ID: 1132758161

View in Genome Browser
Species Human (GRCh38)
Location 16:1495998-1496020
Sequence CAGGGAAAACAGAGCGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132758161_1132758166 -7 Left 1132758161 16:1495998-1496020 CCATGCTCGCTCTGTTTTCCCTG 0: 1
1: 0
2: 2
3: 28
4: 336
Right 1132758166 16:1496014-1496036 TTCCCTGGGGCGCCAGATGGCGG 0: 1
1: 0
2: 1
3: 13
4: 163
1132758161_1132758171 26 Left 1132758161 16:1495998-1496020 CCATGCTCGCTCTGTTTTCCCTG 0: 1
1: 0
2: 2
3: 28
4: 336
Right 1132758171 16:1496047-1496069 TGTGCGTTTCACTAGCGAGAAGG 0: 1
1: 0
2: 0
3: 3
4: 39
1132758161_1132758172 29 Left 1132758161 16:1495998-1496020 CCATGCTCGCTCTGTTTTCCCTG 0: 1
1: 0
2: 2
3: 28
4: 336
Right 1132758172 16:1496050-1496072 GCGTTTCACTAGCGAGAAGGAGG 0: 1
1: 0
2: 0
3: 1
4: 21
1132758161_1132758165 -10 Left 1132758161 16:1495998-1496020 CCATGCTCGCTCTGTTTTCCCTG 0: 1
1: 0
2: 2
3: 28
4: 336
Right 1132758165 16:1496011-1496033 GTTTTCCCTGGGGCGCCAGATGG 0: 1
1: 0
2: 1
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132758161 Original CRISPR CAGGGAAAACAGAGCGAGCA TGG (reversed) Intronic
900189606 1:1347834-1347856 CAGGCAAAGCAGAGAGGGCAGGG - Intronic
901880251 1:12189617-12189639 CTGGGAATACACAGAGAGCAGGG + Intronic
902360745 1:15941463-15941485 CAGGCAACCCAGAGCGAGCCTGG - Intergenic
902606832 1:17573668-17573690 CTGGGAAACCAGAGCCAGCCTGG - Intronic
903567202 1:24276893-24276915 CGGGAGGAACAGAGCGAGCATGG + Intergenic
903885299 1:26537486-26537508 CAGGGGAAGCAGAGATAGCAGGG - Intronic
904488195 1:30841487-30841509 CAGGGAAAACAGCGTATGCATGG - Intergenic
905167656 1:36092379-36092401 CAGGGAGGTCAGAGCTAGCAGGG - Intronic
906541811 1:46592627-46592649 CAGGGAGAGCAGGGAGAGCAAGG + Intronic
907454953 1:54569485-54569507 AGGGGAAAACAGAGGGAACAAGG - Intronic
908429829 1:64045648-64045670 CATGGAAAACAGAGAGGGTAAGG - Intronic
908529958 1:65025018-65025040 CAGTGAAAACAGAGCTAAGAGGG - Intergenic
908601632 1:65745457-65745479 CAGGGAAAACTGGGCTTGCAAGG - Intergenic
908640193 1:66214328-66214350 CAGGGAAAAAAAAGCCAGAAGGG - Intronic
915049490 1:153052895-153052917 CAGGGAAGACAAAGAGAGAAAGG + Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
916389409 1:164314738-164314760 AAGCGAAAACAGAGGTAGCAGGG + Intergenic
916724075 1:167507329-167507351 CAGGGAAAACATGGAGAGCCAGG + Intronic
916750402 1:167718500-167718522 AAGGGAAAAGAGAGAGAGCAGGG - Intergenic
917491955 1:175505370-175505392 CAGGGCTGACTGAGCGAGCAGGG + Intronic
918517181 1:185375954-185375976 CAGGGAAAACAATCCGAGAAAGG - Intergenic
919630846 1:199959159-199959181 TAGGGAAAACAGGGCGAACAGGG - Intergenic
919781455 1:201223978-201224000 CACGGAAAGCAGAGAGAACAAGG - Intronic
920274865 1:204797069-204797091 CAGGCAAAAGAGAGTGTGCAAGG - Intergenic
920680877 1:208071637-208071659 CAGCTAAGACAGAGCCAGCAAGG - Intronic
