ID: 1132758958

View in Genome Browser
Species Human (GRCh38)
Location 16:1499754-1499776
Sequence AGGGTGAAGCAAGATGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1132758958_1132758965 13 Left 1132758958 16:1499754-1499776 CCGGCCACATCTTGCTTCACCCT 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1132758965 16:1499790-1499812 CACGAGAACTTAAGATGGCGAGG 0: 1
1: 0
2: 0
3: 1
4: 27
1132758958_1132758966 29 Left 1132758958 16:1499754-1499776 CCGGCCACATCTTGCTTCACCCT 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1132758966 16:1499806-1499828 GGCGAGGCCCTGCCCCAGCACGG 0: 1
1: 0
2: 0
3: 43
4: 355
1132758958_1132758964 8 Left 1132758958 16:1499754-1499776 CCGGCCACATCTTGCTTCACCCT 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1132758964 16:1499785-1499807 GCTCACACGAGAACTTAAGATGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1132758958 Original CRISPR AGGGTGAAGCAAGATGTGGC CGG (reversed) Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
902324364 1:15689420-15689442 AGGGTTCTGCAAGATGCGGCTGG + Intronic
904421499 1:30397496-30397518 ACGGTGAAGAAAGCTCTGGCAGG - Intergenic
904635008 1:31873149-31873171 TGGGGGAAGTAAGAAGTGGCTGG + Intergenic
905344896 1:37304639-37304661 ATGGTCAGGCAAGCTGTGGCTGG + Intergenic
906702192 1:47867831-47867853 AGAGTGTTGCAAAATGTGGCTGG + Intronic
907589647 1:55654041-55654063 AGGATGAAACATGATGGGGCTGG + Intergenic
910194305 1:84624477-84624499 AGAATAAGGCAAGATGTGGCTGG - Intergenic
911624291 1:100103728-100103750 AGGGTGCAGAAAGAAGTGCCTGG - Intronic
915447337 1:155981450-155981472 AGGTGGAAGGAAGATGTAGCAGG + Intronic
915665853 1:157444338-157444360 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
916898506 1:169193634-169193656 AGGCTGCAGCAACATGTGCCAGG - Intronic
918041042 1:180913728-180913750 AGGCTGAAGCCAGAGGAGGCCGG - Intronic
918263901 1:182822300-182822322 AAGGTAAAGAAAGAAGTGGCTGG - Intronic
920571173 1:207019091-207019113 AGTGGGAAGCATGATCTGGCAGG - Exonic
920836269 1:209513899-209513921 AGGGCGAAGGCAGATGTGGCAGG - Intergenic
920971618 1:210748120-210748142 AGGGTGATGCATCATGTGTCAGG + Intronic
1063982879 10:11470140-11470162 AGGAAGAAGGAAGACGTGGCGGG + Intronic
1064796826 10:19021389-19021411 AGGGTTAAGTAAACTGTGGCAGG + Intergenic
1066997739 10:42579129-42579151 AGGATGAACCATGATGTGGTAGG - Intronic
1067057394 10:43060353-43060375 AGGCTGCAGCAAGCTGGGGCCGG + Intergenic
1067251598 10:44591362-44591384 AAGGAGAAGCAAGGGGTGGCTGG - Intergenic
1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG + Intergenic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG + Intronic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1072124785 10:92436030-92436052 AGGGAAAAGCAAGATCTGGGTGG - Intergenic
1072696727 10:97609441-97609463 AGGGTGAGGCAGGATGGGGTAGG - Intronic
1075465145 10:122645364-122645386 GGGGTGAAGAAAGATGGGGTGGG + Intergenic
1075994716 10:126868089-126868111 AGAGTGAAGGGAGATGAGGCTGG - Intergenic
