ID: 1132756738

View in Genome Browser
Species Human (GRCh38)
Location 16:1488928-1488950
Sequence GCGGCTGGAGGGAGACTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 7, 3: 26, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132756738_1132756749 3 Left 1132756738 16:1488928-1488950 CCCAGCAGTCTCCCTCCAGCCGC 0: 1
1: 0
2: 7
3: 26
4: 264
Right 1132756749 16:1488954-1488976 AGAGGGTGAAGGTGGCTCCGTGG 0: 1
1: 1
2: 3
3: 31
4: 216
1132756738_1132756747 -5 Left 1132756738 16:1488928-1488950 CCCAGCAGTCTCCCTCCAGCCGC 0: 1
1: 0
2: 7
3: 26
4: 264
Right 1132756747 16:1488946-1488968 GCCGCAGGAGAGGGTGAAGGTGG 0: 1
1: 0
2: 6
3: 61
4: 605
1132756738_1132756746 -8 Left 1132756738 16:1488928-1488950 CCCAGCAGTCTCCCTCCAGCCGC 0: 1
1: 0
2: 7
3: 26
4: 264
Right 1132756746 16:1488943-1488965 CCAGCCGCAGGAGAGGGTGAAGG 0: 1
1: 0
2: 0
3: 36
4: 354
1132756738_1132756750 4 Left 1132756738 16:1488928-1488950 CCCAGCAGTCTCCCTCCAGCCGC 0: 1
1: 0
2: 7
3: 26
4: 264
Right 1132756750 16:1488955-1488977 GAGGGTGAAGGTGGCTCCGTGGG 0: 1
1: 0
2: 1
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132756738 Original CRISPR GCGGCTGGAGGGAGACTGCT GGG (reversed) Intronic
900685562 1:3945744-3945766 GCGGCGGGAGGGAGCCTCCTGGG - Intergenic
901212201 1:7533136-7533158 GACGCTGGAGGGAGACTCCTGGG - Intronic
901403868 1:9033032-9033054 GGGGCAGAAGGTAGACTGCTAGG - Intergenic
903186685 1:21633255-21633277 GAGGCTGGAGGGAGTCAGCAGGG - Intronic
903690867 1:25172586-25172608 GGGGCAGGAGGGAGCCTTCTGGG + Intergenic
906895438 1:49765115-49765137 GGGGGTGGAGGGACACAGCTGGG - Intronic
907192792 1:52662836-52662858 GCTACTGGAGGAAGACTGCTAGG + Intronic
907338373 1:53715682-53715704 GCCGGTGCAGGGAGACAGCTAGG + Intronic
908539409 1:65108444-65108466 GAGGCTAGAGGGTGACTTCTAGG + Intergenic
908582063 1:65526081-65526103 GCGCCTGGAGCGAACCTGCTCGG + Intronic
908942213 1:69448948-69448970 GCGTCTGGAGTCAGACTGCTCGG - Intergenic
910172203 1:84389394-84389416 GCGGCAGGAGGGAGAAGACTTGG + Intronic
912956885 1:114160530-114160552 GGCGCTGGAGTGAGACTGCATGG - Intergenic
915367793 1:155325185-155325207 GTGGCTGGGGGGAGGCTGTTGGG + Intronic
915814497 1:158952191-158952213 GCTGCAGGAGCTAGACTGCTGGG - Intronic
917089497 1:171338414-171338436 GAGGCTGTAGGGAGCCTCCTGGG - Intronic
920184287 1:204150937-204150959 GGGGCTGGAGGTAGTCAGCTGGG + Intronic
922506215 1:226127325-226127347 GACGCTGGAGGGAGGCTGTTAGG + Intergenic
922654890 1:227373429-227373451 GCAGCTGGAGTGCCACTGCTGGG - Intergenic
922696551 1:227733817-227733839 GTGGCAGGAGGGGGGCTGCTTGG - Intronic
922706293 1:227792509-227792531 GCCTCTGGAGGGAGCCTGCTTGG - Intergenic
924527143 1:244863290-244863312 GCGGCGGGAGGGAGCCCGGTCGG - Intronic
924942991 1:248825307-248825329 GCAGCTGGAGAGAGAAGGCTGGG + Exonic