921684871 1:218078256-218078278 AAGGGAAAAGAGAGAAAGCACGG + Intergenic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1063649252 10:7917229-7917251 GAGGGAAAAGAGAGCGAGGATGG + Intronic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069060546 10:63889970-63889992 GTGGGACAAGAGAGCGAGCATGG + Intergenic
1069250943 10:66266064-66266086 AAGGGAAAAGAGAGAGAGGAAGG + Intronic
1070467519 10:76738603-76738625 CAGGGAAAACACTCCAAGCATGG - Intergenic
1071789195 10:88936569-88936591 CAGGGGCAACAGAGAGGGCAGGG - Intronic
1071886029 10:89951654-89951676 CAGAGACAACAGAGAGAGAATGG - Intergenic
1071941045 10:90592197-90592219 CAGGAAAAGCAGTGAGAGCATGG + Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073512019 10:104048502-104048524 CAGGGATGACAGCACGAGCAGGG - Intronic
1074299226 10:112218331-112218353 GAGAGAAAACAGAGCGACTATGG + Intergenic
1075258105 10:120940938-120940960 AAGGGAAAACAGAAAGAACAAGG - Intergenic
1075573752 10:123563541-123563563 CTGGGAAAACAGACCCAACAAGG - Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1076598452 10:131640602-131640624 AATGGAAAACAGAAAGAGCAGGG + Intergenic
1077746763 11:4915436-4915458 CAGGTCAATCAGAGCCAGCATGG + Exonic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1079140836 11:17808400-17808422 CAGGAGCAAAAGAGCGAGCAGGG + Intronic
1080338334 11:31225907-31225929 CAGGAAACACAGAGCTAGGAAGG + Intronic
1080392558 11:31861658-31861680 CAGGGAAAACAGACCGATTCCGG - Intronic
1081870156 11:46379679-46379701 CTGGGAAACCTGAGCCAGCAGGG + Intronic
1084129048 11:67119395-67119417 CAGGAAAGACAGAGCGGCCACGG - Intronic
1084276286 11:68052649-68052671 CAGGGAAACCAGAGTGTGCTGGG + Intergenic
1085478953 11:76806119-76806141 GAGGGGAAAAAGAGAGAGCAGGG - Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088341427 11:108772371-108772393 CAGGGAAGACAGAGACAGAAGGG + Intronic
1088560249 11:111107700-111107722 CAGAGAAAACACAGTGAGCTGGG - Intergenic
1089522050 11:119071497-119071519 GAGGGAAAAAAGAGCCAGTATGG + Intronic
1089648739 11:119897766-119897788 CAGGAAAGAAAGAGTGAGCAGGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090560770 11:127929777-127929799 CAGAGAGAAAAGAGAGAGCATGG + Intergenic
1093234383 12:16588497-16588519 AAGGTAAAACAGGGAGAGCATGG + Intronic
1094075371 12:26466754-26466776 CAGAGAAAACACAGGGTGCAGGG + Intronic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094724150 12:33095364-33095386 CAGGAAAGAGAGAGAGAGCAAGG + Intergenic
1096267726 12:50137328-50137350 AAGGGAGAACAGAGAGAGCAAGG + Intronic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097821104 12:64130154-64130176 CAGGTAAAAAAGAGTGTGCATGG - Intronic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1099014137 12:77324981-77325003 GAGGGAAGAAAGAGCGAGCCGGG + Intergenic
1100961653 12:99968850-99968872 CAGGGGCAAGAGAGAGAGCAGGG - Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1102761906 12:115394902-115394924 CAGGGAAAGAAGAGTGAGCAAGG + Intergenic
1104279132 12:127357786-127357808 CAGGGAGAACAGTGAGACCAAGG - Intergenic
1104362176 12:128144314-128144336 CATGAATAACAAAGCGAGCAAGG - Intergenic