1076344952 10:129773585-129773607 AGGGTGTAGCCTGATGTGGGAGG + Intergenic
1077168437 11:1153991-1154013 AGGGAGGAGAAAGCTGTGGCTGG + Intergenic
1080058323 11:27930801-27930823 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1080519987 11:33060384-33060406 AGGGTGAAGCCAGATGGCCCAGG + Intronic
1081092377 11:38888350-38888372 ATGGAGAGGCAAGAAGTGGCGGG - Intergenic
1081533447 11:43981073-43981095 ATGGGGAAACAAGATGGGGCAGG + Intergenic
1081755600 11:45542143-45542165 AGGGTGAGGCAAGGTGGGGGAGG - Intergenic
1081982385 11:47276092-47276114 AGGGTGAATCGAGATGGGTCTGG - Exonic
1082858279 11:57828899-57828921 AGGGTGAGGCAAGGTGGGGTTGG - Intergenic
1084751491 11:71207020-71207042 AGGGTGCAGCAAGCTATGACTGG + Intronic
1084881177 11:72172678-72172700 AGGGTGAAGTCAGCTGTGGAAGG + Intergenic
1085312923 11:75526445-75526467 AGGGAGAAGCAAGGTGTCGGTGG - Intergenic
1086902878 11:92387412-92387434 AGGGTGAAGGAAAAGGTGGTGGG + Intronic
1087161098 11:94948863-94948885 AGTGAGAGGCAAGATGAGGCAGG - Intergenic
1087222574 11:95562414-95562436 AGAGTGAAACAAGATGGAGCTGG + Intergenic
1089167334 11:116487279-116487301 AGGCTGAACAAAGATGTGGCTGG - Intergenic
1089211033 11:116802702-116802724 ACATTGAAGCAAGATGTGACCGG + Intergenic
1089537712 11:119170837-119170859 GGGGAGAGGCAAGACGTGGCAGG + Intronic
1090954759 11:131504181-131504203 AGGGTGAGGACAGAGGTGGCTGG - Intronic
1094636070 12:32227850-32227872 AGGGTGAAGCGGGAGATGGCTGG - Intronic
1096073132 12:48787183-48787205 AGGCTGAAGCAAAATGTTGTGGG - Intronic
1096119472 12:49078429-49078451 AGGGTAAAGGAAGATCTGGAGGG - Intergenic
1096658907 12:53110029-53110051 AGGTTTAAGCAAGTTGTGGAAGG - Intronic
1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG + Intergenic
1097243448 12:57591725-57591747 AGGCTGAAGCTAGACATGGCAGG - Intronic
1097973257 12:65657748-65657770 AGGGCAAAGTAAGATGTGGAAGG + Intergenic
1098438132 12:70490451-70490473 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1098982925 12:76978021-76978043 AGGGTGAAGGAAGATGTTGATGG - Intergenic
1101048779 12:100838880-100838902 AGCCTGAAGGAAGATGTGGATGG + Intronic
1101965874 12:109281578-109281600 AGTCTGGAGCAAGATGTGCCTGG + Exonic
1102464196 12:113119057-113119079 AGGGGGAAGAAAGATGAGACGGG - Intronic
1103480573 12:121247644-121247666 AGAGTGGAGGAAGATGTGGATGG + Intronic
1103659517 12:122502418-122502440 AGAGTGGAGCAAGATGAGGTTGG + Intergenic
1104647569 12:130508279-130508301 AGGGAGAGGCAAGATCTGGCAGG - Intronic
1104656388 12:130576641-130576663 AGGATGAAGCACGAGCTGGCAGG + Intronic
1105778427 13:23684023-23684045 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1106487753 13:30187588-30187610 AGGCTGAAGCAAGATGGGTCTGG - Intergenic
1107597121 13:41974457-41974479 AGTGTGAAGAAAGGTGTGGAGGG + Intergenic
1107850210 13:44563634-44563656 AGGGTGAAGGAAAATGTGTCAGG - Intronic
1110445445 13:75574748-75574770 AGGGTGAAGCCATATCTGGGGGG + Intronic
1110772501 13:79366070-79366092 AGGGTGGAGCAGGAGGAGGCTGG + Exonic