1063506029 10:6600407-6600429 GTGGCTGGAGCAAGACTGATGGG + Intergenic
1064297376 10:14090554-14090576 GCGGCTGGGGGGATGCTGCCTGG - Intronic
1064430037 10:15262891-15262913 GCGGCAGGAGGAAGACCACTCGG + Intronic
1065271941 10:24042131-24042153 GCAGCTGGACGGAAAGTGCTGGG - Intronic
1070777815 10:79120043-79120065 GAGGCTGGGGGGAGAATTCTGGG + Intronic
1070916877 10:80160779-80160801 GGAGCTGCAGGGAGGCTGCTGGG - Intronic
1074184225 10:111087076-111087098 GCTGCTGGGTGGAGACTGATTGG + Intergenic
1074857655 10:117485329-117485351 GCACCTGGAAGGAGACTGCGGGG + Intergenic
1074984327 10:118643570-118643592 GGGGCAAGAGGGAGGCTGCTGGG + Intergenic
1075422278 10:122310462-122310484 GGAGGTGGAGGGAGACTGCAGGG + Intronic
1075553221 10:123409414-123409436 GGGGATGGAGGGAGCCAGCTAGG + Intergenic
1075651445 10:124130286-124130308 GCATGTGGAGGGAGAGTGCTGGG - Intergenic
1075787055 10:125057081-125057103 GGGGCAGGAGGGAGACAGCAAGG + Intronic
1076717722 10:132374867-132374889 CCGGCTGGAAGTAGGCTGCTGGG + Intronic
1078182106 11:9020541-9020563 GTGGGTGGAGGGAGCCTGCAGGG + Intronic
1078455066 11:11468590-11468612 GGGGCTGCAGGGAGGTTGCTGGG + Intronic
1079351249 11:19693865-19693887 GTAGCTGGAGGGAGAATGTTAGG + Intronic
1080233550 11:30044577-30044599 GTGGCTGCAGGGAGACTGTTGGG + Intergenic
1084668677 11:70592489-70592511 GTGGCTGGAGGGGGTGTGCTGGG - Intronic
1084840675 11:71843882-71843904 GCGGCTGGCCGGTGCCTGCTGGG - Intergenic
1085264981 11:75231943-75231965 GCCCCTGGAGGGAGACTTCCTGG + Intergenic
1087404887 11:97718016-97718038 GCGGCAGGCCGGAGCCTGCTGGG - Intergenic
1089340593 11:117754730-117754752 GGGGCTGGAGGGAAGTTGCTGGG + Intronic
1089430970 11:118424196-118424218 GTGGCTGGAGGAAGAGTGGTAGG - Intronic
1089591613 11:119545871-119545893 GCTGCTGCAGGGAGGGTGCTGGG + Intergenic
1090194024 11:124799978-124800000 GCAGCTGGAGGGAGCCGGCACGG - Exonic
1090714420 11:129417435-129417457 GCAGCTGGATGGAGAGTGGTGGG + Intronic
1091778798 12:3200994-3201016 GCGGCCGGAGGTGGACGGCTTGG - Intronic
1091798185 12:3309083-3309105 TGGGCTGGAGGGAGACAGTTGGG + Intergenic
1092002320 12:5043221-5043243 GCGGGTGGAGGGGTTCTGCTGGG + Intergenic
1093177796 12:15932843-15932865 GAGGCTGGAGAGAGACGACTGGG - Intronic
1094350149 12:29515389-29515411 GCTGCTGGGAGGAGACTCCTTGG - Intronic
1095568060 12:43649581-43649603 GCAGCTGGAGGAAGAATGCCTGG - Intergenic
1096741288 12:53695766-53695788 GGGGCTGCAGGGAGACAGGTGGG + Intergenic
1098237338 12:68430005-68430027 TGGGCGGGAGGGAGCCTGCTGGG + Intergenic
1101200212 12:102427658-102427680 GTGTCTGGAGGGAGAGTGTTGGG + Intronic
1102301577 12:111775319-111775341 GGGTCTGAAGGGTGACTGCTAGG - Intronic
1102679779 12:114683593-114683615 GGGGCTGGAGAGAGATTCCTGGG - Intronic