1104427250 12:128687917-128687939 AAGGGAAAACAGTGTGAGCCGGG - Intronic
1104437968 12:128771029-128771051 AAGGGAAAAAAGGCCGAGCACGG + Intergenic
1104807903 12:131601128-131601150 CAGGGAAGACAGTGTGTGCAGGG + Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1106139400 13:26998995-26999017 CCAGGAAAACAGAAAGAGCAGGG + Intergenic
1106437751 13:29738902-29738924 CAGGGAAAAAAGAGAGCTCAGGG - Intergenic
1106587891 13:31073038-31073060 CAGGGAAAGAATAGAGAGCAGGG - Intergenic
1106969938 13:35127078-35127100 CAGGGAAAACTGACCTAGAATGG + Intronic
1107073045 13:36292808-36292830 CAGGGAAAACAGACAGTGTAGGG + Intronic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1111856040 13:93639125-93639147 CAGGGAAAATAAAGCAAGGAGGG + Intronic
1113201738 13:107874030-107874052 CAGGGAAAGCAGAGTGGACAGGG + Intergenic
1114913863 14:27236776-27236798 CAGGAGAATAAGAGCGAGCAAGG - Intergenic
1115342590 14:32308147-32308169 AATGGAGGACAGAGCGAGCAAGG + Intergenic
1116782650 14:49252924-49252946 AATGGAAAACAGAGAAAGCAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117483351 14:56170361-56170383 AAGGGAAACCAGAGCAAGAAGGG - Intronic
1118280668 14:64425499-64425521 AAGGGAAAACAGGCCGGGCACGG - Intronic
1118355249 14:65008402-65008424 CAGGGAAGCCAGAGTGAGCAAGG + Intronic
1118851022 14:69583642-69583664 CAGGCAGAAGAGAGGGAGCAGGG - Intergenic
1119610771 14:76060066-76060088 CAGGGAAAACAGTACTAACAAGG + Intronic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1120724387 14:87921675-87921697 CAGAGAAAACAGAACCAACAGGG + Intronic
1121320861 14:92990941-92990963 CAGGGAAAACAGAGCTGGTGGGG - Intronic
1121323122 14:93004287-93004309 CAGGCAAAACAGAGACCGCAGGG - Intronic
1121958199 14:98234031-98234053 CAGGGAAAAAAGACCAATCAAGG + Intergenic
1122154026 14:99739558-99739580 CAGGGCAGACAGAGCCAGCCTGG - Intronic
1122246171 14:100404953-100404975 CAGGAAAGACAGAACTAGCATGG - Intronic
1123068157 14:105628414-105628436 GAGGGAGGACAGAGTGAGCAGGG - Intergenic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1124378004 15:29140832-29140854 CAGGGCAAACAGAGCCACCTGGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127432361 15:58923064-58923086 CATGGAAAACAGGTCGGGCATGG + Intronic
1129504756 15:76072009-76072031 CAGGGAAGAGAGAGCCAGCAGGG + Intronic
1129668015 15:77590312-77590334 CAGGGAGAGAAGAGTGAGCAGGG + Intergenic
1129699154 15:77757682-77757704 CAGGGCAAAGAGAGCCAGCAGGG + Intronic
1129792644 15:78351720-78351742 CAGGTAAAACAGAAAGAACAAGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131138508 15:89958205-89958227 CAGGGCAAACAGGGCGAACAGGG - Intergenic
1131695074 15:94868176-94868198 CAGGAAAAAGAAAGAGAGCAAGG + Intergenic
1132674074 16:1114511-1114533 CAGAGAAAACAGGCCCAGCAGGG - Intergenic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1134754850 16:16657975-16657997 CAAGGAAAAAAGAGCCAGGAAGG + Intergenic