1111973242 13:94939169-94939191 AGGCTGAAGAAAGCTGTGGCAGG + Intergenic
1112033076 13:95474821-95474843 AGGGTGGAGGAAGATGGGGGTGG + Intronic
1112654573 13:101436655-101436677 AGGAAGAAGCAAGATTGGGCAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1114256520 14:21007019-21007041 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1114844554 14:26305332-26305354 AGTCTGAGGCAAGCTGTGGCAGG - Intergenic
1115600374 14:34950177-34950199 AGGGTAAGGAAAGATGTCGCTGG - Intergenic
1117265228 14:54079573-54079595 TGGGTGATGCAATATGTGACAGG + Intergenic
1117998363 14:61499498-61499520 AGGGAGGAGCAAGATGTGAGGGG - Intronic
1118452127 14:65912748-65912770 TTGATGAAGGAAGATGTGGCTGG + Intergenic
1118645481 14:67834416-67834438 AGTGTGAAGGAAGGTGTGGTAGG - Intronic
1119071178 14:71586182-71586204 AGGGTGAGGCGAGCTCTGGCTGG - Intronic
1119881918 14:78106418-78106440 AGGGAGAGGGAAGATGTGGTTGG + Intergenic
1120968622 14:90189614-90189636 AGGGTGAACCAAGCTGGGGTTGG + Intergenic
1123826362 15:24086287-24086309 AAGGTGAAGCAGTTTGTGGCAGG - Intergenic
1124014027 15:25861714-25861736 GGGGTCAAGCAAGGTGAGGCAGG + Intronic
1124039934 15:26092425-26092447 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1125477200 15:40055296-40055318 AGGAGGAAGTGAGATGTGGCAGG + Intergenic
1125700931 15:41682944-41682966 GGGGTGAAGAGAGATGAGGCTGG - Intronic
1127645637 15:60955732-60955754 AGGGTGGAGCAAGAGGAGTCAGG + Intronic
1129608789 15:77037545-77037567 GGGGTGCAGGAGGATGTGGCAGG + Intergenic
1129686665 15:77689869-77689891 AGGGGGAAGCAAGAAGGGGAAGG + Intronic
1131967216 15:97857267-97857289 AGGATGAAGCAAGATTTGTCAGG + Intergenic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1132880092 16:2158331-2158353 AGGGTGCAGCCAGGTGGGGCAGG + Intronic
1132906777 16:2286541-2286563 ATGGTGGAGGAGGATGTGGCAGG + Intronic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133389776 16:5400387-5400409 AGAGAGAAGCAAGCAGTGGCCGG - Intergenic
1133579947 16:7134593-7134615 AGGGTGAAGGGAGAGGAGGCAGG - Intronic
1135165025 16:20131441-20131463 AGCCTGAAGAAACATGTGGCAGG + Intergenic
1136183893 16:28573688-28573710 AGGGTGAAGGCAGAGGTGACAGG + Intronic
1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG + Intergenic
1137433139 16:48434508-48434530 GGGGAGGAGCCAGATGTGGCTGG - Intronic
1139159366 16:64485599-64485621 AGAGTGAATCATGATGTGCCAGG + Intergenic
1140561179 16:75983653-75983675 AGGGTGAAATAAGAAGTGGAGGG - Intergenic
1141826830 16:86486496-86486518 AGGGTTAAACATGATGTGCCGGG + Intergenic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1147253472 17:39167192-39167214 AGGGAGAAGCCCCATGTGGCTGG - Intronic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1147833112 17:43311076-43311098 AGGCTGCAGCAAGATGTGACTGG - Intergenic
1148191426 17:45681328-45681350 AGGGTGGAGCAGGATGAGGGTGG - Intergenic
1149038063 17:52157480-52157502 AGGGTGAAGGAAAAAGTGGTGGG - Intronic
1149243920 17:54682947-54682969 AAGGGGCAGTAAGATGTGGCAGG - Intergenic