1103575339 12:121873249-121873271 CCAGCTGTAGGGAGACTGGTTGG + Intergenic
1103583741 12:121935862-121935884 CCGGCTGGAGGCAGACTGAATGG + Intronic
1103599139 12:122043292-122043314 GCGTCTGGAGGCAGCCAGCTGGG - Intronic
1103959386 12:124599199-124599221 GGGGCAGGAGGGAGCCTCCTGGG - Intergenic
1104729045 12:131094979-131095001 GCGTCTCGAGGGAGACTGGAGGG - Intronic
1104770896 12:131363678-131363700 GCGGGTGGAGGAAGTCTGCAGGG - Intergenic
1105851306 13:24338991-24339013 GCGGCTGGCCGGCGCCTGCTGGG + Intergenic
1106079349 13:26487734-26487756 GCAGGTGGAGGGAGACTCCTGGG - Intergenic
1106304215 13:28495444-28495466 CCGGGTGGAGGGAGTCTGCAAGG - Intergenic
1107358770 13:39596909-39596931 ATGACTTGAGGGAGACTGCTTGG - Intronic
1112356106 13:98675993-98676015 GGGGCTGCAGCGAGACTGCAGGG - Intergenic
1113501015 13:110774343-110774365 GGGGCTTGAGGGAGCCTGTTTGG - Intergenic
1113647327 13:112007931-112007953 GGGGCTGGAGTGAGACAGCCTGG - Intergenic
1113798111 13:113070581-113070603 GCCGCAGGAGGGAGACGTCTGGG - Intronic
1118693808 14:68364418-68364440 CAGGCTGGAGGGAGACTCCTGGG + Intronic
1118768317 14:68924964-68924986 GTGGCTCGAGGGAGAGGGCTGGG + Intronic
1121180688 14:91926297-91926319 GCTGCTGGAGGGAGGCTGTCTGG + Intronic
1121797557 14:96747657-96747679 CAGGCTGGAGGGGCACTGCTGGG + Intergenic
1121938638 14:98045193-98045215 GCTGCTGCAGGTAGACAGCTTGG - Intergenic
1122447558 14:101781066-101781088 GTAGCTGGAGGGAGACGGCTAGG - Intronic
1122615689 14:103016353-103016375 GGTGCTGGAGGGAGACTACAAGG - Intronic
1122657930 14:103274212-103274234 GCCGCTGGAGGGTGCCTGCCGGG - Intergenic
1122865906 14:104603896-104603918 GGAGCTGGAGAGAGACTGCAGGG - Intronic
1123005787 14:105323045-105323067 CAGGCTGGAGGGAGACGTCTGGG + Intronic
1128228326 15:66018099-66018121 GAGGCTGGAGGGACCCTGCTGGG - Intronic
1128730518 15:70017714-70017736 CAAGCTGGAGGGAGACTGATGGG + Intergenic
1128982376 15:72197219-72197241 GCGGCTGCGGGGAGGCAGCTCGG - Intronic
1129198615 15:73985462-73985484 GGGGCTGGAGGTAGACCGCGTGG - Exonic
1129479002 15:75808233-75808255 GGGGCTGGAGGGAGACCTCATGG - Intergenic
1130573387 15:85069304-85069326 GAGGCTGGATGGAGAGTGCTAGG - Intronic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1132756738 16:1488928-1488950 GCGGCTGGAGGGAGACTGCTGGG - Intronic
1132847362 16:2006693-2006715 GTGGCTGGAGGGAAATGGCTGGG + Intronic
1132889179 16:2195881-2195903 GGGGCGGGAGGGGGTCTGCTAGG + Intronic
1134215192 16:12311731-12311753 GCTGCTGGAGGCAGAGAGCTTGG + Intronic
1135594107 16:23728184-23728206 GAGGCTTGAGGGAGGCTCCTGGG + Intergenic
1138692047 16:58777318-58777340 GCAGCTGGATGCAGAATGCTTGG + Intergenic
1141573832 16:84951545-84951567 CCTGCTGCAGGGAGAATGCTGGG + Intergenic
1141680117 16:85538867-85538889 GGGGCTGGAGAGGGACTGGTGGG - Intergenic
