030 GTCCCCCTGACTTGCTCCAAGGG - Intergenic
1077076112 11:702982-703004 GGCCGCCAGCCTGGCCCTCACGG + Exonic
1077171459 11:1168136-1168158 GTCCACGTGACTGTCCCTAAAGG + Intronic
1078262792 11:9726800-9726822 TTCCCACAGACTGGCCTCAAAGG - Intronic
1083340330 11:61955098-61955120 CACCCCCAGGCTGGCCCTCACGG + Exonic
1088483764 11:110321178-110321200 GTCACCACGCCTGGCCCTAATGG + Intergenic
1088953018 11:114589471-114589493 GTCCCCCCAACTGCACCTAAGGG - Intronic
1089500679 11:118929634-118929656 GTCCACCAGGCTGGCACTCAAGG - Intronic
1092361430 12:7839881-7839903 GTCGCCCAGGCTGGTCCAAAAGG - Intronic
1096235378 12:49922785-49922807 GTCCCCCAGACTGGCCTAGGAGG + Intergenic
1101676091 12:106917893-106917915 ATCCCCCATGCTGACCCTAAAGG + Intergenic
1104792710 12:131493805-131493827 GCCCCTCAGACTGCCCCTTAGGG - Intergenic
1115076316 14:29395897-29395919 ATCCCCCAGACTGCATCTAAAGG + Intergenic
1117251719 14:53946360-53946382 GACCTGCAGACTGGCCCTGAAGG - Intergenic
1122362653 14:101176509-101176531 GGCCCCCAGCCTGGCCCTCCTGG + Intergenic
1124350904 15:28954913-28954935 GTCCCTCACTCTGGCCCTCAGGG + Intronic
1125800777 15:42444686-42444708 GTGCCCCAGACTGTGCCTAATGG - Intronic
1132754117 16:1474495-1474517 GTCCCCCAGACTGGCCCTAAAGG - Intronic
1132973055 16:2698286-2698308 GTCTCCCCGACCGGCCCTCATGG - Intronic
1133232466 16:4373061-4373083 GCCCCCTGGACTGGCCCTAATGG - Intronic
1140408357 16:74725724-74725746 GACCCCCAGACTGGGAGTAATGG - Intronic
1141026852 16:80556851-80556873 GTCCTCCTGACTGGCCATATTGG - Intergenic
1142228346 16:88888267-88888289 GTACCCCAGACTGGGCCTGGCGG + Intronic
1143108476 17:4541026-4541048 GTCCCCCGGTCTGGCCCAGAGGG - Intronic
1143511315 17:7396714-7396736 GACCTCCAGAGTGGCCCAAAGGG - Intronic
1149100974 17:52906699-52906721 GTCCCACAGACTAGTCCTACTGG + Intergenic
1152417888 17:80174871-80174893 TTCCCGCAGTCTGTCCCTAAGGG + Intronic
1152749933 17:82057974-82057996 GGCCCCCAGAGTGGGCCGAAGGG + Exonic
1152823499 17:82449350-82449372 GGCCTCCAGACTGGGCCTGATGG - Intronic
1157786943 18:50492219-50492241 TTCCCTCAGACTGGCCTAAACGG + Intergenic
1159805468 18:72952472-72952494 GTCCCTCAGCATGGCCCTGAGGG - Intergenic
1162382503 19:10339768-10339790 GTCCCCCACCCTGGCCCCCAAGG - Exonic
1163155592 19:15438484-15438506 GTCCCCCTGCTTGGCGCTAAGGG + Intronic
1164220774 19:23191583-23191605 AGCCACCACACTGGCCCTAAAGG - Intergenic
1164792543 19:31000610-31000632 GTCCCCTAGACTGGTCCTCCTGG - Intergenic
1164881788 19:31738951-31738973 GTCCACCATTCTGGCCCTATGGG + Intergenic
1166044025 19:40218882-40218904 GCCACCTCGACTGGCCCTAAAGG - Intergenic
1167534964 19:50044081-50044103 GTCTTCCACACTAGCCCTAAAGG - Intronic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
925845921 2:8033288-8033310 GACCCCCAGACTTGCAGTAATGG - Intergenic