1134991211 16:18701158-18701180 CAAGGAAAAAAGAGCCAGGAAGG - Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136090545 16:27916616-27916638 CAGGTAAAAGGGAGAGAGCATGG - Intronic
1136654271 16:31700617-31700639 CAGGGTACACAGATCAAGCAGGG - Intergenic
1137387975 16:48058390-48058412 CAGGGAAAACACATAGAGAAAGG - Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139283810 16:65792794-65792816 CAGGGAAGACAGAGCAAGCAAGG + Intergenic
1139361809 16:66404096-66404118 CAGAGAAAAGAAAGAGAGCATGG - Exonic
1140119701 16:72072949-72072971 CAGGGAGAACACAGAGAGTAAGG - Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1142905787 17:3040958-3040980 CAGGGAAACCAGAGAGAGCCAGG - Intergenic
1143771681 17:9173141-9173163 CAGGGCAGACAGAGAGACCAGGG - Intronic
1144483014 17:15643016-15643038 CAGCGAAAATACAGTGAGCACGG + Intronic
1144915668 17:18722015-18722037 CAGCGAAAATACAGTGAGCACGG - Intronic
1146279438 17:31535786-31535808 CAGGTAGAACAGAGTCAGCAGGG + Exonic
1147386398 17:40084857-40084879 CAGGGAGAAGAGAGTGAGCTCGG + Intronic
1148857674 17:50587636-50587658 CAGGGAGACTAGAGAGAGCAAGG + Intronic
1149042768 17:52210043-52210065 CAGGCAAAACAGTGTGTGCAGGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149594593 17:57856999-57857021 CAGGGAAAAAAGGGCCAGCTAGG + Intergenic
1150506246 17:65701834-65701856 GAGGGAGAACAGAGAGAGTAGGG - Intronic
1150638356 17:66932384-66932406 CAGTGAAAACAGTGCTAGCAAGG + Intergenic
1151757301 17:76082151-76082173 CAGGGACAGGAGAGCCAGCAGGG - Intronic
1152025226 17:77804670-77804692 CAGGGAAAACTGTGGGAGCCTGG - Intergenic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153118415 18:1689801-1689823 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1154978534 18:21482778-21482800 CAGCGAAAGCACAGGGAGCATGG + Intronic
1155117892 18:22787635-22787657 CAGTGAAAGCAGAGTGAGCGGGG + Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158014721 18:52770751-52770773 CAGGGAAAACCTAGAGAACAAGG + Intronic
1158660019 18:59378680-59378702 AAAGGAAAACAGAACCAGCACGG + Intergenic
1159109698 18:64042615-64042637 CAGGCAAAACAGCACGTGCAGGG + Intergenic
1160255872 18:77248927-77248949 GAGGCAGAACAGAGCTAGCAAGG + Intergenic
1160611042 18:80085331-80085353 CAGGAACAAGAGAGAGAGCAAGG - Intronic
1160690126 19:457890-457912 CAGGGAAAACAGACCCAACCAGG + Intronic
1160751815 19:737951-737973 CAGGGAGAACAGACCGTGGACGG + Intronic
1160974033 19:1783726-1783748 CAGGGAGAACAGAGGTGGCAGGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1163246723 19:16100179-16100201 CGGGGAAAACAGACCTAGGAAGG + Intronic
1163338867 19:16691317-16691339 AAGGGAAAAAAGTGCGAGCTTGG + Intergenic
1164404719 19:27934597-27934619 CAGGGAAAACAGAGCTGCTAAGG - Intergenic
1164946912 19:32303209-32303231 CAAGGAAAAGAGAGAGAGAAAGG - Intergenic
1165177652 19:33941854-33941876 GAGAGAACACAGAGAGAGCAAGG - Intergenic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1167782075 19:51605178-51605200 TAGGCAAGACAGAGCGTGCAGGG - Intergenic
1168141815 19:54393106-54393128 CAGGCAAGAAAGAGCGTGCAGGG - Intergenic