1141727348 16:85798971-85798993 CCTGCTGGAGGGCGACCGCTGGG + Intronic
1142590914 17:1005597-1005619 GCGGGTGGAGGAAGACTGAGGGG + Exonic
1143702586 17:8672390-8672412 GCGGCGGGAGGGAGAAGTCTGGG - Intergenic
1143719255 17:8798701-8798723 GTGGCTGGAGGCAGACTCTTGGG + Exonic
1143844265 17:9760923-9760945 GGGTCTGGAGGAAGACAGCTGGG + Intergenic
1143923090 17:10346433-10346455 GGAGCTGGAGGGAGGCTGCCTGG + Intronic
1144657323 17:17045088-17045110 GGGGCTTGGGGGAGACTGATGGG - Intronic
1145055863 17:19703717-19703739 ACAGCTGGAAGGAGAGTGCTGGG + Intronic
1145246841 17:21275245-21275267 CCGGGTGGAGGAGGACTGCTGGG - Intergenic
1146004630 17:29153554-29153576 GCCTCTGGAGCCAGACTGCTTGG - Intronic
1146693730 17:34893505-34893527 GCGGCAGGAGGGATTCTGGTTGG - Intergenic
1147261113 17:39210266-39210288 GACGCTGGAGGGAAACGGCTTGG - Intergenic
1147546199 17:41403608-41403630 GTTGCTGGAGGCAGGCTGCTTGG + Intergenic
1147671546 17:42179846-42179868 GGAGCTGGAGGGAGACAGCTCGG - Intronic
1148558770 17:48594115-48594137 GCGACTGCAGGGAGCCTGCAGGG - Intronic
1148674653 17:49438425-49438447 GCTGCTGGAGGGACGCTGCAGGG + Intronic
1149186301 17:54001710-54001732 GTGGCTGGAGGGAGGCTACATGG - Intergenic
1149524032 17:57340245-57340267 GCGTCTGGAGGCCGACTCCTTGG - Intronic
1151595839 17:75077641-75077663 GCGGCTCGAGGAAGGCTGCCAGG - Intergenic
1152161117 17:78669345-78669367 GCTGCTGGAGGGAGAATTGTTGG - Intergenic
1152338349 17:79710261-79710283 GGGGCTGGTGGGTGAATGCTAGG - Intergenic
1152495350 17:80667240-80667262 GAGGCTGGAGGGGGACAGCCGGG + Intronic
1152596646 17:81240995-81241017 GACGCTGGAGGGAGGCTGTTAGG + Exonic
1152705577 17:81841868-81841890 GCAGCTCTAGGGAGGCTGCTCGG - Intergenic
1153238853 18:3013132-3013154 GCGGCTGGACTGCGACGGCTAGG + Intronic
1156229652 18:35140987-35141009 GCTGATGGAGGAACACTGCTGGG - Exonic
1158214574 18:55086573-55086595 GCCTCTGGAGGCTGACTGCTGGG - Intergenic
1160317319 18:77859768-77859790 GAGGCTGGAGGGAGGCAGGTAGG + Intergenic
1160864912 19:1252230-1252252 GCGGCTGGAGGGGGGCTCCTCGG - Intronic
1161062529 19:2222336-2222358 CTTGCTGGAGGGCGACTGCTTGG - Exonic
1161979120 19:7621372-7621394 GCGTCTGTAGGGAGCCTGCCAGG + Intronic
1163130795 19:15271649-15271671 CCTGCGGGAGGGAGACTGTTGGG - Intronic
1163439372 19:17313942-17313964 GCACCTGCAGGGTGACTGCTGGG - Intronic
1164619200 19:29683902-29683924 CGGGCTAGAGGGAGACTTCTGGG - Intergenic
1164724812 19:30458907-30458929 GCAGCTGGAGGGGCACTGCCAGG + Intronic
1166015825 19:39978641-39978663 GTGGCTGGAAGGAGAGTCCTGGG + Intronic
1166200846 19:41237126-41237148 GGGGCCTGAGGGAGACTTCTTGG - Intronic
1166524981 19:43504958-43504980 GGGGCTCGAGGGAGACTGGGAGG - Intergenic
1168316283 19:55486101-55486123 GAGGCTGGAGGGAGGCTGCTGGG - Intronic
925309787 2:2874472-2874494 GGGCCTGGAGGGAGACTTTTGGG - Intergenic