1149476907 17:56969754-56969776 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1151243433 17:72776004-72776026 AGGGAGAGGGAACATGTGGCAGG - Intronic
1151661719 17:75522426-75522448 AGGCTTAAGGAAGATGTGGGAGG + Intronic
1152110973 17:78357715-78357737 AGGGGGAAGCAACATTTGGAGGG - Exonic
1154489358 18:14907762-14907784 AGGGGGAAGCCAGATCTGGAAGG - Intergenic
1156032442 18:32728187-32728209 AAGGTGAAGCAAGACGAGACAGG - Intronic
1156789976 18:40959795-40959817 AGAGTGAAGCAGGAATTGGCCGG - Intergenic
1158222504 18:55164275-55164297 AGGGTGAAACAAGGTGTACCTGG - Intergenic
1159746515 18:72242868-72242890 AGGGTGAAGAAAAATGGGGGTGG + Intergenic
1165350140 19:35270663-35270685 AGGGTGAAGTCAGAACTGGCTGG - Intronic
1165752021 19:38265980-38266002 AGGGTGACGTAAGATGTTGGGGG + Intronic
1167749875 19:51373015-51373037 AGGGGGAGGGCAGATGTGGCTGG + Intergenic
1168028726 19:53662997-53663019 GGGGTGAAGTAAGACGAGGCTGG + Intergenic
1168294170 19:55370541-55370563 AGGGTGAGTCAGGATGTGTCAGG - Intergenic
925370349 2:3340322-3340344 AAGGAGAAGCCAGATATGGCCGG + Intronic
926611265 2:14950703-14950725 AGGGTGCACCAAGCTGAGGCTGG + Intergenic
927430587 2:23023409-23023431 AGGGGGAGGCAAGGTGTGGCTGG - Intergenic
928310399 2:30204923-30204945 AGGGAAAAGCAACATGTGCCTGG - Intergenic
928332893 2:30371153-30371175 AGGGTGAAAAAAAATGAGGCTGG + Intergenic
930223949 2:48773357-48773379 AGGGTGCAGGAAGGAGTGGCTGG + Intronic
933713688 2:85345204-85345226 AGGGTGAAGGAAGGAGAGGCTGG + Intronic
933773092 2:85755865-85755887 AGGGTTAGGGTAGATGTGGCTGG + Intronic
935310785 2:101781338-101781360 AGGGGGAGGGAAGATCTGGCTGG - Intronic
935875303 2:107499675-107499697 TGGGTGAGGCAAGATGTTACCGG - Intergenic
936619730 2:114082916-114082938 AGAGTGAGGCAGGATTTGGCTGG - Intergenic
936652061 2:114439095-114439117 ATCATGAAGAAAGATGTGGCAGG + Intergenic
941866715 2:170343150-170343172 AGAGTCAAGCCAGATGTGGTAGG + Intronic
942923810 2:181409535-181409557 AGGCTGAAGACAGATGTGGTGGG - Intergenic
944090509 2:195904700-195904722 AGGGAGCAGCAAGGTGTGGCAGG + Intronic
944190004 2:196992602-196992624 AGGGTGAGGGAAGGTGAGGCGGG + Intronic
944651056 2:201830730-201830752 AGAGTAATGGAAGATGTGGCTGG + Intronic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
946982502 2:225232905-225232927 AGGGGGAAACAAGATGTACCTGG - Intergenic
948686876 2:239675503-239675525 AGGGTGAAGCAATTTCTGGGAGG - Intergenic
1168833685 20:862157-862179 AGGATGAAGCAACATGAGGCTGG + Intergenic
1172312882 20:33931872-33931894 AGGGTGAAGCCAGGTGGGGTGGG + Intergenic
1173142449 20:40495959-40495981 AGGGTGAAGTAGGGTCTGGCTGG - Intergenic
1173213240 20:41054311-41054333 AGTGTGAAGCAAAGTGGGGCAGG - Intronic
1173571297 20:44078190-44078212 AGGGGGAAGCAAGATGGAGGAGG - Intergenic
1173851345 20:46220377-46220399 AGGGTGAAGAAAGATGGTGGGGG + Intronic
1179122473 21:38560533-38560555 AGGATGAAGCAAGACTGGGCAGG - Intronic
1179314851 21:40234496-40234518 ATGTTGAGTCAAGATGTGGCTGG + Intronic