926188915 2:10712631-10712653 CATGGAGATCAGAGTGAGCAGGG + Intergenic
926199884 2:10787093-10787115 CATGGAAAAAAGAACGAACAGGG + Intronic
926229153 2:10989787-10989809 CAGGAAAAACAGAGCATGAAGGG - Intergenic
926607643 2:14913691-14913713 CAGGGGAAACAGAACCAGCTTGG + Intergenic
926905985 2:17806072-17806094 CAGGGTGCACAGAGCCAGCAGGG + Intergenic
927451100 2:23210126-23210148 CATGGAAAACAGTGGGAGCCAGG - Intergenic
927576433 2:24205474-24205496 CAGGGCAGAAAGAGCAAGCAGGG - Intronic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
930196507 2:48516083-48516105 CAGAGAAAACAGAAAGGGCAAGG - Intergenic
930777112 2:55184067-55184089 GAGAGAAAACAGGCCGAGCATGG - Intronic
930864094 2:56105880-56105902 CAGGAAGAAGAGAGAGAGCAGGG + Intergenic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
932481905 2:72046787-72046809 CAGGGAAAACAGAAAGCACAAGG + Intergenic
933185822 2:79278340-79278362 CGGGGAAGAAGGAGCGAGCATGG + Intronic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
933655116 2:84880771-84880793 CACGGAGAGGAGAGCGAGCAAGG + Intronic
935225853 2:101052346-101052368 CTGGCAATACAGAGCCAGCAAGG + Intronic
935400320 2:102653601-102653623 CAGGGAAAAGAGAGAAAGGAAGG - Intronic
936408030 2:112225789-112225811 CCTGGACAACAGAGTGAGCATGG + Intronic
936736054 2:115445075-115445097 CAGGAAAGAGAGAGAGAGCAGGG - Intronic
940272526 2:151907168-151907190 TAGGGAAAACAGAACAAGCAAGG + Intronic
943231150 2:185254113-185254135 CAGAGAAAACAGAGAGAGAGAGG - Intergenic
943651713 2:190464583-190464605 CAGAGGAAACAAAGCGAACAAGG - Intronic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
945468206 2:210196147-210196169 CAGGCAAAACAGCGTGTGCAGGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946113124 2:217437560-217437582 CAGGGAAAGCCTAGCCAGCAAGG - Intronic
947128394 2:226895871-226895893 AAGGGAAAAGACACCGAGCAAGG - Intronic
947587082 2:231362997-231363019 CAGGGCACAGAGAGCGTGCAGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1170129470 20:13003063-13003085 CAGGAAAGAGAGAGAGAGCAGGG + Intergenic
1170756729 20:19212259-19212281 CAGGGAGCACCGAGCGAGCTGGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172064426 20:32208908-32208930 AAGGGAAAATAAAGAGAGCAGGG + Intronic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172881477 20:38202681-38202703 CAGGGGAACCCTAGCGAGCAGGG + Intergenic
1174188552 20:48723720-48723742 CCAGGAGAACAGAGAGAGCAGGG - Intronic
1174587923 20:51623151-51623173 GAGGGAAAACAGACCCAGCTAGG - Intronic
1175507970 20:59499793-59499815 AAGGGAAGACAGAGAGAACAAGG + Intergenic
1176060804 20:63172034-63172056 CAGGGAAGAGACAGCGACCAGGG + Intergenic
1178436171 21:32560297-32560319 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178899155 21:36585097-36585119 CAGGAAGAACAGAGCAAACATGG + Intergenic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179251281 21:39673603-39673625 AAGGGAAAAAAGAGAGAGAAAGG - Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184478306 22:44733476-44733498 CAGGGCAACCAGAGCAAGGAAGG + Intronic