925662078 2:6213262-6213284 GAGGCTGGTGGGAGCTTGCTGGG - Intergenic
926176930 2:10601974-10601996 GCGGCTGCAGACAGACTGCAAGG + Intronic
926328834 2:11808291-11808313 GAGGCTTGAGAGAGCCTGCTAGG - Intronic
929501157 2:42493046-42493068 GCGCCTGGAGGGAGCCGCCTCGG + Exonic
931223676 2:60310686-60310708 GCGGCTGGTGGGAAATTGCCAGG - Intergenic
931763660 2:65436476-65436498 GGGGCTTGGGGGAGACAGCTGGG - Intergenic
933782334 2:85811259-85811281 GCGGCTGGAAGGCGGCGGCTGGG + Intergenic
934989461 2:98911233-98911255 GGGGCTCAAGCGAGACTGCTGGG + Intronic
935278468 2:101496516-101496538 GTGCCTGGAGAGAAACTGCTTGG - Intergenic
936048621 2:109205768-109205790 GCTGCTTCAGGGAGGCTGCTGGG - Intronic
937263626 2:120602015-120602037 GAGCCTGCAGGGAGGCTGCTGGG - Intergenic
938083712 2:128384713-128384735 ACTGCTGCAGGGAAACTGCTGGG - Intergenic
942247468 2:174020965-174020987 GACTCTGGAGGCAGACTGCTTGG - Intergenic
947863880 2:233382524-233382546 GGGGCTGCAGGCAGACAGCTGGG - Intronic
947909700 2:233792935-233792957 GGCGCCGGAGGGAGACTGCTGGG + Intronic
948088213 2:235267964-235267986 GGGGCTGGAGGCAGGCTGGTGGG - Intergenic
948586137 2:239020907-239020929 GCGGGTGTTGGGAGCCTGCTCGG + Intergenic
948832337 2:240604135-240604157 GCGGCTTGGGGGAGACACCTGGG + Intronic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
949079775 2:242087991-242088013 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1169021194 20:2332368-2332390 GGGGCTGCAGGGTGTCTGCTGGG + Intronic
1172611030 20:36252765-36252787 GAGGTTGTGGGGAGACTGCTGGG - Intronic
1173232806 20:41214419-41214441 GGCTCTGGAGCGAGACTGCTTGG - Intronic
1173576708 20:44116674-44116696 GCCTCTGGAGCCAGACTGCTGGG - Intronic
1173645646 20:44631620-44631642 GGGGCTGGAGGGAGACCATTAGG - Intronic
1176120136 20:63450534-63450556 GGGGGTGGGGGAAGACTGCTGGG + Intronic
1176204678 20:63881888-63881910 GTGGCTGCAGGGATACTGTTGGG - Intronic
1177320382 21:19512976-19512998 TGGGCTGAAGGGGGACTGCTGGG - Intergenic
1178660741 21:34505517-34505539 GAGGCTGGAGGGAGAGTGTGAGG + Intergenic
1178914120 21:36697620-36697642 GCCCCTGGAGGGAGCCTGCTCGG + Intergenic
1179407950 21:41140737-41140759 GCGGCAGCAGCGACACTGCTGGG - Intergenic
1180878331 22:19185868-19185890 GCTGCTGGGAGGAGACAGCTGGG - Intronic
1182172515 22:28247141-28247163 GCGGCTGCTGGGTGCCTGCTAGG + Intronic
1183588948 22:38769009-38769031 CCGGCTGCAGCGAGACTGCGTGG + Intronic
1184177364 22:42795877-42795899 GGGGCTGGGGGGAGACTGAGGGG + Intergenic
1184554189 22:45224488-45224510 ATGGCAGGAGGGAGACTGCCCGG + Intronic
1184717533 22:46290479-46290501 GTGGCTGGAGGGTGAGTGTTAGG + Intronic
1184717554 22:46290564-46290586 GTGGCTGGAGGGTGAGTGTTAGG + Intronic
1184717562 22:46290595-46290617 GTGGCTGGAGGGTGAGTGTTAGG + Intronic