929592999 2:43158995-43159017 GTCCCCAAGACTGGGCCACAAGG - Intergenic
932456787 2:71854492-71854514 GTCCCCCAGAATTGCACAAAAGG - Intergenic
937288108 2:120765665-120765687 GTTCCCCAGACCTGCCCTAACGG - Intronic
938415859 2:131103192-131103214 GTCCCTAAGACTGACCCTGAAGG + Intergenic
940518504 2:154712912-154712934 TTCCCCCAGACTGGACCAAAAGG - Intronic
941312860 2:163955727-163955749 CTCCTCCAGACTGCCCCTCAAGG - Intergenic
945428985 2:209742217-209742239 GTTTTCCAGACTGGCCCTGAAGG - Intergenic
948831627 2:240601143-240601165 GTCCCCGAGGCAGGCCCTGAAGG + Intronic
1170038121 20:12011603-12011625 CTCCTCCAGACTGCCCCAAAGGG + Intergenic
1170672087 20:18443854-18443876 GTCCCTCAGACTGGGCTCAATGG - Intronic
1181024898 22:20122639-20122661 GTCAGCCAGACGGGCCCTGATGG + Intronic
1182953203 22:34396744-34396766 TTCACCCAGACATGCCCTAAGGG - Intergenic
950128599 3:10526685-10526707 CACCCCCTCACTGGCCCTAATGG - Intronic
960592045 3:119376200-119376222 GCCACCAAGCCTGGCCCTAAGGG - Intronic
960997520 3:123349778-123349800 GTCATCCAGTCTGGCCCTGAAGG - Intronic
974036754 4:56824210-56824232 GTCCCCCTGACAGACCCTATGGG + Intergenic
974943459 4:68496636-68496658 GTCCTCCAGAGTCACCCTAAAGG - Exonic
979468749 4:121071500-121071522 GTCCCGCAGACTTTCCCTAGCGG + Intronic
984759031 4:183348125-183348147 GTCCCAGACACTGGCCCCAATGG + Intergenic
985880119 5:2633031-2633053 GTCCCCCCGTCTGGCCATCAGGG + Intergenic
999090049 5:148928034-148928056 TTGCCCTGGACTGGCCCTAAAGG + Intronic
999231661 5:150065453-150065475 GTCCCCCAGAGTGACCACAAGGG - Intronic
1000533847 5:162456534-162456556 GTCCCCCAGGCTGGCCTCAGAGG - Intergenic
1000630443 5:163584958-163584980 GTAAACCAGAGTGGCCCTAAAGG + Intergenic
1002521314 5:179794527-179794549 CTTTCTCAGACTGGCCCTAAAGG + Intronic
1009465886 6:63968742-63968764 CTCCCCCAGACAGGCTCAAAAGG + Intronic
1017644399 6:156525994-156526016 TTCCCCCAGACTGGACAGAAAGG - Intergenic
1019465574 7:1186244-1186266 GTCACCCAGACTGGAGCTCAGGG - Intergenic
1025256467 7:57386848-57386870 AGCCCCCAGACTGGCTCTCACGG - Intergenic
1026891998 7:73987762-73987784 TTCTCCCACACTGGCCCTACTGG - Intergenic
1036259764 8:7230226-7230248 TTCTCCCAGCCTGGCCCCAAGGG + Intergenic
1036311807 8:7688796-7688818 TTCTCCCAGCCTGGCCCCAAGGG + Intergenic
1041720632 8:60972161-60972183 GTCACACAGAGAGGCCCTAATGG - Intergenic
1060936354 9:127518343-127518365 GCCACCCAGAATGGCCCTAGAGG + Intronic
1061386110 9:130290217-130290239 GTCCCCAGGCCTGGCCCTACAGG + Intronic
1062034708 9:134377846-134377868 GTCCCCCATACTGGTTCTGATGG - Intronic
1203746819 Un_GL000218v1:44688-44710 CTGCCCCAGACTGCCCCTGAGGG - Intergenic
1186706524 X:12145791-12145813 GACACCCAGACTGCCCCAAAGGG - Intronic
1197961920 X:132016423-132016445 GTCTCGCAGTCTGTCCCTAATGG + Intergenic
1198657508 X:138931090-138931112 GTCCCAAAGATTGGCCATAAGGG - Intronic