1180987879 22:19916127-19916149 GGTGTGCAGCAAGAGGTGGCTGG + Intronic
1182330645 22:29549419-29549441 AGTGTGGAGCAGGATGTGGGTGG - Intronic
1183113570 22:35671324-35671346 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1183633337 22:39046450-39046472 AGGGTGCAGCAAGGTCTGGAGGG - Intronic
1184610352 22:45599329-45599351 ACAGGGAAGCAAGAGGTGGCTGG - Intronic
949148724 3:737880-737902 ATGGTGAAGAAAGGTGGGGCAGG + Intergenic
951856300 3:27200895-27200917 AGTGGGAAGCACCATGTGGCTGG + Intronic
951880563 3:27477714-27477736 AGGCTGAGGCAGGATGAGGCGGG - Intronic
953004499 3:38965548-38965570 AGAGAAGAGCAAGATGTGGCTGG - Intergenic
953387710 3:42516122-42516144 ATGGTGAGGCAAGATGAGGTGGG - Intronic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
954007713 3:47605473-47605495 TGGAAGAAGCCAGATGTGGCCGG + Intronic
954106736 3:48413646-48413668 TGGGTGCAGCCAGATGTGGCTGG - Intronic
954807202 3:53227397-53227419 AGGCAGGAGCAAGATGGGGCTGG - Intronic
955613743 3:60784098-60784120 AGGATGAAGAAAGATGGGGAGGG - Intronic
957350543 3:79018379-79018401 AGGGTGAAGAAAGAAGACGCGGG + Intronic
957803127 3:85111586-85111608 AGAGTGTAGAAAGATGAGGCTGG + Intronic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG + Intergenic
964330949 3:155602039-155602061 AGAGTTTAGCATGATGTGGCGGG - Intronic
966721381 3:183065694-183065716 AGGTTTAAGCAAGTTGTGGAAGG + Intronic
967117916 3:186358556-186358578 AGGTGGAAACAAAATGTGGCTGG - Intronic
967155975 3:186692620-186692642 AGGATGAAGCAAAATATGGATGG + Intergenic
967224101 3:187274855-187274877 AGGGAGAAGAAAGAGCTGGCAGG + Intronic
967295770 3:187963266-187963288 AGGGGGATTCTAGATGTGGCGGG - Intergenic
970342585 4:15122013-15122035 AGAGTGAAGCAAGGTGTGACAGG - Intergenic
970627339 4:17902148-17902170 AGAGAGACACAAGATGTGGCTGG + Intronic
971968948 4:33596951-33596973 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
974100478 4:57410820-57410842 AGGGTTAAGAGAGATTTGGCAGG - Intergenic
975378964 4:73676583-73676605 AGGGTTAAGCAAGATAATGCAGG - Intergenic
975650943 4:76592229-76592251 TGGGTGGAGCAGAATGTGGCGGG + Intronic
976727099 4:88225435-88225457 AGAGTGAAGCATGATGAGGTTGG + Intronic
979263205 4:118671751-118671773 AGGGTGAGTCCAGATGGGGCAGG + Intergenic
979916518 4:126441525-126441547 AGTGTGAAACAAAATGTGGGAGG + Intergenic
982374747 4:154677545-154677567 AGGGTGAATCCAGATGCAGCGGG + Intronic
983253826 4:165376402-165376424 GAGGTGAAGCAAGAAGTGGAGGG + Intronic
984441482 4:179776015-179776037 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
984809485 4:183782208-183782230 AGGCAGAAGAGAGATGTGGCAGG - Intergenic
986286072 5:6360085-6360107 AGGAGGAGGCAGGATGTGGCAGG + Intergenic
991076657 5:62546927-62546949 AGGGTGAAACTAGATCTGTCAGG + Intronic
991442784 5:66668811-66668833 AGGGGGAAGCCAGAGGTGGGAGG + Intronic
993939556 5:94042135-94042157 AGGTTTAAGCAAGTTGTGGAAGG + Intronic
995229576 5:109743921-109743943 AGTGTGAAGCAGGAAGTGACTGG - Intronic