1184717576 22:46290652-46290674 GTGGCTGGAGGGTGAGTGTTAGG + Intronic
1184783220 22:46659347-46659369 GAGGCTGGAGGGAGGCTGAGTGG - Intronic
1184907248 22:47497171-47497193 GAGGATGGAGCGAGGCTGCTGGG + Intergenic
1185014046 22:48333242-48333264 GAGGCTGGAGGGAGGCGGGTTGG - Intergenic
1185222704 22:49636936-49636958 GCGGCTGGAGGGATGTGGCTGGG - Intronic
949473154 3:4417787-4417809 GGGGCTGGAGGGAGCCCACTTGG + Intronic
950222185 3:11204924-11204946 GGGGCTGGAGGGAGCCTGGTTGG - Intronic
950627176 3:14255970-14255992 GAGGCTGGAGGGAGCTTGCTGGG - Intergenic
952016100 3:28959054-28959076 GCAGCTGGAGGCAGAGTCCTGGG + Intergenic
953571937 3:44078176-44078198 GGGGCTGGAGGGAGGCAGTTAGG - Intergenic
954330130 3:49885423-49885445 GCAGCTGGATGGAGAAAGCTGGG + Intergenic
954758975 3:52860565-52860587 GCAGCTGGAGGGAGCCTGCTGGG - Intronic
957277470 3:78108536-78108558 GCGGCTGCAGGGGGTGTGCTGGG + Intergenic
959811517 3:110625651-110625673 GCAGCTGGAGGGGGACTGGAAGG + Intergenic
960369134 3:116811705-116811727 GCTGCTGGGGTCAGACTGCTGGG + Intronic
960776053 3:121254706-121254728 GCAGCTAGAGGGAGACTACAGGG - Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961508430 3:127387196-127387218 GCGGGGGGATGGACACTGCTGGG - Intergenic
961816786 3:129555258-129555280 GGGGCTGGAGGGGGGCAGCTGGG - Exonic
961863850 3:129939247-129939269 GGGGCATGAGGGAGCCTGCTGGG - Intergenic
966484705 3:180454809-180454831 GCGTCTGGTGGAAGACAGCTAGG - Intergenic
966790793 3:183667593-183667615 GGGGCTGGTGGGGGACTGGTCGG - Intronic
967147204 3:186616372-186616394 GTGCCTGGAGGGAGCCTGCCCGG + Intronic
967392659 3:188972537-188972559 TCGGCTGCCGGGAGACTGCTGGG - Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969605844 4:8201886-8201908 GTGGATGGAGAGAGGCTGCTGGG + Intronic
970188643 4:13488689-13488711 GTGGCATGAGGGAGTCTGCTGGG - Intergenic
970456190 4:16226479-16226501 GAGGCTGGAGGGAGGCGGCGGGG - Exonic
971301923 4:25449000-25449022 GCGCCTGGAGGGAAACAGCTGGG + Intergenic
972322274 4:37982983-37983005 GGGCCTGGAGCGAGACTGCTGGG + Intronic
972784634 4:42315326-42315348 GCGGCCGGTGGGCGCCTGCTGGG - Intergenic
974459781 4:62172520-62172542 GAGACTGTAGGGTGACTGCTAGG - Intergenic
974615185 4:64271425-64271447 GCGGCTGGAGGCAAATTGCTAGG + Intergenic
979349681 4:119629029-119629051 GCGGCTGGAAGGAGGCCGCGCGG + Intergenic
980119119 4:128709541-128709563 GTGGGTGCAGAGAGACTGCTAGG - Intergenic
984012577 4:174388327-174388349 GAGGCTTGAGGGAGTCTGCCTGG + Intergenic
985867428 5:2524765-2524787 GTGGCAGGAGGAAGACTGCATGG + Intergenic
986285297 5:6354490-6354512 GAGGCTGGAGGGAGACAGGCTGG + Intergenic
988629933 5:32918011-32918033 GTGGCAGGAGGGAGACGGTTGGG - Intergenic
993786497 5:92145001-92145023 GCTGTGAGAGGGAGACTGCTTGG + Intergenic
