ID: 1132754260

View in Genome Browser
Species Human (GRCh38)
Location 16:1474979-1475001
Sequence CGCCGCGGAGCGACACCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132754253_1132754260 3 Left 1132754253 16:1474953-1474975 CCTTCTTAGAGACGTTGGCCATG 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1132754260 16:1474979-1475001 CGCCGCGGAGCGACACCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 46
1132754247_1132754260 26 Left 1132754247 16:1474930-1474952 CCGGTCCCGGCCGGACCAGGACA 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1132754260 16:1474979-1475001 CGCCGCGGAGCGACACCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 46
1132754248_1132754260 21 Left 1132754248 16:1474935-1474957 CCCGGCCGGACCAGGACACCTTC 0: 1
1: 0
2: 2
3: 11
4: 120
Right 1132754260 16:1474979-1475001 CGCCGCGGAGCGACACCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 46
1132754250_1132754260 16 Left 1132754250 16:1474940-1474962 CCGGACCAGGACACCTTCTTAGA 0: 1
1: 1
2: 0
3: 17
4: 127
Right 1132754260 16:1474979-1475001 CGCCGCGGAGCGACACCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 46
1132754246_1132754260 27 Left 1132754246 16:1474929-1474951 CCCGGTCCCGGCCGGACCAGGAC 0: 1
1: 0
2: 1
3: 8
4: 118
Right 1132754260 16:1474979-1475001 CGCCGCGGAGCGACACCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 46
1132754251_1132754260 11 Left 1132754251 16:1474945-1474967 CCAGGACACCTTCTTAGAGACGT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1132754260 16:1474979-1475001 CGCCGCGGAGCGACACCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 46
1132754249_1132754260 20 Left 1132754249 16:1474936-1474958 CCGGCCGGACCAGGACACCTTCT 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1132754260 16:1474979-1475001 CGCCGCGGAGCGACACCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132754260 Original CRISPR CGCCGCGGAGCGACACCGGC CGG Exonic
901796229 1:11681080-11681102 CGCCGCGGGGAGCCACCGACCGG + Exonic
905505526 1:38476331-38476353 CGCGGAGCAGCGAAACCGGCCGG + Intergenic
906168600 1:43706120-43706142 TGCCCCGGAGCTGCACCGGCTGG + Intronic
914753044 1:150548972-150548994 CGGCGCGGCGCGGCACAGGCGGG - Intergenic
916497201 1:165356588-165356610 CGCTGAGGAGCGACGCGGGCTGG - Exonic
1078057519 11:8019638-8019660 CCCGGCGGAGCGACCCTGGCGGG - Intronic
1078222664 11:9364544-9364566 CGACGGCGAGCGACGCCGGCGGG + Intergenic
1093925260 12:24902962-24902984 CGCAGCGGAGCGAAGCGGGCTGG + Exonic
1116186558 14:41606767-41606789 AGCAGCGGAGCGGCCCCGGCCGG + Intergenic
1128374625 15:67066112-67066134 CGGCGAGGAGCGCCCCCGGCGGG - Exonic
1130613481 15:85381328-85381350 AGCCGCGGAGAGGCACCGACAGG - Intronic
1132754260 16:1474979-1475001 CGCCGCGGAGCGACACCGGCCGG + Exonic
1132842252 16:1983940-1983962 CGCCGCGGATCGACGCCTGAGGG + Intronic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1138180276 16:54936487-54936509 CGGCGCGGAGAGCCTCCGGCTGG + Intergenic
1139631884 16:68236198-68236220 CCCCGCGGGGCGCCACGGGCGGG - Exonic
1142761032 17:2042050-2042072 GGCCGCGCAGCGACCCCTGCGGG + Exonic
1148233058 17:45949275-45949297 GGCCGTGGAGCGGCCCCGGCGGG - Intronic
1160991812 19:1863260-1863282 CGCCGCGGCGCCCCACCTGCTGG - Exonic
1165274292 19:34734432-34734454 CCCCGCGGTGTGACCCCGGCCGG + Intronic
1165861679 19:38912272-38912294 CGCGGCGGGGCGACATCTGCGGG + Intergenic
1166222821 19:41376664-41376686 CGCCGCGGAGGGACAGAGCCTGG + Exonic
1166389666 19:42401988-42402010 CCACGCGCAGCGTCACCGGCTGG + Exonic
929789815 2:45014144-45014166 AGCCGCGGAGCTCCACCGCCGGG + Intergenic
931882401 2:66581487-66581509 ATCCGCGGAGCCACCCCGGCAGG - Intergenic
1172508141 20:35479374-35479396 GGCCGTGGAGCGTGACCGGCAGG + Exonic
1184041478 22:41946633-41946655 CCCCGCGAAGCGGCACGGGCTGG + Intronic
959591912 3:108090991-108091013 CGCCGCCGCGCGTCACAGGCAGG + Exonic
964569217 3:158094513-158094535 CGCCGCGGCCCGACTCCCGCGGG + Intergenic
968820064 4:2843696-2843718 CGCCTCGGGGCGACCCCGCCGGG - Intergenic
991474383 5:67004189-67004211 GGCCGCGGCGCGACCCCAGCCGG - Intronic
1002055770 5:176597239-176597261 CGGCGCCCAGCGACACCTGCAGG + Exonic
1005841840 6:29748855-29748877 CTCGGCGGAGCGGCAGCGGCGGG - Intergenic
1008659503 6:53651856-53651878 CGCCGCGTAGCTCCACTGGCCGG + Exonic
1014741555 6:125153697-125153719 CGCCGCTGGGCGCCACCTGCCGG - Exonic
1019722601 7:2582361-2582383 GGCAGGGGTGCGACACCGGCTGG - Intronic
1022230535 7:28409146-28409168 CGCCCGGGAGCGGCAGCGGCGGG - Intronic
1029996726 7:105014041-105014063 CTCCGCGGAGAGGCAACGGCGGG + Intergenic
1030033282 7:105388388-105388410 CGCCCCGGGTCGCCACCGGCCGG - Intronic
1031468630 7:122144002-122144024 CGCCGCGAGGCGACCCCGGCCGG - Intronic
1032125420 7:129189327-129189349 CGCCGCTGAGCCACTGCGGCCGG + Exonic
1032450232 7:132024285-132024307 CCCAGCGGAGAAACACCGGCTGG - Intergenic
1034982960 7:155490201-155490223 CACCAGGGAGCGGCACCGGCTGG + Intronic
1049419644 8:142511067-142511089 CGACGCGGTGAGACCCCGGCCGG + Exonic
1058110678 9:101028564-101028586 CCCCGCGGAGCGACTGCCGCTGG + Intergenic
1061123122 9:128656503-128656525 CCGCGCGGAGCGACGCGGGCGGG - Intronic
1195966748 X:110436004-110436026 CACAGTGGAGCCACACCGGCAGG - Intronic
1198370640 X:135985688-135985710 AGCCGAGGAGAGCCACCGGCAGG + Exonic