1184889849 22:47372994-47373016 CAGGAAAAAGACAGCCAGCATGG + Intergenic
1185082477 22:48717705-48717727 CAGGGACCACAGAGCAGGCATGG + Intronic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949237414 3:1826652-1826674 CAGGGAAAACACATAGAACAGGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
951450573 3:22833222-22833244 CAGGGAAATCAGAAACAGCATGG + Intergenic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
954122877 3:48510504-48510526 CAGGAAAAACTGAGTGAGCCTGG - Intergenic
955421017 3:58737763-58737785 GAGGGAAAAAAGAGTGTGCATGG + Intronic
955906695 3:63815017-63815039 CAGGGGCAAGAGAGAGAGCAGGG + Intergenic
956776866 3:72572401-72572423 CAGGGAGACCAGAGCCAGGAGGG - Intergenic
958993999 3:100880309-100880331 TAGGGAAAAGAGAGCCAGCAAGG - Intronic
959576878 3:107943980-107944002 CATGGAACACAGGGCGTGCAGGG - Intergenic
960588518 3:119343732-119343754 CAGGGAGAAAAGGGAGAGCAAGG - Intronic
961356463 3:126343039-126343061 CAGGGCAGACAGAGCCAGAAGGG - Exonic
961875776 3:130022429-130022451 CAGGGACAGCAAAGCGAGGACGG + Intergenic
962027151 3:131560335-131560357 CAGGGATGATAGAGAGAGCATGG - Intronic
962369138 3:134806284-134806306 CAGGAGAAACAGAGAGAGCTAGG - Intronic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965554327 3:170004072-170004094 CAGGGAAAACAGTCCCAGCCAGG + Intergenic
965596720 3:170418495-170418517 CAGGGAAGAAGGAGCGAGCAGGG + Intergenic
965673788 3:171173910-171173932 CAGGGAGAAGAGAGGAAGCAGGG + Intronic
965678572 3:171226312-171226334 CAGGCAAAAAAGGGAGAGCAGGG - Intronic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
969339445 4:6531029-6531051 CAGGGACCACAGAGCCAGCTTGG + Intronic
970014270 4:11495338-11495360 CAGGCAAATCAGAGAGAGCCAGG - Intergenic
972886281 4:43493218-43493240 CAGGAAAAATAGAGGGAGCTGGG + Intergenic
973323233 4:48831201-48831223 CAAGGAAAACCAAGCGATCAGGG - Exonic
973637089 4:52870403-52870425 CAGGGCAGACATAGCGGGCATGG - Intergenic
975658655 4:76666730-76666752 AAGGAAATACAGAGCAAGCAGGG + Intronic
975892843 4:79050027-79050049 CAGGCGGCACAGAGCGAGCACGG - Intergenic
976408235 4:84683586-84683608 TAGGGAAAACATAGTGAGCAGGG - Intronic
978083564 4:104622672-104622694 CAGGGAAAAGAGCCCGAGCATGG + Intergenic
978410008 4:108416132-108416154 CAGGGACAGGAGAGCCAGCAGGG - Intergenic
979639075 4:122990877-122990899 AAGGGAAAACAGGTCCAGCATGG - Intronic
981422545 4:144567660-144567682 CAGGCAAAAGAGAGTGTGCAGGG - Intergenic
984278644 4:177640208-177640230 CAGGGTAAGCAGAGCCAGAAAGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985717290 5:1469813-1469835 CAGTGAAAGCAGGGCCAGCAGGG + Intronic
986530115 5:8727034-8727056 GAGGGAAGAAAGAGCGAGGAAGG + Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
987397868 5:17442919-17442941 CAAGAAAGAGAGAGCGAGCAAGG + Intergenic
988854431 5:35214141-35214163 CAGGCAAACCAGAGCCAGCTGGG - Intronic
990718046 5:58660804-58660826 TAAGGAAAAAAGAGAGAGCATGG + Intronic