994874042 5:105392499-105392521 TCGGCTGGAGCGAGGCTGCAGGG - Intergenic
995142618 5:108749553-108749575 GCGGGTCAAGGGAGACTGCGGGG - Intronic
995523363 5:113031438-113031460 TCCGCTGGAGGAGGACTGCTGGG - Intronic
999239075 5:150117183-150117205 GGGGCCAGAGGGAGCCTGCTTGG - Intronic
1001687157 5:173602295-173602317 GAGACTGGAGGGACACTGATGGG + Intergenic
1001734648 5:173988760-173988782 GGGGCTGGAGGGAGAAAGCTGGG - Intronic
1002576901 5:180179086-180179108 GGGGCTGGAGGGAGAGTCGTGGG + Intronic
1003094721 6:3133289-3133311 GAGGCTGGCGGGAGCCTGGTGGG - Intronic
1003139132 6:3456675-3456697 GCGGCTCGAGAGAGAGCGCTCGG + Intronic
1006374352 6:33663637-33663659 TGGGCTGGAGGGAGACAGATGGG + Intronic
1007293097 6:40801816-40801838 GTGGCAGGAGGGAGACTGGGAGG + Intergenic
1007390902 6:41548892-41548914 GTGGCTGGAGGGAGGATACTGGG + Intronic
1011249516 6:85356250-85356272 TCCTCTGGAGGGAGAATGCTTGG + Intergenic
1012971074 6:105731814-105731836 GGGGTGGGAGGGAGACTGCTGGG - Intergenic
1013990765 6:116252141-116252163 GTGGCTGATGGGTGACTGCTAGG - Exonic
1015671857 6:135699769-135699791 GCGGGTGGAGGCAGACAGCCAGG + Intergenic
1016452161 6:144194518-144194540 GGGACTGGAGAAAGACTGCTTGG + Intergenic
1017446336 6:154510293-154510315 GCAGCTGGAGGGAGAGGGCCGGG - Exonic
1017516881 6:155164511-155164533 GCGGCTGCAAGGAGACTCTTTGG - Exonic
1019413070 7:914993-915015 CCGGCTGCAGGGAGGCTGCTGGG - Intronic
1020007214 7:4789256-4789278 GCAGTTGGATGGAGCCTGCTGGG - Intronic
1021279268 7:18697153-18697175 ACTGCTGAAGGGAAACTGCTAGG - Intronic
1022091473 7:27110467-27110489 GGCGCTGGAGGGAGACTGGAGGG + Exonic
1023820036 7:43975490-43975512 GCGGCTGGCGGGGGACTGCTGGG - Intergenic
1024453897 7:49580644-49580666 GAGTCTGGATGAAGACTGCTCGG + Intergenic
1026312557 7:69199790-69199812 TGGGCTAGAGGGAGACTGCACGG - Intergenic
1026534625 7:71229622-71229644 GGGGCTGTTTGGAGACTGCTGGG - Intronic
1027494422 7:78869641-78869663 GCAGCAGGAGAGAGAGTGCTAGG + Intronic
1029748315 7:102528943-102528965 GCGGCTGGCGGGGGACTGCTGGG - Intergenic
1029766262 7:102628030-102628052 GCGGCTGGCGGGGGACTGCTGGG - Intronic
1030549870 7:110945156-110945178 GTGGCTGGAGGGATACTCCGAGG + Intronic
1032092900 7:128920544-128920566 GGGGCAGGAGGGAGAATGGTTGG + Intergenic
1034902178 7:154914561-154914583 GCTGCTGGGAGGAGACGGCTGGG - Intergenic
1035537826 8:406276-406298 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1035610750 8:962504-962526 GCGCCTTGAGGGAGCCTCCTGGG + Intergenic
1035864213 8:3064371-3064393 GCAGCAGGAGGGAGAGAGCTAGG - Intronic
1036507911 8:9372506-9372528 GGAGCTGGAGGGAGAGTGCCAGG - Intergenic
1036837650 8:12088855-12088877 GCGGCTGGCCGGTGCCTGCTGGG + Intergenic
1036859443 8:12335103-12335125 GCGGCTGGCCGGTGCCTGCTGGG + Intergenic
1037880267 8:22570225-22570247 GTGGCTGGATGGAGACAGATGGG + Intronic