996021035 5:118591051-118591073 AGTGTGGAGCAAGATGAAGCTGG + Intergenic
999088404 5:148913315-148913337 AGGATGAAGCAGCATGAGGCAGG - Intergenic
999246447 5:150157535-150157557 AGGGTGAAGAAAGCTGTCCCAGG + Intergenic
999325002 5:150638464-150638486 ATGGTGAAGCAAAATGTGAAGGG + Intronic
999470677 5:151852156-151852178 AGGGTGAAGAAAGATGGGGAAGG - Intronic
1000276899 5:159745813-159745835 AGGGTGTGGCAAGCTGTTGCTGG + Intergenic
1001233601 5:170010759-170010781 AGGCTGGAGAAAGCTGTGGCGGG + Intronic
1001506212 5:172283171-172283193 AGGGTGCGGAAAGATGTGGCGGG + Intronic
1002512430 5:179731694-179731716 AAGGTTAAGCAGGAGGTGGCAGG - Intergenic
1002612927 5:180433213-180433235 AGAGTGAAGCAGGAAGTGGCAGG - Intergenic
1003791334 6:9550839-9550861 TGGGTGAAGACAGAAGTGGCTGG - Intergenic
1005106346 6:22228385-22228407 AGGCTGAAGCAAGAGGTGAGGGG + Intergenic
1007733347 6:43965206-43965228 AGGGTGCAGCAAGTTGGGGTGGG - Intergenic
1009588322 6:65635393-65635415 AGGGAAAGGCAAGATGGGGCGGG - Intronic
1010261884 6:73826119-73826141 AGTATGAAGGAAGAAGTGGCCGG - Exonic
1011546384 6:88486199-88486221 ACGGGAAAGCAAGATGTGCCTGG + Intergenic
1013445845 6:110225703-110225725 AGGGTGAAGCAAGATGTCTGAGG - Intronic
1014439655 6:121459713-121459735 AGGAGGAAGCAAGATTTAGCTGG - Intergenic
1014538972 6:122651092-122651114 CGAGTGAAACAAGATGTGGTGGG + Intronic
1015723095 6:136266455-136266477 AGGATGAAGCTAGAGGTGGTAGG - Intronic
1018522816 6:164670346-164670368 AGGGCTAAGCAAGATGTGATCGG + Intergenic
1018630408 6:165817161-165817183 TGGGAGAAGAAAGATGTGACAGG - Intronic
1019069821 6:169335008-169335030 AGGTTTAAGCAAGGTGTGGAAGG - Intergenic
1020268089 7:6574998-6575020 AGGCTGAGGCAGGATGAGGCAGG - Intergenic
1021926751 7:25541217-25541239 AGGGTGAGGAAAGAGCTGGCAGG - Intergenic
1022818694 7:33937903-33937925 AGGGTGATGGAAAATGAGGCTGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023372106 7:39522025-39522047 AGGCTGAGGCAGGATGAGGCAGG + Intergenic
1024024986 7:45402360-45402382 AGGGTGGAGGAAGAGGTGTCTGG + Intergenic
1024323291 7:48089765-48089787 AGGGTGAAGCCAGAGCCGGCAGG + Intronic
1025039128 7:55624346-55624368 ATAAAGAAGCAAGATGTGGCTGG - Intergenic
1025797172 7:64749338-64749360 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1025923719 7:65939270-65939292 AGGTTGCAGCAAGACATGGCTGG + Intronic
1026141654 7:67712004-67712026 AGGGTGAGGCCAGATGGGGAAGG + Intergenic
1026613681 7:71883009-71883031 AAGGTAAAGTAAGATGAGGCTGG - Intronic
1026945740 7:74314856-74314878 AGGGGGCAGCAAGATGGGACTGG - Intronic
1028617601 7:92786885-92786907 AAGATAAATCAAGATGTGGCTGG + Intronic
1030155614 7:106451372-106451394 AGGTTGAAGCAAGATGGAGTTGG + Intergenic
1033877767 7:145843169-145843191 AGGGGAAAGCAACATGTGACAGG - Intergenic
1033981582 7:147171242-147171264 AGGCTGAAGCAAGAGGAGGCTGG - Intronic
1039553592 8:38460806-38460828 GAGGTGAAGCAGGAGGTGGCAGG - Intronic
1041810282 8:61901196-61901218 AGGTTTAAGCAAGATGTGGAAGG - Intergenic