991042275 5:62188292-62188314 CTGGGAAACCAGAGCCTGCAGGG + Intergenic
996147424 5:119993015-119993037 CAGAGAAAACAGACCTGGCAGGG + Intergenic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
998965710 5:147538468-147538490 CAGAGAAAACAGAATGAACATGG - Intergenic
999521990 5:152360094-152360116 TAGGGAAAATTGAGGGAGCAGGG + Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000130363 5:158291273-158291295 CAGAGAAAAAAGAGGCAGCAAGG + Intergenic
1000391352 5:160726621-160726643 AAAGGGAAACAGAGAGAGCAAGG + Intronic
1000912996 5:167044935-167044957 CAGAGAAAATGGAGGGAGCAAGG + Intergenic
1002364120 5:178696894-178696916 CTGGGAAAACACCGCGAGAAAGG + Intergenic
1002921457 6:1576104-1576126 CAGAGAAAACAAGGCTAGCAGGG - Intergenic
1003443479 6:6164657-6164679 GAGGGAAAAAGGAGCGAGAATGG - Intronic
1004828036 6:19445490-19445512 CAGGGAAAACAGAGAAATCTTGG - Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005237707 6:23784814-23784836 CAGAGAACACAGAGCACGCAAGG - Intergenic
1005569678 6:27132781-27132803 AAGGAAAAACAGCGTGAGCAGGG + Intergenic
1005822307 6:29607997-29608019 CAGAGGAAAAAGAGAGAGCAAGG + Intronic
1006057313 6:31395006-31395028 CAGGGAAGCCAGAGCCACCATGG - Intergenic
1007501701 6:42303440-42303462 CAGGGGAAAGATAGAGAGCAAGG + Intronic
1007894078 6:45330411-45330433 CAGGGATAACAGAGATATCAGGG + Intronic
1010835959 6:80587532-80587554 CAGGCAAAAGAGCACGAGCAAGG - Intergenic
1011216239 6:85008862-85008884 CAGGAGAAAGAGAGAGAGCATGG - Intergenic
1011243964 6:85302143-85302165 CAGGACAAACTGAGTGAGCATGG + Intergenic
1011984664 6:93428404-93428426 CAAGGAAAAAAGAGTCAGCAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013315594 6:108939474-108939496 CAGGAAGAAGAGAGAGAGCAGGG - Intronic
1013680375 6:112518884-112518906 CAGGGAAAGCAGAGGAAGAAAGG + Intergenic
1013745891 6:113345469-113345491 CAGGGAAAACACAAAGGGCATGG + Intergenic
1014007773 6:116440928-116440950 CAGGGAATACACAGCGAACAGGG - Exonic
1014429701 6:121353686-121353708 CAGGGAGAGAAGAGCAAGCAGGG + Intergenic
1016256013 6:142106246-142106268 GAGGCAAAACAGGGAGAGCAGGG + Intergenic
1016487596 6:144559373-144559395 CAGGGAAAACAGAGCAAAACTGG + Intronic
1017348896 6:153416492-153416514 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1021281694 7:18727693-18727715 GAGGTAAAACAGAGGCAGCAGGG - Exonic
1021924218 7:25519295-25519317 CAGGGAAAAGAGGGAGAGCAGGG + Intergenic
1023230242 7:38020236-38020258 CTGGGAAACCAGAGAGAGCCCGG - Intronic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024437966 7:49381454-49381476 CAGGGAAGACAGGGCATGCATGG + Intergenic
1024759416 7:52576598-52576620 CACAGAAAACAGATCGAGAAAGG - Intergenic
1027250534 7:76396011-76396033 CAGAGAAAACAGGGCTAGCAGGG + Intronic
1029204655 7:98862337-98862359 AAGGGAAAACAGAGAGAGAAGGG + Intronic
1029551616 7:101239740-101239762 CAGGGAAAGGACAGCGAGGATGG + Exonic
1029790389 7:102837288-102837310 CAGGGAAACCAGGCTGAGCAAGG + Intronic