1037891507 8:22626307-22626329 TGGGCTGGGGTGAGACTGCTGGG + Intronic
1040436948 8:47399926-47399948 GCCGCTGGAGGGAGGCAGTTCGG + Intronic
1041449857 8:57994824-57994846 GGGCCGGGAGAGAGACTGCTGGG + Intronic
1042036474 8:64539618-64539640 GCCTCTGGAGCCAGACTGCTTGG + Intergenic
1043755601 8:84000184-84000206 GCAGCTGGAGGGGGAAAGCTGGG + Intergenic
1048507493 8:135034327-135034349 GAAGATGGAGGGAGACTACTGGG - Intergenic
1049298343 8:141855708-141855730 GGGCCTGCAAGGAGACTGCTGGG + Intergenic
1049457783 8:142702533-142702555 AGGGCTGGAGAGTGACTGCTGGG - Intronic
1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG + Intergenic
1051617986 9:19024637-19024659 GAAGCTGGAGTGAGACTGCCTGG - Intronic
1054856744 9:69908677-69908699 ACGGCAGGGGGCAGACTGCTGGG + Intergenic
1057922039 9:99105315-99105337 GCGGCGGGCGGGCGACTGCGGGG + Intronic
1058147433 9:101427536-101427558 GAGGCTGGATGGACACTGGTCGG + Exonic
1058566415 9:106289966-106289988 GCTCCTGGGGGGAGACTCCTGGG + Intergenic
1059269882 9:113065324-113065346 CCGGCGGGAGGGAGACCGCCGGG + Intergenic
1059271016 9:113070772-113070794 CCGGCGGGAGGGAGACCGCCGGG + Intergenic
1059272149 9:113076218-113076240 CCGGCGGGAGGGAGACCGCCGGG + Intergenic
1059273284 9:113081660-113081682 CCGGCGGGAGGGAGACCGCCGGG + Intergenic
1059274420 9:113087106-113087128 CCGGCGGGAGGGAGACCGCCGGG + Intergenic
1060597375 9:124856522-124856544 GCGCCTGGTGGGAGACTGCTGGG - Exonic
1060773023 9:126346488-126346510 GAGGCGGGAGGGAGACTCTTGGG + Intronic
1061630988 9:131872082-131872104 GACGCTGGAGGCTGACTGCTGGG + Intronic
1061802385 9:133119686-133119708 GCGGCTGGAGAGGGACCCCTGGG - Intronic
1061892086 9:133627689-133627711 GTAGCTGGAGGGAGGCTGCCTGG + Intergenic
1061927954 9:133815453-133815475 GGGGCGGGAAGGAGACTGATGGG - Intronic
1062717154 9:138016746-138016768 GCGGCGGGAGGCTGACTGCACGG - Intronic
1185736498 X:2500493-2500515 GCGGCTGCACGGGGGCTGCTTGG + Intronic
1186060371 X:5698989-5699011 AAAGCTGGAGGGAGACTGCAGGG - Intergenic
1186194918 X:7100254-7100276 GCTGCAGGAGGGTGTCTGCTTGG - Intronic
1186289474 X:8080827-8080849 GCTGCTGGAGGGGGACTACTGGG + Intergenic
1190516266 X:51226385-51226407 GGCTCTGGAGGGAGACTGCCTGG + Intergenic
1190712829 X:53082112-53082134 GCGACGGGAGGGAAACTGCAGGG - Intergenic
1191157265 X:57287145-57287167 GGGGATGAAGGGAGACTTCTGGG + Intronic
1191953538 X:66619972-66619994 GGGGCGTGAGGGAGCCTGCTGGG - Intronic
1192200704 X:69064860-69064882 GTGGCTGTAGCAAGACTGCTGGG + Intergenic
1192261363 X:69507405-69507427 GAGGCGGGAGGGAGACTGCTAGG - Intronic
1195293438 X:103451386-103451408 GAAGCTGGAGGGAGACAGGTAGG - Intergenic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic
1200163105 X:154019259-154019281 GCGGGTGCAGGGATGCTGCTGGG + Exonic