1044084077 8:87921887-87921909 AGGGTGGGGCAGGAGGTGGCAGG - Intergenic
1044559347 8:93597187-93597209 AGGGAGAAGGAAGATGTCGCAGG - Intergenic
1044658919 8:94576741-94576763 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1045311429 8:101006641-101006663 ACGGAGAGGCAAGATGTGGTAGG - Intergenic
1047566243 8:126047107-126047129 AGGGTGATGCAGGGTGGGGCGGG - Intergenic
1049472941 8:142784350-142784372 AGGGTGAAGCTAGACTGGGCGGG - Intergenic
1049561390 8:143313252-143313274 AGAAAGAAGAAAGATGTGGCCGG + Intronic
1050847830 9:10245748-10245770 AGGGGGAAGACAGATGTGGCAGG + Intronic
1051262575 9:15279215-15279237 AGGGTGGAGCAAGATCATGCAGG - Intronic
1052012019 9:23421694-23421716 AGGGTGTAGAAAGAGGTGGAAGG + Intergenic
1053202494 9:36162293-36162315 AGCCTGAAGAAGGATGTGGCAGG - Intronic
1057051573 9:91928075-91928097 AGTGTGATGCAGGAGGTGGCGGG - Intronic
1057174184 9:92983777-92983799 AGGTTAAAGCAAGTTGTGGAAGG - Intronic
1060523952 9:124310017-124310039 AGGCTGGAGCAGGAAGTGGCAGG + Intronic
1060624170 9:125095286-125095308 GGGAAGAAGCAAGATTTGGCAGG - Intronic
1061430214 9:130526189-130526211 AAGGTGAAGGAAGAAATGGCTGG + Intergenic
1061590487 9:131594610-131594632 AGGGTGAAGCACCCTGTGGCAGG - Intronic
1061878785 9:133558071-133558093 AGAGTCAACCAAGATGGGGCAGG - Intronic
1061907295 9:133705229-133705251 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907308 9:133705278-133705300 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907321 9:133705327-133705349 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907334 9:133705380-133705402 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907347 9:133705433-133705455 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907370 9:133705531-133705553 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1202629303 M:3493-3515 AGGGTGATGGTAGATGTGGCGGG - Intergenic
1187579966 X:20596875-20596897 AGGGAGAGGCAAGAAGTGGAAGG + Intergenic
1189157839 X:38777761-38777783 AGTGAGAAGCAAGATGAGACTGG + Intergenic
1189269710 X:39742497-39742519 AGTGTGAAGAGAGATGGGGCTGG - Intergenic
1189563362 X:42213904-42213926 AGGGTGCAGAAAGATGTGAGAGG + Intergenic
1190619326 X:52269592-52269614 AGGGTGGAGTAGGATGGGGCGGG + Intergenic
1191005710 X:55709462-55709484 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1191842558 X:65523655-65523677 AGTGGGAAGCAAGAAGGGGCTGG - Exonic
1192433660 X:71129153-71129175 AAGGTGAAGGAGGATGCGGCAGG - Exonic
1193523345 X:82557517-82557539 AGGTTTAAGCAAGTTGTGGTAGG + Intergenic
1193705449 X:84815667-84815689 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic
1196074330 X:111558368-111558390 AGGTTTAAGCAAGCTGTGGAAGG - Intergenic
1197481226 X:126989020-126989042 AGGTTTAAGCAAGTTGTGGAAGG + Intergenic
1198435111 X:136609595-136609617 TGGGTGAAGGAAGAGGTGCCTGG - Intergenic
1198574563 X:137995954-137995976 AGGGTGATGAAAGAGGAGGCTGG + Intergenic
1198844660 X:140897993-140898015 AGGTTTAAGCAAGTTGTGGAAGG - Intergenic