1030230007 7:107197883-107197905 CAGGAAAAACAAATTGAGCAAGG - Intronic
1036943787 8:13075311-13075333 GAGGGAAGACACAGCGAGCAGGG + Intergenic
1039096668 8:33894302-33894324 CAGGGACAACTGAGAAAGCAAGG + Intergenic
1039374938 8:37023861-37023883 CAGGGAGAGCAGAGATAGCAAGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041977388 8:63815748-63815770 CAGGGACCACAGAGCCAGCATGG - Intergenic
1042078083 8:65018008-65018030 CAGGGAAAACAGAGGTAGCTAGG + Intergenic
1043514095 8:80980167-80980189 CAGGAAAAATAGAGAGGGCAGGG - Intronic
1045531728 8:102991395-102991417 CCGGGAACACAGAGCTACCAGGG - Intergenic
1047729631 8:127716226-127716248 CTGAGAAAACAGAGTAAGCAAGG - Intergenic
1048019013 8:130521164-130521186 TGGGGAAAACAAAGCGGGCATGG + Intergenic
1049879760 8:145053558-145053580 CAGGGAAGCCTGAGGGAGCAGGG + Intronic
1050062449 9:1724133-1724155 CAGGGCAAACAGAGGTATCAGGG - Intergenic
1050247558 9:3706923-3706945 CAGGGAGAACAGGTTGAGCACGG + Intergenic
1051826272 9:21223808-21223830 CAGTGAAAACAGAGCTAAAAAGG + Intronic
1052502984 9:29316826-29316848 CAGGGACAAGAGATGGAGCAGGG + Intergenic
1053206174 9:36188465-36188487 TAGGCAAAAGAGAGCGAGAAAGG - Intergenic
1055134694 9:72814642-72814664 CAGGGAAAGAAGAGCAAGTATGG - Intronic
1055592148 9:77828101-77828123 CAGTGAAAACAGAGCTGGTATGG + Intronic
1056697713 9:88874021-88874043 CAGGGAAAACTGTGTGAGCCTGG - Intergenic
1056907202 9:90663632-90663654 AATGGAAAACAGAGAAAGCAAGG - Intergenic
1057292356 9:93814717-93814739 CAGGGAAACCAGAGAGAGAGAGG - Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058344926 9:103949798-103949820 CATGAAAAAGAGAGAGAGCATGG - Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062671840 9:137715518-137715540 CAGGAAGAACAGAGCCAGGAAGG + Intronic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1186270490 X:7881511-7881533 ATGGGAAAACAGAGTGATCAAGG - Intergenic
1187680550 X:21763294-21763316 CTGGGAAAGAAGAGGGAGCAAGG + Intergenic
1187734635 X:22291219-22291241 GAGGGAAAAGAGAGCAAGCATGG - Intergenic
1188791339 X:34411761-34411783 CATGGAGAACAGAGAAAGCAAGG + Intergenic
1188926388 X:36049973-36049995 CAGGCAAGAGAGAGCGTGCAGGG - Intronic
1189654919 X:43234958-43234980 CAGGGAAAACAGATCTTTCACGG + Intergenic
1190931950 X:54956282-54956304 CAGGGAGAACAGAGGTATCAAGG + Intronic
1191136772 X:57072666-57072688 CATGGAAAACAGAACGATCAAGG - Intergenic
1192067889 X:67904965-67904987 CATGGAGAACAGAGAAAGCAAGG - Intergenic
1194869085 X:99105331-99105353 CAGGGAAAACAAAGCAGGAAAGG - Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196769687 X:119281415-119281437 CAGGGAGAACAGAGCTGTCAGGG - Intergenic
1197622544 X:128766593-128766615 CAAGAAAAACAGAGGGAGAAAGG - Intergenic
1198368574 X:135968818-135968840 CAGTGAAAACTGGCCGAGCACGG - Intronic
1199720562 X:150540282-150540304 CAGGAGCAACAGAGAGAGCAGGG - Intergenic
1199732703 X:150652222-150652244 GTGGAAAAACAGAGCCAGCATGG + Intronic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic